Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Oct 1.
Published in final edited form as: J Immunol. 2014 Aug 29;193(7):3676–3682. doi: 10.4049/jimmunol.1401448

The E3 ubiquitin ligase TRIM33 is essential for cytosolic RNA-induced NLRP3 inflammasome activation

Leiyun Weng *, Hiroki Mitoma *, Coline Tricot *, Musheng Bao *, Ying Liu *, Zhiqiang Zhang *,†,1, Yong-Jun Liu *,‡,1
PMCID: PMC4170004  NIHMSID: NIHMS620365  PMID: 25172487

Abstract

NLRP3 is a key component of caspase-activating macromolecular protein complexes called inflammasomes. It has been found that DHX33 is a cytosolic double-stranded RNA (dsRNA) sensor for the NLRP3 inflammasome, which induces caspase-1-dependent production of IL-1β and IL18 upon activation. However, how the cytosolic dsRNAs induce the interaction between DHX33 and the NLRP3 inflammasome remains unknown. Here, we report that TRIM33, a member of the tripartite motif (TRIM) family, can bind DHX33 directly and induce DHX33 ubiquitination via the lysine 218 upon dsRNA stimulation. Knocking down of TRIM33 abolished the dsRNA-induced NLRP3 inflammasome activation in both THP-1-derived macrophages and human monocyte-derived macrophages. The ubiquitination of DHX33 by TRIM33 is lysine 63-specific and is required for the formation of the DHX33-NLRP3 inflammasome complex.

Introduction

TRIM (tripartite-motif) family proteins contain RBCC motifs, which consist of the RING (really interesting new gene 1) finger domain, B-box motif, and a coiled-coil domain (1, 2). Most of the TRIM family members are E3 ubiquitin (Ub) ligases. These proteins interact with Ub-conjugating enzymes (E2) via their RING domains and transfer Ub from Ub-activating enzymes (E1) to the target molecules (3–5). Many TRIM members are interferon (IFN)-stimulated genes (ISGs) and play important roles in a broad range of immune responses including anti-microbial infection (6, 7). It has been reported that TRIM25 ubiquitinates the caspase recruitment domains (CARD) of retinoic acid inducible gene I (RIG-I), and this ubiquitination activity is essential for the activation of downstream antiviral innate immune responses (8). TRIM5α has been intensively studied with its well-known retroviral restriction activity (9). TRIM21 negatively regulates an intracellular dsDNA sensing pathway by ubiquitinating and degrading DDX41 (10). TRIM30α induces TAB2 and TAB3 ubiquitination and degradation, and it inhibits TRAF6-induced NF-κB activation (11). Ubiquitination of stimulator of interferon gene (STING) by TRIM56 is essential for STING dimerization and IFNβ promoter activation (12).

TRIM33, previously known as transcriptional intermediary factor 1 gamma (TIF1-γ), has been shown to function in transcriptional regulation during hematopoiesis (13). It is also reported to have tumor suppressor activity in multiple tissues (14, 15). A recent study reported that TRIM33 functions in DNA repair (16). It is unknown whether TRIM33 plays a role in the innate immune system.

Inflammasomes are caspase-activating multiprotein complexes that were identified in 2002 (17). NLRP3 is a member of Nod-like receptors (NLRs). Upon activation, NLRP3 forms a macromolecular signaling complex with its adaptor protein ASC and procaspase-1 called the NLRP3 inflammasome (18, 19). This leads to the cleavage and activation of caspase-1, which in turn processes the proforms of IL-1β and IL18 to generate biologically active cytokines (20). Multiple types of stimulatory signals can activate the NLRP3 inflammasome, including ATP, crystalline reagents and microbial toxin nigericin (19, 21, 22). It’s believed that these stimuli may activate the NLRP3 inflammasome via different pathways (23–26). Our laboratory has recently reported that DHX33, a member of DExD/H-box helicase family, is a cytosolic double stranded RNA (dsRNA) sensor for the NLRP3 inflammasome (27). However, the mechanism of how the cytosolic RNA induces the activation of the DHX33-NLRP3 inflammasome is unclear. Here, we report that TRIM33 ubiquitinates DHX33 and is essential for the cytosolic RNA-induced NLRP3 inflammasome activation. When TRIM33 is knocked down in human macrophages, the dsRNA-induced NLRP3 inflammasome activation is blocked. TRIM33 binds DHX33 directly and induces lysine 63 (K63)-specific ubiquitination of DHX33, which is essential for the formation of the DHX33-NLRP3 complex.

Materials and Methods

Plasmids

For reconstitution of TRIM33, TRIM33 cDNA was subcloned into pCMV vectors coding for HA- and Myc-tagged proteins (Clontech). Various primers were designed and used for the generation of truncations using HA-tagged full-length TRIM33 as template. All of the PCRs were carried out according to a standard procedure. HA-tagged DHX33 lysine-to-arginine mutants were obtained using a site-directed mutagenesis kit (Agilent, Life Technologies) according to the manufacturer’s manual.

Cell culture

HEK293T cells were maintained in DMEM medium with 10% fetal bovine serum (FBS). THP-1 cells, a human acute monocytic leukemia cell line, were maintained in RPMI-1640 medium containing 10% FBS, 2 mM L-glutamine and 50 µM β-mercaptoethanol. All of the FBS was heat inactivated before use.

Differentiation and stimulation of THP-1 macrophages

As described previously (27), THP-1 cells were differentiated to macrophages with 60 nM phorbol 12-myristate 13-acetate (PMA; Sigma) for 16 hrs, and cells were cultured for an additional 48h without PMA. Differentiated cells were stimulated for 8 hrs in 96 well-plates with one of the following conditions: 5 µg/ml high molecular weight (HMW) poly I:C (Invivogen) plus Lipofectamine 2000, 5 µg/ml low molecular weight (LMW) poly I:C (Invivogen) or 1 µg/ml poly dA:dT (Invivogen) plus Lipofectamine 2000, 2.5 µg/ml reoviral genomic RNA plus Lipofectamine 2000 and 2.5 µg/ml bacterial RNA plus Lipofectamine 2000, or 2 µM nigericin (Invivogen). Culture supernatants were collected to measure cytokines IL-1β and IL-18 using ELISA and cleavage of caspase-1 using immunoblot. Cells were harvested for real-time PCR or immunoblot analysis.

Lentivirus production and infection

The shRNA targeting sequences for human TRIM33, DHX33, NLRP3 and caspase-1 are the following (5’ to 3’): shTRIM33-1: AACTGGAAAGTAATCAGTCGC; shTRIM33-2: ATTAGGAGTATAACCAGGAGC; shDHX33-1: CATTTCCTTTAGAACCCAAAT; shDHX33-2: GTTGACACGGGCATGGTTAAA; shNLRP3: GCGTTAGAAACACTTCAAGAA; shcaspase-1: CTACAACTCAATGCAATCTTT.

The scrambled or gene-specific targeting shRNAs (Open Biosystems) in PLKO.1 vector were transfected to HEK293T cells together with packaging plasmid psPAX2 and envelope-encoding plasmid pMD2G using Lipofectamine 2000 (Life Technologies), for production of lentiviral particles. The supernatants of transfected HEK293T cells were harvested 24 and 48 hrs post transfection and then were centrifuged at 1500 rpm for 15 min before infection. THP-1 cells were infected with the lentiviral particles containing supernatants in the presence of 8 µg/ml polybrene (Sigma), followed by centrifugation at 3500 rpm for 1 hr. The medium was changed to fresh complete medium 6 hrs post infection. The infected THP-1 cells were cultured for another 48 hrs before antibiotic selection using 5 µg/ml puromycin (Invivogen). The knockdown efficiency of each shRNA was examined by real-time PCR and/or immunoblot analysis after 3 days of puromycin selection.

Isolation of reoviral genomic RNA

As described before (27), Vero cells were infected with reovirus serotype 3 (VR-824, ATCC) at a multiplicity of infection (MOI) of 0.1 PFU/cell. The supernatant was collected 48 hrs post viral infection, centrifuged at 2500 rpm for 30 min, and then passed through 0.45 µm filters. The filtered supernatant was centrifuged at 21,000 rpm for 180 min. The viral pellet was resuspended in RLT Buffer (RNeasy kit, Qiagen), which was followed by RNA extraction according to the manufacturer’s manual.

Isolation and stimulation of human monocyte-derived macrophages

As described before (27), buffy coats of blood samples from healthy donors were used for isolation of peripheral blood monocytes. Monocytes were isolated using RosetteSep™ Human Monocyte Enrichment Cocktail (STEMCELL Technologies) and were differentiated into macrophages in RPMI-1640 medium containing 10% FBS, 2 mM L-glutamine and 10 ng/ml M-CSF (Life Technologies) for 10 days. Scramble or gene-specific siRNAs (Dharmacon) were transfected into macrophages using HiPerFect Transfection Reagent (Qiagen). At 48 hrs post transfection, cells were stimulated with the indicated dsRNA plus Lipofectamine 2000 for 8 hrs before the culture supernatants were harvested for cytokine expression analysis. For respiratory syncytial virus (RSV) infection, we first incubated the RSV (B strain, from Advanced Biotechnologies Inc) with the macrophages at a MOI of 1 in Opti-MEM reduced-serum medium (Life Technologies) for 2 hrs as described before (27), followed by washing and continued culturing with complete culture medium for 8 hrs before the supernatants were collected for ELISA assay.

Enzyme-linked immunosorbent assay (ELISA)

The concentration of secreted human IL-1β and IL-18 in culture supernatants was measured by ELISA kits (IL-1β, BD Biosciences; IL-18, MBL International) according to the manufacturers’ instructions.

Immunoblot analysis

Proteins were probed with a primary antibody as follows: polyclonal rabbit anti-TRIM33 (8972S, Cell Signaling), polyclonal rabbit anti-DHX33 (sc-137424; Santa Cruz), monoclonal mouse anti-NLRP3 (Cryo-2) (ALX-804-881-C100; Enzo Life Sciences), monoclonal rabbit anti-caspase-1 (D7F10) (3866; Cell Signaling) and monoclonal mouse anti-GAPDH (G9295; Sigma).

Expression and purification of recombinant proteins in HEK293T cells

PCMV-HA plasmid encoding human DHX33 was transfected to HEK293T cells. At 36 hrs post transfection, cells were harvested, and the expressed HA-tagged human DHX33 protein was purified using anti-HA beads (Sigma). After washing, the recombinant protein was eluted from the beads using acidic elution buffer (0.1 M glycine-HCl pH 2.5) and then the pH was adjusted to around 7.5 using 1M Tris-HCl pH 9.0.

Co-immunoprecipitation assays using transfected HEK293T cells

pCMV vectors encoding Myc-tagged and HA-tagged expression plasmids were co-transfected to HEK293T cells using Lipofectamine 2000. Cells were lysed 36 hrs after transfection in the lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Nonidet-P40, 5 mM EDTA and 1 mM DTT). Cell lysates were immunoprecipitated by anti-HA beads (Sigma).

Endogenous immunoprecipitation assays using stimulated THP-1 macrophages

THP-1 cells were differentiated with 60 nM PMA for 16 hrs and then treated with 5 µg/ml HMW poly I:C plus Lipofectamine 2000 for 2 hrs or 2 µM nigericin for 45 min. For overexpression in THP-1 cells, HA-tagged DHX33 wild type or K218R mutant was transfected to THP-1 cells for 24 hrs before stimulation. Stimulated cells were washed with 1X PBS once and then resuspended in 1X lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.3% Nonidet-P40, 1 mM EDTA and 1 mM DTT). Cell lysates were immunoprecipitated with isotype control rabbit IgG, anti-DHX33 antibody (NB100-2581, Novus Biologicals) or anti-TRIM33 (8972S, Cell Signaling) for 4 hrs followed by 1 hr incubation with Protein-G Sepharose (Thermo Scientific).

Real-time PCR

RNAs from about 0.2 million cells were isolated using the RNeasy Micro Kit (Qiagen) and used for synthesis of cDNA with iScript cDNA Synthesis Kit (Bio-Rad). The iTaq SYBR Green Supermix with ROX (Bio-Rad) was used for Real-time PCR. The housekeeping gene GAPDH was used as internal control to normalize the amount of cDNA among different samples.

Ubiquitination assay in HEK293T overexpression system

HEK293T cells were co-transfected with expression plasmids encoding HA empty vector, HA-tagged full-length wild type or mutant DHX33 together with Myc-tagged TRIM33, using Lipofectamine 2000. The protease inhibitor MG132 (10 µM, Sigma) was added 10 hrs before harvest. At 36 hrs post transfection, cells were harvested and lysed for immunoprecipitation with anti-HA beads and then followed by immunoblotting of HA.

In vitro ubiquitination assay

An in vitro ubiquitination assay was performed as described (10). Briefly, 2 ng of mammalian-derived HA-tagged DHX33 and Myc-tagged TRIM33 proteins were incubated with E1 (100 ng), E2 (500 ng) and ubiquitin (2.5 µg) in 50 µl assay buffer (50 mM Tris-HCl pH 7.5, 2.5 mM MgCl2, 0.5 mM DTT and 2 mM ATP). Reactions were incubated at 30°C for 2 hrs. Then, samples were loaded to SDS-PAGE gel and analyzed by immunoblotting.

Results

TRIM33 plays a critical role in cytosolic poly I:C-induced NLRP3 inflammasome activation in THP-1-derived macrophages

Helicase DHX33 is a critical cytosolic dsRNA sensor for the NLRP3 inflammasome (27). To further investigate how DHX33 is regulated in dsRNA-induced the NLRP3 inflammasome, we identified DHX33-interacting proteins by immunoprecipitation with antibody to DHX33 (anti-DHX33) in THP-1 cells, followed by protein sequencing by liquid chromatography–mass spectrometry. We found that the E3 ubiquitin ligase TRIM33 was in a DHX33-interacting protein complex. We then examined whether TRIM33 also functions in NLRP3 inflammasome activation. We checked this function by stable knockdown of TRIM33 using short-hairpin RNA (shRNA) in THP-1-derived macrophages. Two distinct TRIM33-targeting shRNAs that showed good knockdown efficiency were selected. We then stimulated those THP-1-derived macrophages with HMW poly I:C delivered by Lipofectamine 2000 and measured IL-1β and IL-18 in the culture supernatants by ELISA. Consistent with published data, knockdown of DHX33 or NLRP3 abrogated the production of IL-1β and IL-18 (Fig. 1A) as well as the cleavage of caspase-1 (Fig. 1B) that was induced by intracellular poly I:C (27–29). Interestingly, knockdown of TRIM33 also reduced the production of IL-1β and IL-18 and the cleavage of caspase-1 by THP-1-derived macrophages in response to intracellular HMW poly I:C (Fig. 1A and 1B). DHX33 is specifically involved in a cytosolic dsRNA-induced inflammasome activation pathway, but does not respond to other stimuli such as nigericin. Similar to the knocking down of DHX33, knocking down of TRIM33 in THP-1-derived macrophages did not affect the production of IL-1β and IL-18 (Fig. 1C) or the cleavage of caspase-1 (Fig. 1D) in response to nigericin. Both caspase-1 and NLRP3 are dispensable for the nigericin pathway. We also examined the TRIM33 function in THP-1-derived macrophages in response to LMW poly I:C and poly dA:dT. Similar to HMW poly I:C, the LWM poly I:C induced IL-1β production decreased dramatically in TRIM33-knockdown cells (Fig. 1E). By contrast, knockdown of TRIM33 or DHX33 did not affect poly dA:dT induced IL-1β production (Fig. 1E). The knockdown efficiency of the shRNAs targeting TRIM33, DHX33, caspase-1 and NLRP3 were shown in Fig. 1F. Taken together, these data indicate that TRIM33 is specifically involved in poly I:C-induced DHX33-dependent NLRP3 inflammasome activation, but not in nigericin-induced NLRP3 inflammasome activation.

Figure 1.

Figure 1

TRIM33 plays a critical role in cytosolic poly I:C-induced NLRP3 inflammasome activation in THP-1-derived macrophages. (A-D) THP-1 macrophages were stimulated with 5 µg/ml cytosolic HMW poly I:C delivered by Lipofectamine 2000 (A and B) or 2 µM nigericin (C and D) for 8 hrs. The supernatants (sup) were collected for analysis of secreted IL-1β and IL-18 by ELISA assay (A and C) and cleaved caspase-1 by IB (B and D). The expression levels of pro-caspase-1 and GAPDH proteins in stimulated cells (lysate) were also analyzed by IB (B and D). THP-1 macrophages with shSCR and treated with Lipofectamine 2000 alone (A and B) or medium (C and D) were used as mock. (E) ELISA assay of IL-1β production of THP-1 macrophages stimulated by 5 µg/ml cytosolic LMW poly I:C or poly dA:dT delivered by Lipofectamine 2000. (F) The protein expression levels of TRIM33, DHX33, caspase-1, NLRP3 and GAPDH were analyzed by IB in THP-1 macrophages with gene-specific shRNA or scramble shRNA (shSCR). GAPDH was shown for normalization of proteins.

TRIM33 plays a critical role for cytosolic dsRNA-induced NLRP3 inflammasome activation in human primary monocyte-derived macrophages

We next determined the role of TRIM33 in human primary monocyte-derived macrophages (hPMDM). We used small interfering RNA (siRNA) to knock down TRIM33, DHX33 and NLRP3. As shown in Fig. 2A by real-time PCR, all of the three siRNAs showed more than 60% knock down of mRNA levels. Knocking down TRIM33 in hPMDM reduced the secretion of IL-1β and IL18 in response to cytosolic HMW poly I:C, as measured by ELISA (Fig. 2B). To determine the role of TRIM33 in response to microbial RNA stimulation, we isolated bacterial total RNA and reoviral RNA. In cells with scramble siRNA (siSCR), large amounts of IL-1β and IL18 were produced upon stimulation with cytosolic bacterial and reoviral RNAs (Fig. 2C and 2D). These levels of IL-1β and IL18 were reduced dramatically in DHX33-knockdown cells or in NLRP3-knockdown cells, which confirmed a previous study showing that DHX33 and NLRP3 play critical roles in sensing microbial RNA to activate inflammasomes (27). TRIM33 knockdown resulted in about a 60%–70% reduction in IL-1β and IL18 secretion in response to cytosolic bacterial RNA or reoviral RNA (Fig. 2C and 2D). To further determine the role of TRIM33 in response to viral infection, siRNA treated hPMDM were infected with RSV, which generates dsRNA intermediates during the replication (30). The induced IL-1β and IL18 expression levels in the RSV infected hPMDM supernatants were measured by ELISA. Both the IL-1β and IL18 production decreased dramatically when TRIM33, DHX33 or NLRP3 is absent as compared to scramble siRNA knock down. These results indicated that TRIM33 play a critical role in cytosolic dsRNA-inducted NLRP3 inflammasome activation in hPMDM cells.

Figure 2.

Figure 2

TRIM33 plays a critical role in cytosolic dsRNA-induced NLRP3 inflammasome activation in human primary monocyte-derived macrophages (hPMDM). (A) The mRNA levels of TRIM33, DHX33 and NLRP3 in hPMDM were measured by real-time PCR 48 hrs post-siRNA transfection. (B-E) ELISA detection of IL-1β and IL-18 secretion by hPMDM cells after stimulation. Cells were stimulated with 5 µg/ml cytosolic HMW poly I:C (B), 2.5 µg/ml bacterial RNA (C) and 2.5 µg/ml Reoviral RNA (D) delivered by Lipofectamine 2000, or respiratory syncytial virus (RSV) for 8 hrs before the culture supernatants (sup) were collected for ELISA assay. hPMDM with siSCR and treated with Lipofectamine 2000 alone were used as mock.

TRIM33 binds to DHX33 directly and induces K63-linked ubiquitination

Since we found that TRIM33 is in a DHX33-interacting protein complex and TRIM33 is an E3 ubiquitin ligase, we next investigated whether DHX33 is the ubiquitination target of TRIM33. HA-tagged DHX33 or Myc-tagged TRIM33 was expressed and purified from 293T cells, and were shown by Coomassie Brilliant Blue staining together with commercially obtained TRIM25 and RIG-I (Fig. 3A, left panel). In vitro pull-down assay experiments show that TRIM33 binds DHX33 in a dose-dependent manner (Fig. 3A, right panel). By contrast, TRIM25, an E3 ligase regulating the sensing of RNA viruses by RIG-I, does not bind DHX33. To determine whether TRIM33 modified DHX33 directly, we performed an in vitro ubiquitination assay with TRIM33 and DHX33. In the presence of E1, E3 ligase TRIM33, ubiquitin substrate and ATP, DHX33 is ubiquitinated strongly by a specific E2 enzyme (Ubc H13). Two other E2 enzymes, Ubc H5c and H6, can also marginally ubiquitinate DHX33 by TRIM33 (Fig. 3B). Using K48-specific or K63-specific ubiquitin substrates, we observed that the ubiquitination of DHX33 was mediated by TRIM33 via K63 linkage but not K48 linkage (Fig. 3C). To determine whether RIG-I is the ubiquitination target of TRIM33, we performed the ubiquitination assay with RIG-I, TRIM33 or TRIM25. As shown in Fig. 3D, RIG-I is ubiquitinated strongly by TRIM25, but not by TRIM33. These results demonstrated that TRIM33 binds to DHX33 and induces the ubiquitination of DHX33 specifically by K63 linkage.

Figure 3.

Figure 3

TRIM33 binds to DHX33 directly and induces K63-linked ubiquitination. (A) In vitro pull-down assay using purified proteins. Left panel shows 1 µg proteins of DHX33, TRIM33, TRIM25 and RIG-I followed by staining with Coomassie Brilliant Blue (Bio-Rad). 1 µg of HA-DHX33 was incubated with 0.5 µg, 1 µg and 2 µg of Myc-tagged TRIM33 or TRIM25 for 2 hrs followed by Myc-beads pull-down and IB with anti-HA antibody (right panel). (B) In vitro ubiquitination assay using purified TRIM33 and DHX33. Together with E1, Ub, ATP and 10 different E2, the proteins were incubated at 30 °C for 2 hrs before sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis with anti-ub antibody. (C) In vitro ubiquitination assay using K48- or K63- linked Ub as a substrate. Together with E1, ATP and E2 (Ubc H13), TRIM33 and DHX33 were incubated with K48- or K63-linked Ub under the same conditions for 2 hrs followed by Ub IB. (D) In vitro ubiquitination assay of RIG-I or DHX33 by TRIM33 or TRIM25. In the presence of E1, Ubc 5c E2, Ub and ATP, TRIM33 was incubated with RIG-I, while TRIM33 with DHX33 and TRIM25 with RIG-I combinations were also tested as controls.

TRIM33 binds the HA2-DUF region of DHX33 via its BBC domain

We next determined the interaction domains between TRIM33 and DHX33. We generated three truncations of HA-tagged DHX33 with a deletion of the C-terminal DUF domain (dDUF), the HA2 domain (dHA2) or the N-terminal DEXDc and HELICc domains (dHELICc) (Fig. 4A, top panel). We co-expressed the full length DHX33 or the C-terminus of DHX33 consisting of both HA2 domain and DUF domain with Myc-tagged TRIM33 and co-immunoprecipitated (co-IP) using anti-Myc beads. We found that either version of DHX33 could bind TRIM33 (Fig. 4A, bottom panel), indicating that DHX33 binds TRIM33 via the C-terminal HA2-DUF region. Likewise, we generated and expressed truncated forms of HA-TRIM33 in 293T cells along with Myc-DHX33. Co-IP experiments showed that the truncated version of TRIM33 that lacked the BBC domain was no longer pulled down by DHX33 (Fig. 4B), indicating that the BBC domain of TRIM33 binds DHX33.

Figure 4.

Figure 4

TRIM33 binds to the HA2 domain of DHX33 via its C-terminal BBC domain. Schematic structures of full length (FL) and three truncations of DHX33 (A, top panel) and FL and seven truncations of TRIM33 (B, top panel) were shown. Numbers represent amino acid residues. Domain mapping of DHX33 and TRIM33 interactions was shown in the bottom panels (A and B). HA-tagged FL and truncation constructs were co-expressed with Myc-tagged TRIM33 (A) or DHX33 (B) followed by IP with Myc-beads and then IB of HA to detect the interacting molecules (middle panel). 5% input of HA-tagged truncations and FL construct is shown in bottom panels (IP Myc, IB HA), while input of Myc-tagged FL protein is shown as input. DEXDc: DEAD-like helicases superfamily domain; HELICc: helicase C-terminal domain. HA2: Helicase-associated domain; DUF: domain of unknown function. RING: really interesting new gene. BB1: B-box motif 1. BB2: B-box motif 2. BBC: B-box C terminal domain. PHD: plant homeo domain. Brom: bromodomain.

TRIM33 ubiquitinates DHX33 at lysine 218

To determine whether TRIM33 is the main E3 ligase for the ubiquitination of DHX33, we performed an in vivo ubiquitin assay on THP-1-derived macrophages. Upon stimulation with HMW poly I:C for 2 hrs, we detected the poly-ubiquitinated DHX33 (Ub-DHX33) in scramble knockdown cells, while nigericin stimulation didn’t generate detectable ubiquitinated DHX33 (Fig. 5A). When we knock down DHX33 in THP-1 macrophages using TRIM33-specific shRNA, the Ub-DHX33 is not detectable any more after HMW poly I:C stimulation (Fig. 5A). This result indicates that poly I:C-induced DHX33 ubiquitination in THP-1-derived macrophages is dependent on TRIM33.

Figure 5.

Figure 5

TRIM33 ubiquitinates DHX33 at lysine 218. (A) Immunoblot of DHX33 in THP-1-derived macrophages after stimulation with HMW poly I:C or nigericin in scramble or TRIM33-specific shRNA knockdown cells. After 2 hrs of HMW poly I:C or 45 min of nigericin treatment, THP-1 macrophages were collected and cytoplasmic components were extracted for SDS-PAGE and DHX33 IB (top panel). TRIM33 protein was determined using anti-TRIM33 antibody, and GAPDH was a loading control (bottom panel). (B) Immunoblotting of Ub after HA IP from HEK293T cells co-transfected with Myc-TRIM33 and HA-DHX33 wild type and 10 mutants. Empty HA vector was used as a control (top panel). Cells were harvested 36 hrs post transfection, and cell lysates were loaded for detection of input DHX33 amount by HA IB (middle panel). GAPDH was used as loading control.

In order to determine the residue on DHX33 that is ubiquitinated by TRIM33, we predicted the lysine sites of DHX33 that might be ubiquitinated using BDM-PUB online tool (http://bdmpub.biocuckoo.org/results.php). When the ubiquitination threshold was adjusted to 1.35, the tool predicted 11 putative ubiquitination target sites (Table S1). We therefore replaced each of the eleven lysine residues in DHX33 individually with arginine. We co-expressed the HA-tagged wild type or mutations of DHX33 together with Myc-TRIM33 in HEK293T cells and stimulated the cells with HMW poly I:C for 2 hrs. Using the approach of an immunoprecipitation assay with anti-HA beads and followed by Ub immunoblotting, we were able to demonstrate that the K218R substitution blocked ubiquitination of DHX33 (Fig. 5B). These data indicated that TRIM33 is the main E3 ligase to induce the ubiquitination of DHX33 and this occurred on lysine 218.

TRIM33 is essential for DHX33-NLRP3 inflammasome formation upon dsRNA stimulation

Since DHX33 forms a complex with NLRP3 in response to cytosolic dsRNA (27), we next examined whether TRIM33 plays a role in the DHX33-NLRP3 complex formation. THP-1-derived macrophages with scramble and TRIM33-specific (shTRIM33) stable knockdown were stimulated with HMW poly I:C or nigericin for 2 hrs before harvesting and cell lysis. Immunoprecipitation was performed using anti-DHX33 followed by immunoblotting for DHX33, TRIM33 and NLRP3. As shown in Fig. 6A, both TRIM33 and NLRP3 were present with DHX33 only when stimulated with HMW poly I:C in scramble knockdown macrophages but not in nigericin-stimulated cells. Furthermore, when TRIM33 is absent by stable knockdown using shTRIM33, the interaction of NLRP3 with DHX33 is no longer detectable after HMW poly I:C stimulation; neither was it detectable after nigericin stimulation, which indicates that TRIM33 is essential and specific for poly I:C-induced DHX33-NLRP3 complex formation.

Figure 6.

Figure 6

TRIM33 is essential for DHX33-NLRP3 inflammasome formation upon dsRNA stimulation. (A) Endogenous IP of DHX33 in THP-1-derived macrophages treated with scramble (shSCR) or TRIM33-specific shRNA (shTRIM33) and stimulated with HMW poly I:C or nigericin. Isotype antibody (IgG) was also used for IP as a control. The IP samples were blotted with antibodies anti-NLRP3 and anti-DHX33 (IP section). 5% of the lysate was loaded as input and blotted with anti-TRIM33, anti-DHX33 and anti-NLRP3 antibodies (input section). GAPDH was used as a loading control. (B) IP of DHX33 in THP-1-derived macrophages transfected with HA tagged DHX33 wild type and K218R mutant plasmids using HA beads. 5% of each cell lysate was loaded as input. The IP samples and inputs were blotted with antibodies anti-HA, anti-NLRP3 and anti-TRIM33.

To further determine the ubiquitination effect on DHX33-NLRP3 complex formation, we overexpressed HA-tagged DHX33 wild type and the lysine 218 mutant (K218R) in THP-1 macrophages. The macrophages were stimulated with HMW poly I:C or nigericin, followed by HA IP. As shown in Fig. 6B, both NLRP3 and TRIM33 were pulled down by wild type DHX33. However, the DHX33 K218R mutant, which abolished the DHX33 ubiquitination by TRIM33, only pulled down TRIM33 but not NLRP3. Neither the wild type nor the K218R mutant DHX33 can pull down TRIM33 or NLRP3 after nigericin stimulation (Fig. 6B). These data indicate that the ubiquitination of DHX33 at lysine 218 by TRIM33 is required to form the DHX33-NLRP3 complex, and thus is also required for NLRP3 inflammasome activation.

Discussion

In this study, we have presented data showing that the E3 ubiquitin ligase TRIM33 plays a critical role in the cytosolic dsRNA-induced NLRP3 inflammasome activation by targeting the dsRNA sensor DHX33. Knockdown of TRIM33 in THP-1-derived or human primary monocyte-derived macrophages results in reduced NLRP3 inflammasome activation in response to cytosolic dsRNA. TRIM33 binds DHX33 in macrophages and induces the K63-linked poly-ubiquitination of DHX33 upon cytosolic dsRNA stimulation. TRIM33 ubiquitinates DHX33 at lysine 218. DHX33 interacts with TRIM33 via the HA2-DUF region and the BBC domain. This interaction is essential for the activation and formation of the DHX33-NLRP3 inflammasome complex upon dsRNA stimulation. Various stimuli have been shown to activate the NLRP3 inflammasome, including the bacterial toxin nigericin, LPS plus ATP treatment, and cytosolic nucleic acids (26). DHX33 has been identified as the cytosolic dsRNA sensor that induces NLRP3 inflammasome activation.TRIM33 is the main E3 ligase of DHX33, specifically regulating the formation of the cytosolic dsRNA-induced NLRP3 inflammasome.

Most of the TRIM family members are E3 ubiquitin ligases, and they have been reported to mediate both K48- and K63-linked ubiquitination. Two well-studied examples of TRIM protein ubiquitination of helicase family members are the reports that TRIM25 ubiquitinates RIG-I by K63-specific linkage and TRIM21 ubiquitinates DDX41 by K48-specific linkage (8, 10). Some other TRIM members that are important in regulating the innate immune response have also been reported. TRIM56 was reported to ubiquitinate and activate the STING molecule, which is a key adaptor for DNA sensors (12). TRIM38 was reported to target TRAF6 for degradation via K48-linked ubiquitination (31).

As important intracellular anti-microbial machinery (32), the inflammasome needs precise regulation of its activation. Our results showed that TRIM33-induced DHX33 ubiquitination is essential for the DHX33-NLRP3 inflammasome formation and function, as shown by ELISA detection of IL1β and IL18 production as well as our endogenous IP experiments. In contrast to cytosolic dsRNA, TRIM33-DHX33 is not involved in the NLRP3 activation that is induced by nigericin, which is believed to utilize a different activation pathway (33).

It has been reported that TRIM33 is involved in erythroid differentiation, tumor suppression and the autoimmune disease dermatomyositis (34–37). Our study found another important function of TRIM33 in regulating NLRP3 activation in response to bacterial and viral infection. This finding will further shed light on the clinical application of TRIM33 for various diseases including microbial infections.

Supplementary Material

1

Highlights.

  1. TRIM33 is involved in cytosolic dsRNA-induced inflammasome activation.

  2. Knockdown of TRIM33 abolishes the production of IL-1β and IL-18 in response to cytosolic dsRNA.

  3. TRIM33 binds to DHX33 both in vitro and in vivo.

  4. TRIM33 ubiquitinates DHX33 in a lysine 63-specific manner.

  5. TRIM33 is essential for dsRNA-induced DHX33-mediated NLRP3 inflammasome activation and formation.

Acknowledgements

We thank Dr. Carson Harrod at Baylor Institute for Immunology Research for critical reading of the manuscript. We also thank all of the colleagues in our laboratory for helpful discussions.

This work was supported by the US National Institutes of Health (R37 AI091947).

Abbreviations used in this article

dsRNA

double-stranded RNA

HA

Hemagglutinin

hPMDM

human primary monocyte-derived macrophages

IB

immunoblot

IP

immunoprecipitation

shRNA

short-hairpin RNA

shSCR

scramble shRNA

siRNA

small interfering RNA

siSCR

scramble siRNA

TRIM

tripartite motif

Footnotes

Disclosures

The authors declared no conflicts of interest.

References

  • 1.Meroni G, Diez-Roux G. TRIM/RBCC, a novel class of 'single protein RING finger' E3 ubiquitin ligases. BioEssays : news and reviews in molecular, cellular and developmental biology. 2005;27:1147–1157. doi: 10.1002/bies.20304. [DOI] [PubMed] [Google Scholar]
  • 2.Reymond A, Meroni G, Fantozzi A, Merla G, Cairo S, Luzi L, Riganelli D, Zanaria E, Messali S, Cainarca S, Guffanti A, Minucci S, Pelicci PG, Ballabio A. The tripartite motif family identifies cell compartments. The EMBO journal. 2001;20:2140–2151. doi: 10.1093/emboj/20.9.2140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Joazeiro CA, Weissman AM. RING finger proteins: mediators of ubiquitin ligase activity. Cell. 2000;102:549–552. doi: 10.1016/s0092-8674(00)00077-5. [DOI] [PubMed] [Google Scholar]
  • 4.Rajsbaum R, Garcia-Sastre A, Versteeg GA. TRIMmunity: the roles of the TRIM E3-ubiquitin ligase family in innate antiviral immunity. Journal of molecular biology. 2014;426:1265–1284. doi: 10.1016/j.jmb.2013.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Liu YC. Ubiquitin ligases and the immune response. Annual review of immunology. 2004;22:81–127. doi: 10.1146/annurev.immunol.22.012703.104813. [DOI] [PubMed] [Google Scholar]
  • 6.McNab FW, Rajsbaum R, Stoye JP, O'Garra A. Tripartite-motif proteins and innate immune regulation. Current opinion in immunology. 2011;23:46–56. doi: 10.1016/j.coi.2010.10.021. [DOI] [PubMed] [Google Scholar]
  • 7.Carthagena L, Bergamaschi A, Luna JM, David A, Uchil PD, Margottin-Goguet F, Mothes W, Hazan U, Transy C, Pancino G, Nisole S. Human TRIM gene expression in response to interferons. PloS one. 2009;4:e4894. doi: 10.1371/journal.pone.0004894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gack MU, Shin YC, Joo CH, Urano T, Liang C, Sun L, Takeuchi O, Akira S, Chen Z, Inoue S, Jung JU. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature. 2007;446:916–920. doi: 10.1038/nature05732. [DOI] [PubMed] [Google Scholar]
  • 9.Stremlau M, Owens CM, Perron MJ, Kiessling M, Autissier P, Sodroski J. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature. 2004;427:848–853. doi: 10.1038/nature02343. [DOI] [PubMed] [Google Scholar]
  • 10.Zhang Z, Bao M, Lu N, Weng L, Yuan B, Liu YJ. The E3 ubiquitin ligase TRIM21 negatively regulates the innate immune response to intracellular double-stranded DNA. Nature immunology. 2013;14:172–178. doi: 10.1038/ni.2492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Shi M, Deng W, Bi E, Mao K, Ji Y, Lin G, Wu X, Tao Z, Li Z, Cai X, Sun S, Xiang C, Sun B. TRIM30 alpha negatively regulates TLR-mediated NF-kappa B activation by targeting TAB2 and TAB3 for degradation. Nature immunology. 2008;9:369–377. doi: 10.1038/ni1577. [DOI] [PubMed] [Google Scholar]
  • 12.Tsuchida T, Zou J, Saitoh T, Kumar H, Abe T, Matsuura Y, Kawai T, Akira S. The ubiquitin ligase TRIM56 regulates innate immune responses to intracellular double-stranded DNA. Immunity. 2010;33:765–776. doi: 10.1016/j.immuni.2010.10.013. [DOI] [PubMed] [Google Scholar]
  • 13.He W, Dorn DC, Erdjument-Bromage H, Tempst P, Moore MA, Massague J. Hematopoiesis controlled by distinct TIF1gamma and Smad4 branches of the TGFbeta pathway. Cell. 2006;125:929–941. doi: 10.1016/j.cell.2006.03.045. [DOI] [PubMed] [Google Scholar]
  • 14.Herquel B, Ouararhni K, Khetchoumian K, Ignat M, Teletin M, Mark M, Bechade G, Van Dorsselaer A, Sanglier-Cianferani S, Hamiche A, Cammas F, Davidson I, Losson R. Transcription cofactors TRIM24, TRIM28, and TRIM33 associate to form regulatory complexes that suppress murine hepatocellular carcinoma. Proceedings of the National Academy of Sciences of the United States of America. 2011;108:8212–8217. doi: 10.1073/pnas.1101544108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Aucagne R, Droin N, Paggetti J, Lagrange B, Largeot A, Hammann A, Bataille A, Martin L, Yan KP, Fenaux P, Losson R, Solary E, Bastie JN, Delva L. Transcription intermediary factor 1gamma is a tumor suppressor in mouse and human chronic myelomonocytic leukemia. The Journal of clinical investigation. 2011;121:2361–2370. doi: 10.1172/JCI45213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kulkarni A, Oza J, Yao M, Sohail H, Ginjala V, Tomas-Loba A, Horejsi Z, Tan AR, Boulton SJ, Ganesan S. Tripartite Motif-containing 33 (TRIM33) protein functions in the poly(ADP-ribose) polymerase (PARP)-dependent DNA damage response through interaction with Amplified in Liver Cancer 1 (ALC1) protein. The Journal of biological chemistry. 2013;288:32357–32369. doi: 10.1074/jbc.M113.459164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Martinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Molecular cell. 2002;10:417–426. doi: 10.1016/s1097-2765(02)00599-3. [DOI] [PubMed] [Google Scholar]
  • 18.Agostini L, Martinon F, Burns K, McDermott MF, Hawkins PN, Tschopp J. NALP3 forms an IL-1beta-processing inflammasome with increased activity in Muckle-Wells autoinflammatory disorder. Immunity. 2004;20:319–325. doi: 10.1016/s1074-7613(04)00046-9. [DOI] [PubMed] [Google Scholar]
  • 19.Schroder K, Tschopp J. The inflammasomes. Cell. 2010;140:821–832. doi: 10.1016/j.cell.2010.01.040. [DOI] [PubMed] [Google Scholar]
  • 20.Cerretti DP, Kozlosky CJ, Mosley B, Nelson N, Van Ness K, Greenstreet TA, March CJ, Kronheim SR, Druck T, Cannizzaro LA, et al. Molecular cloning of the interleukin-1 beta converting enzyme. Science. 1992;256:97–100. doi: 10.1126/science.1373520. [DOI] [PubMed] [Google Scholar]
  • 21.Wen H, Miao EA, Ting JP. Mechanisms of NOD-like receptor-associated inflammasome activation. Immunity. 2013;39:432–441. doi: 10.1016/j.immuni.2013.08.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wu J, Fernandes-Alnemri T, Alnemri ES. Involvement of the AIM2, NLRC4, and NLRP3 inflammasomes in caspase-1 activation by Listeria monocytogenes. Journal of clinical immunology. 2010;30:693–702. doi: 10.1007/s10875-010-9425-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhou R, Tardivel A, Thorens B, Choi I, Tschopp J. Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nature immunology. 2010;11:136–140. doi: 10.1038/ni.1831. [DOI] [PubMed] [Google Scholar]
  • 24.Zhou R, Yazdi AS, Menu P, Tschopp J. A role for mitochondria in NLRP3 inflammasome activation. Nature. 2011;469:221–225. doi: 10.1038/nature09663. [DOI] [PubMed] [Google Scholar]
  • 25.Shimada K, Crother TR, Karlin J, Dagvadorj J, Chiba N, Chen S, Ramanujan VK, Wolf AJ, Vergnes L, Ojcius DM, Rentsendorj A, Vargas M, Guerrero C, Wang Y, Fitzgerald KA, Underhill DM, Town T, Arditi M. Oxidized mitochondrial DNA activates the NLRP3 inflammasome during apoptosis. Immunity. 2012;36:401–414. doi: 10.1016/j.immuni.2012.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Mariathasan S, Newton K, Monack DM, Vucic D, French DM, Lee WP, Roose-Girma M, Erickson S, Dixit VM. Differential activation of the inflammasome by caspase-1 adaptors ASC and Ipaf. Nature. 2004;430:213–218. doi: 10.1038/nature02664. [DOI] [PubMed] [Google Scholar]
  • 27.Mitoma H, Hanabuchi S, Kim T, Bao M, Zhang Z, Sugimoto N, Liu YJ. The DHX33 RNA helicase senses cytosolic RNA and activates the NLRP3 inflammasome. Immunity. 2013;39:123–135. doi: 10.1016/j.immuni.2013.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kanneganti TD, Body-Malapel M, Amer A, Park JH, Whitfield J, Franchi L, Taraporewala ZF, Miller D, Patton JT, Inohara N, Nunez G. Critical role for Cryopyrin/Nalp3 in activation of caspase-1 in response to viral infection and double-stranded RNA. The Journal of biological chemistry. 2006;281:36560–36568. doi: 10.1074/jbc.M607594200. [DOI] [PubMed] [Google Scholar]
  • 29.Rajan JV, Warren SE, Miao EA, Aderem A. Activation of the NLRP3 inflammasome by intracellular poly I:C. FEBS letters. 2010;584:4627–4632. doi: 10.1016/j.febslet.2010.10.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Martinez I, Melero JA. A model for the generation of multiple A to G transitions in the human respiratory syncytial virus genome: predicted RNA secondary structures as substrates for adenosine deaminases that act on RNA. The Journal of general virology. 2002;83:1445–1455. doi: 10.1099/0022-1317-83-6-1445. [DOI] [PubMed] [Google Scholar]
  • 31.Zhao W, Wang L, Zhang M, Yuan C, Gao C. E3 ubiquitin ligase tripartite motif 38 negatively regulates TLR-mediated immune responses by proteasomal degradation of TNF receptor-associated factor 6 in macrophages. J Immunol. 2012;188:2567–2574. doi: 10.4049/jimmunol.1103255. [DOI] [PubMed] [Google Scholar]
  • 32.Davis BK, Wen H, Ting JP. The inflammasome NLRs in immunity, inflammation, and associated diseases. Annual review of immunology. 2011;29:707–735. doi: 10.1146/annurev-immunol-031210-101405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Perregaux D, Gabel CA. Interleukin-1 beta maturation and release in response to ATP and nigericin. Evidence that potassium depletion mediated by these agents is a necessary and common feature of their activity. The Journal of biological chemistry. 1994;269:15195–15203. [PubMed] [Google Scholar]
  • 34.Venturini L, You J, Stadler M, Galien R, Lallemand V, Koken MH, Mattei MG, Ganser A, Chambon P, Losson R, de The H. TIF1gamma, a novel member of the transcriptional intermediary factor 1 family. Oncogene. 1999;18:1209–1217. doi: 10.1038/sj.onc.1202655. [DOI] [PubMed] [Google Scholar]
  • 35.Bai X, Kim J, Yang Z, Jurynec MJ, Akie TE, Lee J, LeBlanc J, Sessa A, Jiang H, DiBiase A, Zhou Y, Grunwald DJ, Lin S, Cantor AB, Orkin SH, Zon LI. TIF1gamma controls erythroid cell fate by regulating transcription elongation. Cell. 2010;142:133–143. doi: 10.1016/j.cell.2010.05.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Vincent DF, Yan KP, Treilleux I, Gay F, Arfi V, Kaniewski B, Marie JC, Lepinasse F, Martel S, Goddard-Leon S, Iovanna JL, Dubus P, Garcia S, Puisieux A, Rimokh R, Bardeesy N, Scoazec JY, Losson R, Bartholin L. Inactivation of TIF1gamma cooperates with Kras to induce cystic tumors of the pancreas. PLoS genetics. 2009;5:e1000575. doi: 10.1371/journal.pgen.1000575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Labrador-Horrillo M, Martinez MA, Selva-O'Callaghan A, Trallero-Araguas E, Balada E, Vilardell-Tarres M, Juarez C. Anti-TIF1gamma antibodies (anti-p155) in adult patients with dermatomyositis: comparison of different diagnostic assays. Annals of the rheumatic diseases. 2012;71:993–996. doi: 10.1136/annrheumdis-2011-200871. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES