Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Oct 1.
Published in final edited form as: J Immunol. 2014 Aug 29;193(7):3769–3778. doi: 10.4049/jimmunol.1400942

Protective Actions of Aspirin-Triggered (17R) Resolvin D1 and its Analogue, 17R-Hydroxy-19-Para-Fluorophenoxy-Resolvin D1 Methyl Ester, in C5a-dependent IgG Immune Complex-Induced Inflammation and Lung Injury

Huifang Tang 1,2, Yanlan Liu 1, Chunguang Yan 1, Nicos A Petasis 3, Charles N Serhan 1,4, Hongwei Gao 1,4
PMCID: PMC4170233  NIHMSID: NIHMS620009  PMID: 25172497

Abstract

Increasing evidence suggests that the novel anti-inflammatory and pro-resolving mediators such as the resolvins play an important role during inflammation. However, the functions of these lipid mediators in immune complex (IC)-induced lung injury remain unknown. Here, we determined the role of aspirin-triggered resolvin D1 (AT-RvD1) and its metabolically stable analogue, 17R-hydroxy-19-para-fluorophenoxy-resolvin D1 methyl ester (p-RvD1), in IgG IC-induced inflammatory responses in myeloid cells and injury in the lung. We show that lung vascular permeability in the AT-RvD1- or p-RvD1-treated mice were significantly reduced when compared with values in mice receiving control vesicle during the injury. Furthermore, i.v. administration of either AT-RvD1 or p-RvD1 caused significant decreases in the bronchoalveolar lavage fluids (BALF) contents of neutrophils, inflammatory cytokines, and chemokines. Of interest, AT-RvD1 or p-RvD1 significantly reduced BALF complement C5a level. By Electrophoretic Mobility Shift Assay, we demonstrate that IgG IC-induced activation of NF-κB and C/EBPβ transcription factors in the lung were significantly inhibited by AT-RvD1 and p-RvD1. Moreover, AT-RvD1 dramatically mitigates IgG IC-induced NF-κB and C/EBP activity in alveolar macrophages. Also, secretion of TNF-α, IL-6, KC, and MIP-1α from IgG IC-stimulated alveolar macrophages or neutrophils was significantly decreased by AT-RvD1. These results suggest a new approach to the blocking of IC-induced inflammation.

Keywords: Resovin D1, Lung, Immune Complex

Introduction

The IgG immune complex-induced lung injury model in the rodents has been employed to determine the molecular mechanisms of acute lung inflammatory injury. In this model, intra-alveolar deposition of IgG immune complexes stimulates alveolar macrophages via cross-linking of Fcγ receptors (FcγRs), which results in robust formation of the early response cytokines such as tumor necrosis factor α (TNF-α) and IL-6 (1, 2). These cytokines then activate transcription factors such as NF-κB and CCAAT/enhancer-binding proteins (C/EBPs) to induce expression of adhesion molecules and other inflammatory mediators such as CXC and CC chemokines on leukocytes and on endothelial cells and epithelial cells, all of which induce a strong pro-inflammatory cascade (1, 2). The formation of IgG immune complexes in lung also results in in situ generation of the complement activation product, C5a, a strong chemoattractant that is involved in the recruitment of inflammatory cells such as neutrophils (1, 2). These inflammatory events together led to the acute lung injury; however, the anti-inflammatory cascade such as the molecular events that contribute to the resolution of immune complex-induced lung inflammation is poorly understood.

Resolvin D1 (RvD1; 7S, 8R, 17S-trihydroxy-4Z, 9E, 11E, 13Z, 15E, 19Z-docosahexaenoic acid) belongs to a new classes of Specialized Pro-Resolving Lipid Mediators (SPMs), which is produced endogenously from essential ω-3-polyunsaturated fatty acids (PUFAs), docosahexaenoic acid (DHA) (3, 4). The aspirin-triggered RvD1 (AT-RvD1) is the 17R epimer of RvD1 (7 S, 8 R, 17 R-trihydroxy-4 Z, 9 E, 11 E, 13 Z, 15 E, 19 Z-docosahexaenoic acid) which is more resistant to catalysis than RvD1 (5). Both RvD1 and AT-RvD1 have proven to be very potent in treating a number of inflammation-associated models of human diseases including obesity-induced steatohepatitis (6), adjuvant-induced arthritis (7), inflammatory and postoperative pain (8, 9), peritonitis (10, 11), suture-induced or IL-1β-induced hemangiogenesis (12), ischemia/reperfusion kidney and lung injury (13, 14), dextran sulfate sodium induced colitis (15), and sepsis (16). Of interest, recent studies indicate that RvD1 or AT-RvD1 plays a critical role in mitigating lung inflammation and injury (17, 18). Little is known about whether resolvins and other SPM could affect FcγR-mediated inflammatory responses. We hypothesize that the new classes of Specialized Pro-Resolving Lipid Mediators can regulate immune complex-induced inflammation and tissue injury. In the current studies we sought to determine the role of AT-RvD1 and RvD1 metabolically stable analogue, p-RvD1 (17R-hydroxy-19-para-fluorophenoxy-resolvin D1 methyl ester) during acute lung inflammation induced by IgG immune complexes. Our data indicate that administration of either AT-RvD1 or p-RvD1 reduces IgG immune complex-induced neutrophil accumulation and lung injury. AT-RvD1 or p-RvD1 also suppresses lung NF-κB and C/EBPs activation in association with decreased bronchoalveolar lavage fluid (BALF) levels of TNF-α, IL-6, and KC. Of interest, C5a levels in the BALF are significantly reduced by p-RvD1 and AT-RvD1. Furthermore, we provide evidence that AT-RvD1 has the ability to regulate the FcγR-mediated induction of inflammatory cytokine and chemokines in both macrophages and neutrophils. These findings suggest that AT-RvD1 is an important regulator of lung inflammatory injury after deposition of IgG immune complexes.

Materials and Methods

Reagents

AT-RvD1 and RvD1 analogue, 17R-hydroxy-19-para-fluorophenoxy-resolvin D1 (pRvD1), were prepared by total organic synthesis (14, 19). 19-p-phenoxy-RvD1 methyl ester and AT-RvD1 methyl ester were used in the in vivo experiments. In some experiments, 17R-RvD1 with the same chemical structure as AT-RvD1 was purchased from Cayman Chemical (Ann Arbor, MI). Both AT-RvD1 and p-RvD1 are dissolved in ethanol. Vesicle control is the same amount of ethanol diluted in PBS.

In vivo studies

Animals

Specific pathogen-free male C57BL/6 mice at the age of 8–12 weeks (weighing 20 g to 30g) were obtained from Jackson Laboratory (Bar Harbor, ME). All procedures involving mice were approved by the Animal Care and Use Committee of Harvard Medical School.

Murine model of IgG immune complex-induced lung injury

Mice were anesthetized with intraperitoneal ketamine (100 mg/kg body weight) (Fort Dodge Animal Health, Fort Dodge, Iowa) and xylazine (12.5 mg/kg body weight) (Ben Venue Laboratories, Benford, Ohio) for sedation. The trachea was surgically exposed by a midline incision, and 120 μg of rabbit anti-BSA IgG (MP Biomedicals, LLC, Solon, OH) in 40 μl of PBS was administered intratracheally by tracheal puncture with a 30 gauge needle. The incision was closed by two surgical clips, and 2 mg of BSA (Albumin from bovine serum, Sigma-Adrich, St. Louis, MO) in a volume of 200 μl was injected i.v. immediately thereafter. When employed, AT-RvD1 (500 ng/mouse) or p-RvD1 (500 ng/mouse) was injected intravenously 5 min before the administration of anti-BSA (αBSA). Control mice received αBSA intratracheally in the absence of an i.v. infusion of BSA.

BAL fluid collection, total and differential leukocyte count

BAL fluids were harvested for total leukocyte count, differential cell counts, and quantification of chemokine/cytokine production by ELISAs. 4 h after IgG immune complex deposition, the thorax was opened and 1 ml of sterile PBS was instilled into the lung via a tracheal incision. The recovered BAL fluids were first used to determine the total leukocyte count via a hemocytometer. BAL fluids were centrifuged at 450× g for 10 min, the cell-free supernatants were used for cytokine/chemokine measurements by sandwich ELISA, and the cell pellets were stained by HEMA3 stain set (Fisher Scientific, Kalamazoo, MI) for differential cell counts. The slides were quantified for macrophages, neutrophils, and lymphocytes by counting a total of 200 cells per slide in randomly selected high-powered fields (× 400) as differential cell count. BAL levels of TNF-α, IL-6, keratinocyte-derived chemokine (KC), MIP-1α, and C5a were determined using ELISA kits (R&D Systems, Minneapolis, MN) according to the instructions of manufacturer.

Permeability evaluation

Mouse albumin levels in BAL fluids were measured using a mouse albumin ELISA kit purchased from Bethyl laboratories, Inc (Montgomery, TX). The detection limit for this ELISA was 7 ng/ml. All procedure followed the protocol of company.

Morphological assessment of lung injury

4 h after IgG immune complex deposition, lungs were fixed by intratracheal instillation of 1 ml of buffered formalin (10%, Fisher Scientific, Fair lawn, NJ), followed by further fixing in the 10% buffered formalin solution for histological examination to evaluate the lung injury by tissue sectioning and staining with hematoxylin and eosin (H&E).

Electrophoretic Mobility Shift Assay (EMSA)

Nuclear extracts of whole lung tissues were prepared, as described previously (20). Briefly, fresh lungs were homogenized in Solution A containing 0.6% (v/v) Nonidet P-40, 150 mM NaCl, 10 mM HEPES (pH 7.9), 1 mM EDTA, 0.5 mM PMSF, 2.5 μg/ml leupeptin, 5 μg/ml antipain, and 5 μg/ml aprotinin. The homogenate was incubated on ice for 5 min and the nuclei were pelleted by centrifugation at 5, 000 × g for 5 min at 4°C. Proteins were extracted from the nuclei by incubation at 4°C with Solution B containing 420 mM NaCl, 20 mM HEPES (pH 7.9), 1.2 mM MgCl2, 0.2 mM EDTA, 25% (v/v) glycerol, 0.5 mM DTT, 0.5 mM PMSF, 2.5 μg/ml leupeptin, 5 μg/ml antipain, and 5 μg/ml aprotinin. Nuclei debris was pelleted by centrifugation at 13,000 × g for 30 min at 4°C, and the supernatant extract was stored at −80°C. Protein concentrations were determined by BioRad protein assay kit (BioRad, Hercules, CA). The EMSA probes were double-stranded oligonucleotides containing a murine IL-6 C/EBP binding site (5′-CTAAACGACGTCACATTGTGCAATCTTAATAAGGTT-3′ annealed with 5′-TGGAAACCTTATTAAGATTGCACAATGTGACGTCGT-3′, kindly provided by Richard Schwartz, Michigan State University), or a NF-κB consensus oligonucleotide (AGTTGAGGGGACTTTCCCAGGC, Promega, Madison, WI). C/EBP probes were labeled with α-[32P]ATP (3,000 Ci/mmol at 10 mCi/ml, GE Healthcare, Piscataway, NJ). NF-κB probes were labeled with γ-[32P]ATP (3,000 Ci/mmol at 10 mCi/ml, GE Healthcare). DNA-binding reactions were performed at room temperature as described previously (20). Samples were electrophoresed through 5.5% polyacrylamide gels in 1XTBE, dried under vacuum, and exposed to X-ray film.

In vitro studies

MH-S cell culture and IgG immune complex stimulation

MH-S cells, obtained from American Type Culture Collection (ATCC, Manassas, VA), were cultured in RPMI 1640 medium supplemented with 10 mM HEPES, 2mM L-glutamine, 100U/ml streptomycin, 100U/ml penicillin, and 10% (v/v) fetal bovine serum. Cells were stimulated by IgG immune complexes (100 μg/ml) with or without AT-RvD1 (100nM) treatment (18). Supernatants were collected at 0, 2, 4, 8, and 24 h for determination of cytokines and chemokines via ELISA kits as described above.

Transfection and Luciferase Assay

Mouse NF-κB-dependent promoter-luciferase construct was obtained from Promega, Madison, WI. C/EBP dependent promoter-luciferase, the DEI-4 (DEI4-(-35alb) LUC), mouse TNF-α promoter-luciferase and mouse IL-6 promoter-luciferase were kindly provided by Richard C. Schwartz (Michigan State University). The thymidine kinase promoter-Renilla luciferase reporter plasmid (pRL-TK) is used as a control for transfection efficiency in the Dual-Luciferase Reporter Assay System. Transient transfections were performed with 3 × 105 cells plated in 12-well plates by using 0.5 μg of DNA and 1.5 μl of Fugene® 6 Transfection Reagent (Roche, Indianapolis, IN) in 50 μl of Opti-MEM I medium (Invitrogen, Carlsbad, CA). Under these conditions, the transfection efficiency is about 20%. Unless otherwise indicated, 24 h after transfection, the cells were incubated with or without IgG immune complexes (100 μg/ml) and AT-RvD1 (100nM) for 4 hours. Cell lysates were subjected to luciferase activity analysis by using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI).

Primary neutrophil isolation and IgG immune complex stimulation

Mouse peritoneal neutrophils were harvested 5 h after intraperitoneal injection of 1.5 ml thioglycolate (BD Biosciences, Sparks, MD; 2.4 g/100 ml) by peritoneal lavaging peritoneum three times with 10 ml of PBS. The cells were collected by centrifugation at 300 × g for 8 minutes at room temperature and washed twice with PBS. The cell pellets were stained by HEMA3 stain set (Fisher Scientific, Kalamazoo, MI) for differential cell counts. The slides were quantified for macrophages, neutrophils, and lymphocytes by counting a total of 200 cells per slide in randomly selected high-powered fields (× 400) as differential cell count. The purity of cell suspension was at least 95% neutrophils. Neutrophils (5×106 cells per experimental condition) were stimulated by IgG immune complexes (100 μg/ml) with or without AT-RvD1 (100nM) treatment. Supernatants were collected at 0, 2, 4, 8, and 24 h for determination of cytokines and chemokines via ELISA kits as described above.

Statistical analysis

All values were represented as the mean ± SEM. Significance was assigned in which p < 0.05. Data sets were analyzed using Student’s t test or oneway ANOVA, with individual group means being compared with the Student-Newman-Keuls multiple comparison test.

Results

AT-RvD1 protects against the development of IgG immune complex-induced lung injury

Our previous work in mice has shown that the pulmonary vascular permeability was increased after IgG immune complexes deposition by measuring albumin level in the BAL fluids (21). Since AT-RvD1 partially resists metabolic inactivation compared with RvD1 (5), we choose to use AT-RvD1 for the study. IgG immune complex-induced lung injury was induced in the manner as described above and the parameters of lung injury was determined at 4 h. As shown in Fig. 1A, the mean permeability index (albumin leakage) in the negative and positive controls is 1±0.17 and 9.73±0.93, respectively. However, the i.v. administration of AT-RvD1 (500 ng/mouse) resulted in a 59% decrease in lung permeability index (3.93±0.44; p < 0.01). The major cells in BAL fluids from control lungs were macrophages and lymphocytes, while in IgG immune complex-injured lungs, the majority of cells turn to neutrophils (Data not shown). The neutrophil content in BAL fluids of animals undergoing IgG immune complex-induced lung injury reflects the degree of lung injury and correspondingly the protective effects of interventions (22, 23). As shown in Fig. 1B, AT-RvD1-treated mice exhibited significant attenuation of the neutrophils (by 81%; p < 0.05). To further examine whether AT-RvD1 treatment reduced lung injury, histological analyses were performed. As shown in Fig. 2A and C, mice receiving PBS (A) or AT-RvD1 (C) alone exhibited normal lung architecture with no evidence of inflammation. In the IgG immune complex-injured lung, significant hemorrhage, edema, and accumulation of neutrophils were observed (Fig. 2B). In AT-RvD1-treated mice, all of these features were attenuated 4 h after IgG immune complex deposition in the lung (Fig. 2D).

Figure 1. AT-RvD1 and p-RvD1 reduce IgG immune complex-induced lung injury parameters permeability index and neutrophil counts in BAL fluids 4 hours after onset of lung injury.

Figure 1

Open in a new tab

Lung injury in mice receiving AT-RvD1 (500 ng/mouse) (A and B) or p-RvD1 (500 ng/mouse) (C and D) was compared to mice receiving vesicle control in the presence (IgG-IC) and absence (Control) of IgG immune complexes deposition. Mouse albumin levels in BAL fluids 4 h after onset of IgG immune complex-induced lung injury were measured as an index for vascular leakage (A and C). Leukocytes were quantitated in BAL fluids (B and D). Results are represented as mean ± SEM, n=3~5. * p < 0.05, ** p < 0.01.

Figure 2. AT-RvD1 and p-RvD1 mitigate histopathology of lung tissue in mice after lung injury.

Figure 2

Open in a new tab

H&E-stained paraffin-embedded lung sections in mice receiving AT-RvD1 (500 ng/mouse) (A and B) or p-RvD1 (500 ng/mouse) (C and D) was compared to mice receiving vesicle control in the presence (IgG-IC) and absence (Control) of IgG immune complexes deposition. Original magnification: ×200. (A and E) Lung section from mice receiving vesicle control with αBSA only. (C and G) Lung section from mice receiving AT-RvD1 (C) or p-RvD1 (G) with αBSA only. (B and F) Lung section from mice receiving vesicle control together with IgG immune complex deposition. (D and H) Lung section from mice receiving AT-RvD1 (D) or p-RvD1 (H) together with IgG immune complexes deposition. Shown are representative sections for each condition (scale bar: 10 μM).

AT-RvD1 reduces BAL TNF-α, IL-6 and KC contents in the IgG immune complex-injured lung

Levels of TNF-α, IL-6 and KC that are involved in IgG immune complex-induced lung injury (1) were determined. Negative control mice had low levels of TNF-α (121 ± 85 pg/ml), IL-6 (165 ± 2 pg/ml) and KC (346 ± 16 pg/ml) (Fig. 3A–C). As expected, IgG immune complex deposition in the lung resulted in a substantial increase in BAL TNF-α (7637 ± 637 pg/ml), IL-6 (3725 ± 745 pg/ml) and KC (4020 ± 742 pg/ml) contents (Fig. 3A–C). The levels of all these inflammatory cytokine and chemokine were significantly decreased in AT-RvD1-treated mice (TNF-α by 61%, IL-6 by 76%, and KC by 62%, respectively). These results correlate with decreased albumin leakage, neutrophil, and histology changes as described above.

Figure 3. AT-RvD1 and p-RvD1 reduce BAL contents of TNF-α (A and D), IL-6 (B and E), and KC (C and F).

Figure 3

Open in a new tab

Mice received AT-RvD1 (500 ng/mouse) (A–C), p-RvD1 (500 ng/mouse) (D–F) or vesicle control 5 min before IgG immune complex deposition were performed. BAL fluids were obtained 4 h after onset of IgG immune complex-induced lung injury, and analyzed by ELISAs. Controls received αBSA intratracheally together with vesicle control, but in the absence of intravenously administered BSA. Results are represented as mean ± SEM, n=3~5. * p < 0.05, ** p < 0.01, *** p < 0.001.

p-RvD1 decreases the IgG immune complex-induced lung injury and BAL contents of TNF-α, IL-6 and KC

Similar studies were conducted with RvD1 metabolically stable analogue, p-RvD1 (17R-hydroxy-19-para-fluorophenoxy-resolvin D1 methyl ester) in the IgG immune complex model of lung injury. As shown in Fig. 1C, p-RvD1 treatment (i.v., 500 ng/mouse) significantly decreased the permeability values by 49.5% (p < 0.01). Next, BAL fluids were harvested from IgG immune complex-injured to evaluate the effect of p-RvD1 on infiltration of the inflammatory cells. As shown in Fig. 1D, p-RvD1 treatment results in a 46% reduction in the number of neutrophil presented in the BAL fluids (3.88 ± 0.65 × 106 cells/ml v.s. 8.95 ± 1.39 × 106 cells/ml; p < 0.01) when compared to IgG immune complex-injured mice with control treatment, while the numbers of mononuclear cells (chiefly lymphocytes and macrophages) shows an increased tendency without significant difference (Data not shown). To further examine whether p-RvD1 treatment reduces lung injury, histological analyses were performed. Similar to AT-RvD1 treatment, in the presence of p-RvD1, significantly reduced alveolar injury (hemorrhage) or inflammation (neutrophils) was found (Fig. 2E–H).

We examined TNF-α, IL-6 and KC in the BAL fluid 4 h after deposition of IgG immune complexes in mice treated either with p-RvD1 or PBS. As shown in Fig. 3D–F, in the IgG immune complex-injured lungs, p-RvD1 reduced the BAL contents of TNF-α by 51% (p < 0.05), IL-6 by 64% (p < 0.05), KC by 76% (p < 0.01), respectively. These results suggested that reduction of BAL TNF-α, IL-6 and KC by p-RvD1 in the IgG immune complex model is probably directly linked to the protective effects of this RvD1 metabolically stable analogue, the results of which are associated with reduced lung content of neutrophils (Fig. 1D and Fig. 2H).

p-RvD1 and AT-RvD1 reduce C5a production in BAL fluids

C5a is an inflammatory peptide with a broad spectrum of biological functions (24). Previous studies have demonstrated that C5a play an essential role for the full production of TNF-α, albumin leakage, and neutrophil accumulation during IgG immune complex-induced lung injury (25, 26). To investigate whether p-RvD1 and AT-RvD1 can regulate the IgG immune complex-induced C5a activation in the lung, C5a levels in BAL fluids were assessed. As shown in Fig. 4A, negative control animals (αBSA only) had low levels of BAL C5a (89.96 ± 5.5). The level of C5a significantly increased in the BAL fluids from IgG immune complex-injured lungs when compared to that from control mice (326.2 ± 15.4; p < 0.0001) (Fig. 4A). However, the mice receiving p-RvD1 at the initiation of IgG immune complex deposition showed a marked decrease of the C5a content by 47.8% (190.1 ± 10.5; p < 0.0001) (Fig. 4A). Similarly, AT-RvD1 can also significantly decrease the C5a level in BAL fluids from IgG immune complex-injured lungs (p < 0.05, Fig. 4B). These findings indicate that p-RvD1 and AT-RvD1 may exert their protective roles in IgG immune complex-induced injury by inhibiting C5a production.

Figure 4. p-RvD1 and AT-RvD1 reduce C5a content in BAL fluids.

Figure 4

Open in a new tab

Mice received p-RvD1 (500 ng/mouse) (A), p-RvD1 (500 ng/mouse) (B)or vesicle control 5 min before IgG immune complex deposition was performed. BAL fluids were obtained 4 h after onset of lung injury, and analyzed by ELISA for C5a content. Controls received αBSA intratracheally together with vesicle control, but in the absence of intravenously administered BSA. Results are represented as mean ± SEM, n=3–5. * p < 0.05, *** p < 0.001.

p-RvD1 and AT-RvD1 inhibit the activities of NF-κB and C/EBPs

In the model of IgG immune complex-induced lung injury, activation of NF-κB is known to be required for production of relevant inflammatory mediators (27, 28). In addition, our recent studies show that C/EBP transcription factors play a critical role in FcγR signaling in macrophages and IgG immune complex-induced lung injury (29, 30). To determine the potential mechanisms whereby p-RvD1 and AT-RvD1 suppress IgG immune complex-induced inflammation, we performed EMSA assay of nuclear proteins from control and IgG immune complex-injured lungs in the presence or absence of p-RvD1 or AT-RvD1 to evaluate NF-κB and C/EBP activation. As shown in Fig 5A and B, very little NF-κB and C/EBP were found in lung nuclear proteins obtained from mice receiving PBS, AT-RvD1, or pRvD1 in the presence of αBSA alone. In mice undergoing IgG immune complex deposition treated intravenously with PBS, there were clear evidences of increased DNA binding activities for both NF-κB and C/EBP (Fig. 5A and B). Importantly, in mice undergoing IgG immune complex deposition and treated with AT-RvD1 or pRvD1, there were reduced activation of NF-κB and C/EBP (Fig. 5A and B, right four lanes).

Figure 5. AT-RvD1 and p-RvD1 reduce NF-κB and C/EBP activation in IgG immune complex-injured lungs and IgG immune complex-stimulated alveolar macrophage cells.

Figure 5

Open in a new tab

(A and B) Mice received AT-RvD1, p-RvD1 or vesicle control 5 min before IgG immune complex deposition was performed. Nuclear extracts from whole lungs harvested 4 h after lung injury were subjected to EMSA assay for NF-κB (A) and C/EBP (B) DNA binding activity. (C and D) MH-S cells were transiently transfected with total of 0.5 μg indicated DNA. Twenty-four hours after transfection, the cells were challenged with IgG immune complexes in the presence or absence of AT-RvD1 for 4 h. Cell lysates were used for luciferase activity assay (C for NF-κB and D for C/EBPs). Luminometer values were normalized for expression from a cotransfected thymidine kinase reporter gene. Results are expressed as means of six experiments ± SEM. * p < 0.05.

We next determined whether AT-RvD1 could affect NF-κB and C/EBP promoter-luciferase activity in alveolar macrophage cells (MH-S). As shown in Fig 5 C and D, IgG immune complex stimulation led to a significant increase of NF-κB and C/EBP promoter-luciferase activity (about two folds; p < 0.05). While AT-RvD1 treatment had no effect on the basal activity of luciferase, it caused a significant decrease of the NF-κB and C/EBP promoter-luciferase expression induced by IgG immune complexes (p < 0.05; Fig. 5C and D). Together, these data suggest that the reduction of NF-κB and C/EBPs activity is a potential mechanism whereby AT-RvD1 and p-RvD1 suppresses IgG immune complex-induced cytokine and chemokine production in the lung.

AT-RvD1 reduces cytokine production from alveolar macrophages

We evaluated the effects of AT-RvD1 treatment on the cytokine production in the MH-S cells. We showed the secretions of TNF-α and IL-6 were significantly induced from IgG immune complex-stimulated MH-S cells over a 24-hour period (Fig. 6A and B). Interestingly, there were rapid increases in the production of TNF-α, peaking at 2 h after IgG immune complex stimulation, followed by a gradual decline; while the secretion of IL-6 shows a progressive increase, peaking at 24 h (Fig. 6A and B). Moreover, on IgG immune complex stimulation, AT-RvD1 led to a decreased production of both TNF-α and IL-6 in all time points when compared with control-treated MH-S cells (Fig. 6A and B).

Figure 6. AT-RvD1 reduces production and promoter activity of TNF-α and IL-6 in IgG immune complex-stimulated alveolar macrophage cells.

Figure 6

Open in a new tab

(A and B) MH-S cells were incubated with 100 μg/ml IgG immune complexes in the presence or absence of AT-RvD1 (100 nM) for the indicated time periods. Levels of TNF-α (A) and IL-6 (B) in the supernatants were assayed by ELISA. Data were represented as mean ± SEM, n=4. *p < 0.05; ** p < 0.01; *** p < 0.001. (C and D) MH-S cells were transiently transfected with total of 0.5 μg indicated DNA. Twenty-four hours after transfection, the cells were challenged with IgG immune complexes in the presence or absence of AT-RvD1 for 4 h. Cell lysates were used for luciferase activity assay (C for TNF-α and D for IL-6). Luminometer values were normalized for expression from a co-transfected thymidine kinase reporter gene. Results are expressed as means of three experiments ± SEM. * p < 0.05.

To further examine the mechanisms by which AT-RvD1 suppresses the production of TNF-α and IL-6 induced by IgG immune complexes, we performed transient transfection assay with TNF-α- and IL-6-promoter-luciferase constructs. As with the endogenous promoter, IgG immune complex stimulation induced luciferase expression by over 3-fold and 4-fold, for TNF-α and IL-6 promoter-luciferase, respectively. AT-RvD1 treatment led to a significant decrease in TNF-α (~ 30%; p < 0.05) and IL-6 (~ 40%; p < 0.05) promoter-luciferase expression induced by IgG immune complexes (Fig. 6C and D). These results suggested that in alveolar macrophages, AT-RvD1 inhibits IgG immune complex-induced TNF-α and IL-6 production at transcription level.

AT-RvD1 suppresses cytokine and chemokine secretion from primary neutrophils when incubated with IgG immune complexes

In the IgG immune complex-induced lung injury model, recruitment of neutrophils and their subsequent activation by immune complexes lead to the generation of oxidants and release of proteinases, eventually causing lung injury characterized by increased vascular permeability and alveolar hemorrhage (1, 2). We evaluated AT-RvD1 treatment on the expression of cytokines and chemokines in primary peritoneal neutrophils. As shown in Fig. 7, the secretions of TNF-α, IL-6, KC, and MIP-1α were all significantly induced from IgG immune complex-stimulated neutrophils. Moreover, AT-RvD1 treatment led to a significant decrease in IgG immune complex-induced secretion of theses cytokines and chemokines from neutrophils (TNF-α and KC at all time points, Fig. 7A and C; IL-6 and MIP-1α at 4–8 h and after, Fig. 7B and D) when compared with control-treated cells. These results suggest one potential mechanism whereby AT-RvD1 disrupts IgG immune complex-induced lung injury is via its effects on neutrophil inflammatory responses.

Figure 7. AT-RvD1 reduces production of cytokines and chemokines in IgG immune complex-stimulated neutrophils.

Figure 7

Open in a new tab

Primary mouse peritoneal neutrophils were incubated with 100 μg/ml IgG immune complexes in the presence or absence of AT-RvD1 (100 nM) for the indicated time periods. Levels of TNF-α (A), IL-6 (B), KC (C), and MIP-1α (D) in the supernatants were assayed by ELISA. Results are represented as mean ± SEM, n=4. *p < 0.05; ** p < 0.01; *** p < 0.001.

Discussion

Although inflammation is usually a local, protective reaction to injury or invasive microbes, these immune responses may sometimes injure the host in both acute and chronic circumstances. For example, tissue injury and destruction may result from the vigorous responses with which leukocytes destroy pathogens, pathogen-infected cells, and dispose of dead cells and their products instead of the direct effects of the pathological agents themselves (1). Accordingly, the inflammatory responses must be precisely regulated. The recent discovery of specialized pro-resolving mediators (SPM), derived from poly-unsaturated fatty acids (PUFA), such as lipoxins, D-series resolvins, E-series resolvins, neuoprotectins, and maresins, has uncovered molecular mechanisms that regulate the progression and resolution of inflammation (31). However, the detailed events that SPM controls inflammation-triggered tissue injury remain of interest. Resolvins of the D series (RvD1-RvD6) are derived from docosahexaenoic acid (DHA; C22:6) (31). The biosynthesis of both D series and aspirin-triggered D series resolvins have been described (19, 31, 32). Among them, RvD1/AT-RvD1 is proved to be a potent D series resolvin that protects from excessive inflammation (31). In the current study, we determined the actions of aspirin-triggered (17R) resolvin D1 (AT-RvD1) and its analogue, 17R-hydroxy-19-para-fluorophenoxy-resolvin D1 methyl ester (p-RvD1) on FcγR-mediated inflammatory responses.

Lung inflammatory injury triggered by intrapulmonary deposition of IgG immune complexes has proven to be an important model for developing an understanding of the role of various mediators in events that lead to tissue injury (1). In this model, intra-alveolar deposition of IgG immune complexes results in an acutely damaging process that includes a vascular leak syndrome, significant recruitment and activation of leukocytes, and damage of vascular endothelial cells and alveolar epithelial cells (1). These types of events are observed in many diseases including autoimmune diseases and specific types of immune-mediated diseases such as allergic aspergillosis (33). Using this highly neutrophil-dependent lung injury model, we have demonstrated for the first time that AT-RvD1- and p-RvD1-treated mice have significantly reduced lung inflammatory responses and reduced lung injury after IgG immune complex deposition. This was indicated by reduced lung vascular permeability (albumin leak), lung histology, BAL neutrophil influx and cytokine/chemokine levels (Figs. 1–3). These results suggest that AT-RvD1and p-RvD1 play a critical role in IgG immune complex-induced inflammatory responses and injury in the lung.

Earlier studies including ours suggest that activation of transcription factors NF-κB and C/EBPβ plays a central role in the pulmonary inflammatory response to IgG immune complexes (28, 30, 34). Both NF-κB and C/EBPβ are known regulators of various genes involved in the inflammation such as those coding for cytokines, chemokines, their receptors, and acute-phase proteins. In the current study, we show that AT-RvD1 and p-RvD1 inhibited the activities of NF-κB and C/EBPs in both lung and alveolar macrophages, suggesting that the reduction of NF-κB and C/EBPs activity is a potential mechanism whereby AT-RvD1 and p-RvD1 suppresse IgG immune complex- induced cytokine/chemokine production and injury in the lung. Interestingly, recent studies show that RvD1 reduces NF-κB pathway in human monocytes and macrophages by regulating specific microRNAs (32, 35). Whether the similar mechanism is involved in the AT-RvD1 regulation of C/EBPβ remains an interesting question to determine.

Alveolar macrophage activation is a key initiation signal for acute lung injury (36–39). By airway instillation of liposome-encapsulated dichloromethylene diphosphonate, Lentsch et al shows that depleting alveolar macrophages significantly reduced NF-κB activation in the IgG immune complex-injured lungs (40). Moreover, our recent study demonstrates that lung C/EBP activation induced by IgG immune complexes is suppressed by depletion of alveolar macrophages (30). Furthermore, intrapulmonary instillation of phosphonate-containing liposomes or C/EBPβ gene knockout led to substantially reduced bronchoalveolar lavage levels of TNF-α, the CXC chemokines, neutrophil accumulation, and lung injury (30, 40, 41). Interestingly, lung instillation of recombinant TNF-α in alveolar macrophage-depleted animals restores the NF-κB activation response in whole lung (40). These data together suggest that initial activation of NF-κB and C/EBP in alveolar macrophages and the ensuing production of TNF-α and other inflammatory mediators play an important role in the initial pathogenesis of IgG immune complex-induced lung injury. Data in the current study shows that AT-RvD1 suppresses IgG immune complex-induced TNF-α and IL-6 production from alveolar macrophages at both transcriptional and translational levels (Fig. 6). In addition, AT-RvD1 treatment also led to a significant decrease of the NF-κB and C/EBP promoter-luciferase expression induced by IgG immune complexes (Fig. 5C and D). These data suggest that alveolar macrophage is an important target of RvD1 upon immune complex stimulation. Interestingly, we previously show that Stat3 plays an important regulatory role in the pathogenesis of IgG immune complex-induced acute lung injury (21). Furthermore, it has been demonstrated that Stat3 is involved in the IL-6-induced upregulation of C/EBPβ and -δ gene promoters (42). Thus, it is reasonable to speculate that IgG immune complex-activated IL-6-Stat3-C/EBP signal is a critical circuit regulated by RvD1. However, Stat3 can also be activated in response to IL-10 which is important regulator of lung inflammatory injury after deposition of IgG immune complexes and contain the extent of injury (43). Thus, in the future study it is interesting to investigate how Stat3 activation through different receptors (IL-6 or IL-10 receptors) can be differentially regulated by RvD1 in immune effector cells, leading to controlled inflammatory responses.

Neutrophil activation and transmigration into the alveolar compartment play a key role in the development of IgG immune complex-induced lung injury. Our current study provides the evidence that AT-RvD1 and p-RvD1 appear to reduce leukocyte recruitment into the alveolar space (Fig. 1B and D). In addition, AT-RvD1 suppressed cytokine and chemokine secretion from primary neutrophils when incubated with IgG immune complexes. Interestingly, a recent study demonstrates that the RvD1 is able to limit the human neutrophil recruitment under shear conditions in a mechanism dependent on its receptors, ALX/FPR2 and GPR32 (44). Furthermore, both AT-RvD1 and RvD1 analogs effectively activated ALX/FPR2 and GPR32 in GPCR-overexpressing β-arrestin systems (45). Importantly, neutrophil infiltration in self-limited peritonitis was reduced in human ALX/FPR2-overexpressing transgenic mice (45). Together with our current results, these studies suggest that regulation of neutrophil activation and migration is another important mechanism in RvD1 mitigation of IgG immune complex-induced inflammatory responses. Both human neutrophils and macrohages express ALX/FPR2 and GPR32 (46); however, the detailed molecular mechanisms whereby RvD1 regulates FcγR-mediated signals in phagocytes remain to be determined.

Probably, one of the most important findings in the current study is that p-RvD1 and AT-RvD1 treatment led to a significant reduction in the IgG immune complex-induced C5a production in BAL fluids (Fig. 4). C5a is a powerful pro-inflammatory anaphylatoxin. In the model of IgG immune complex acute lung injury, anti-C5a treatment significantly reduced the increase in vascular permeability and neutrophil recruitment (25). The protective effects of anti-C5a appeared to be related to its ability to suppress lung alveolar macrophage production of TNF-α (25). Similarly, mice deficient in C5 and C5aR were protected from IgG immune complex-induced alveolitis (26, 47). In addition, early IgG immune complex-induced C5a and its interaction with C5aR led to induction of activating FcγRIII and suppression of inhibitory FcγRII on alveolar macrophages, which appears crucial for cytokine production and neutrophil recruitment in the IgG immune complex-injured lung (26). The detailed mechanisms by which p-RvD1 and AT-RvD1 suppress C5a production in the lung remain to be determined. Interestingly, C/EBPβ plays a critical role in the transcriptional induction of Complement 3 (C3) (48). Thus a possible mechanism of RvD1 involvement in C5a production is its regulation on C/EBPβ transcriptional activities.

In summary, our studies provide first evidence that AT-RvD1 and its metabolically stable analogue, p-RvD1, play a critical role in blocking acute inflammatory responses induced by IgG immune complexes both in vitro and in vivo in the lungs. More detailed understanding of the cross-talk between resolvins and FcγR-mediated inflammatory responses and the underlying mechanisms may provide new therapeutic strategies for diseases with an inflammatory component including acute hypersensitivity pneumonitis.

Figure 8. Role of AT-RvD1 and p-RvD1 in IgG immune complex-induced lung injury.

Figure 8

Open in a new tab

Activation of alveolar macrophages by IgG immune complexes results in robust generation of C5a, the synthesis and release of TNF-α, IL-6 and KC, followed by a recruitment of neutrophils into the interstitial and alveolar compartments. Neutrophils can also be stimulated by IgG immune complexes, which represent a positive-feedback loop of lung inflammation. These events together led to the lung injury. The inflammatory responses in the lung are regulated by AT-RvD1 and p-RvD1, involved in cytokine & chemokine production, NF-κB and C/EBP activation, and neutrophil recruitment.

Acknowledgments

This research was supported by NIH grants 5R01HL092905 and 3R01HL092905-02S1 (H.G.), and 5P01GM095467 (C.N.S.).

Abbreviations

SPM

specialized pro-resolving mediators

PUFA

poly-unsaturated fatty acids

AT-RvD1

Aspirin-Triggered (17R) Resolvin D1

p-RvD1

17R-hydroxy-19-para-fluorophenoxy-resolvin D1 methyl ester (p-RvD1)

FcγR

Fcγ receptor

BAL

bronchoalveolar lavage

C/EBP

CCAAT/enhancer-binding proteins (C/EBPs)

EMSA

electrophoretic mobility shift assay

IL

interleukin

TNF-α

tumor necrosis factor α

MIP

macrophage inflammatory protein

KC

keratinocyte cell-derived chemokine

Footnotes

Competing Financial Interests

C.N.S. is an inventor on patents (Resolvins) assigned to BWH and licensed to Resolvyx Pharmaceuticals. C.N.S. is a scientific founder of Resolvyx Pharmaceuticals and owns equity in the company. C.N.S.’s interests were reviewed and are managed by the Brigham and Women’s Hospital and Partners HealthCare in accordance with their conflict of interest policies. N.A.P. is an inventor on patents (resolvins) assigned to the University of Southern California and licensed for clinical development and retains stock in Resolvyx Pharmaceuticals.

References

  • 1.Gao H, Neff T, Ward PA. Regulation of lung inflammation in the model of IgG immune-complex injury. Annual review of pathology. 2006;1:215–242. doi: 10.1146/annurev.pathol.1.110304.100155. [DOI] [PubMed] [Google Scholar]
  • 2.Guo RF, Ward PA. Mediators and regulation of neutrophil accumulation in inflammatory responses in lung: insights from the IgG immune complex model. Free radical biology & medicine. 2002;33:303–310. doi: 10.1016/s0891-5849(02)00823-7. [DOI] [PubMed] [Google Scholar]
  • 3.Serhan CN, Chiang N, Van Dyke TE. Resolving inflammation: dual anti-inflammatory and pro-resolution lipid mediators. Nat Rev Immunol. 2008;8:349–361. doi: 10.1038/nri2294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Recchiuti A. Resolvin D1 and its GPCRs in resolution circuits of inflammation. Prostaglandins & other lipid mediators. 2013;107:64–76. doi: 10.1016/j.prostaglandins.2013.02.004. [DOI] [PubMed] [Google Scholar]
  • 5.Sun YP, Oh SF, Uddin J, Yang R, Gotlinger K, Campbell E, Colgan SP, Petasis NA, Serhan CN. Resolvin D1 and its aspirin-triggered 17R epimer. Stereochemical assignments, anti-inflammatory properties, and enzymatic inactivation. The Journal of biological chemistry. 2007;282:9323–9334. doi: 10.1074/jbc.M609212200. [DOI] [PubMed] [Google Scholar]
  • 6.Rius B, Titos E, Moran-Salvador E, Lopez-Vicario C, Garcia-Alonso V, Gonzalez-Periz A, Arroyo V, Claria J. Resolvin D1 primes the resolution process initiated by calorie restriction in obesity-induced steatohepatitis. FASEB journal. 2014;28(2):836–848. doi: 10.1096/fj.13-235614. [DOI] [PubMed] [Google Scholar]
  • 7.Lima-Garcia JF, Dutra RC, da Silva K, Motta EM, Campos MM, Calixto JB. The precursor of resolvin D series and aspirin-triggered resolvin D1 display anti-hyperalgesic properties in adjuvant-induced arthritis in rats. British journal of pharmacology. 2011;164:278–293. doi: 10.1111/j.1476-5381.2011.01345.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Xu ZZ, Zhang L, Liu T, Park JY, Berta T, Yang R, Serhan CN, Ji RR. Resolvins RvE1 and RvD1 attenuate inflammatory pain via central and peripheral actions. Nature medicine. 2010;16:592–597. doi: 10.1038/nm.2123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bang S, Yoo S, Yang TJ, Cho H, Hwang SW. 17(R)-resolvin D1 specifically inhibits transient receptor potential ion channel vanilloid 3 leading to peripheral antinociception. British journal of pharmacology. 2012;165:683–692. doi: 10.1111/j.1476-5381.2011.01568.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Spite M, Summers L, Porter TF, Srivastava S, Bhatnagar A, Serhan CN. Resolvin D1 controls inflammation initiated by glutathione-lipid conjugates formed during oxidative stress. British journal of pharmacology. 2009;158:1062–1073. doi: 10.1111/j.1476-5381.2009.00234.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Tang Y, Zhang MJ, Hellmann J, Kosuri M, Bhatnagar A, Spite M. Proresolution therapy for the treatment of delayed healing of diabetic wounds. Diabetes. 2013;62:618–627. doi: 10.2337/db12-0684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jin Y, Arita M, Zhang Q, Saban DR, Chauhan SK, Chiang N, Serhan CN, Dana R. Anti-angiogenesis effect of the novel anti-inflammatory and pro-resolving lipid mediators. Invest Ophthalmol Vis Sci. 2009;50:4743–4752. doi: 10.1167/iovs.08-2462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Duffield JS, Hong S, Vaidya VS, Lu Y, Fredman G, Serhan CN, Bonventre JV. Resolvin D series and protectin D1 mitigate acute kidney injury. Journal of immunology. 2006;177:5902–5911. doi: 10.4049/jimmunol.177.9.5902. [DOI] [PubMed] [Google Scholar]
  • 14.Kasuga K, Yang R, Porter TF, Agrawal N, Petasis NA, Irimia D, Toner M, Serhan CN. Rapid appearance of resolvin precursors in inflammatory exudates: novel mechanisms in resolution. Journal of immunology. 2008;181:8677–8687. doi: 10.4049/jimmunol.181.12.8677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bento AF, Claudino RF, Dutra RC, Marcon R, Calixto JB. Omega-3 fatty acid-derived mediators 17(R)-hydroxy docosahexaenoic acid, aspirin-triggered resolvin D1 and resolvin D2 prevent experimental colitis in mice. Journal of immunology. 2011;187:1957–1969. doi: 10.4049/jimmunol.1101305. [DOI] [PubMed] [Google Scholar]
  • 16.Chen F, Fan XH, Wu YP, Zhu JL, Wang F, Bo LL, Li JB, Bao R, Deng XM. Resolvin D1 improves survival in experimental sepsis through reducing bacterial load and preventing excessive activation of inflammatory response. Eur J Clin Microbiol Infect Dis. 2014;33(3):457–464. doi: 10.1007/s10096-013-1978-6. [DOI] [PubMed] [Google Scholar]
  • 17.Eickmeier O, Seki H, Haworth O, Hilberath JN, Gao F, Uddin M, Croze RH, Carlo T, Pfeffer MA, Levy BD. Aspirin-triggered resolvin D1 reduces mucosal inflammation and promotes resolution in a murine model of acute lung injury. Mucosal immunology. 2013;6:256–266. doi: 10.1038/mi.2012.66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Rogerio AP, Haworth O, Croze R, Oh SF, Uddin M, Carlo T, Pfeffer MA, Priluck R, Serhan CN, Levy BD. Resolvin D1 and aspirin-triggered resolvin D1 promote resolution of allergic airways responses. Journal of immunology. 2012;189:1983–1991. doi: 10.4049/jimmunol.1101665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Serhan CN, Petasis NA. Resolvins and protectins in inflammation resolution. Chemical reviews. 2011;111:5922–5943. doi: 10.1021/cr100396c. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gao H, Guo RF, Speyer CL, Reuben J, Neff TA, Hoesel LM, Riedemann NC, McClintock SD, Sarma JV, Van Rooijen N, Zetoune FS, Ward PA. Stat3 activation in acute lung injury. Journal of immunology. 2004;172:7703–7712. doi: 10.4049/jimmunol.172.12.7703. [DOI] [PubMed] [Google Scholar]
  • 21.Tang H, Yan C, Cao J, Sarma JV, Haura EB, Wu M, Gao H. An essential role for Stat3 in regulating IgG immune complex-induced pulmonary inflammation. FASEB journal. 2011;25:4292–4300. doi: 10.1096/fj.11-187955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mulligan MS, Jones ML, Vaporciyan AA, Howard MC, Ward PA. Protective effects of IL-4 and IL-10 against immune complex-induced lung injury. Journal of immunology. 1993;151:5666–5674. [PubMed] [Google Scholar]
  • 23.Mulligan MS, Hevel JM, Marletta MA, Ward PA. Tissue injury caused by deposition of immune complexes is L-arginine dependent. Proceedings of the National Academy of Sciences of the United States of America. 1991;88:6338–6342. doi: 10.1073/pnas.88.14.6338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Guo RF, Ward PA. Role of C5a in inflammatory responses. Annual review of immunology. 2005;23:821–852. doi: 10.1146/annurev.immunol.23.021704.115835. [DOI] [PubMed] [Google Scholar]
  • 25.Mulligan MS, Schmid E, Beck-Schimmer B, Till GO, Friedl HP, Brauer RB, Hugli TE, Miyasaka M, Warner RL, Johnson KJ, Ward PA. Requirement and role of C5a in acute lung inflammatory injury in rats. The Journal of clinical investigation. 1996;98:503–512. doi: 10.1172/JCI118818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Shushakova N, Skokowa J, Schulman J, Baumann U, Zwirner J, Schmidt RE, Gessner JE. C5a anaphylatoxin is a major regulator of activating versus inhibitory FcgammaRs in immune complex-induced lung disease. The Journal of clinical investigation. 2002;110:1823–1830. doi: 10.1172/JCI200216577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lentsch AB, Czermak BJ, Bless NM, Ward PA. NF-kappaB activation during IgG immune complex-induced lung injury: requirements for TNF-alpha and IL-1beta but not complement. The American journal of pathology. 1998;152:1327–1336. [PMC free article] [PubMed] [Google Scholar]
  • 28.Lentsch AB, Shanley TP, Sarma V, Ward PA. In vivo suppression of NF-kappa B and preservation of I kappa B alpha by interleukin-10 and interleukin-13. The Journal of clinical investigation. 1997;100:2443–2448. doi: 10.1172/JCI119786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yan C, Zhu M, Staiger J, Johnson PF, Gao H. C5a-regulated CCAAT/enhancer-binding proteins beta and delta are essential in Fcgamma receptor-mediated inflammatory cytokine and chemokine production in macrophages. The Journal of biological chemistry. 2012;287:3217–3230. doi: 10.1074/jbc.M111.280834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yan C, Wu M, Cao J, Tang H, Zhu M, Johnson PF, Gao H. Critical role for CCAAT/enhancer-binding protein beta in immune complex-induced acute lung injury. Journal of immunology. 2012;189:1480–1490. doi: 10.4049/jimmunol.1200877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Serhan CN. Resolution phase of inflammation: novel endogenous anti-inflammatory and proresolving lipid mediators and pathways. Annual review of immunology. 2007;25:101–137. doi: 10.1146/annurev.immunol.25.022106.141647. [DOI] [PubMed] [Google Scholar]
  • 32.Recchiuti A, Krishnamoorthy S, Fredman G, Chiang N, Serhan CN. MicroRNAs in resolution of acute inflammation: identification of novel resolvin D1-miRNA circuits. FASEB journal. 2011;25:544–560. doi: 10.1096/fj.10-169599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lukacs NW, Ward PA. Inflammatory mediators, cytokines, and adhesion molecules in pulmonary inflammation and injury. Adv Immunol. 1996;62:257–304. doi: 10.1016/s0065-2776(08)60432-0. [DOI] [PubMed] [Google Scholar]
  • 34.Yan C, Wu M, Cao J, Tang H, Zhu M, Johnson PF, Gao H. Critical role for CCAAT/enhancer-binding protein beta in immune complex-induced acute lung injury. Journal of immunology. 189:1480–1490. doi: 10.4049/jimmunol.1200877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Li Y, Dalli J, Chiang N, Baron RM, Quintana C, Serhan CN. Plasticity of leukocytic exudates in resolving acute inflammation is regulated by MicroRNA and proresolving mediators. Immunity. 2013;39:885–898. doi: 10.1016/j.immuni.2013.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Prakash A, Mesa KR, Wilhelmsen K, Xu F, Dodd-o JM, Hellman J. Alveolar macrophages and Toll-like receptor 4 mediate ventilated lung ischemia reperfusion injury in mice. Anesthesiology. 2012;117:822–835. doi: 10.1097/ALN.0b013e31826a4ae3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Frank JA, Wray CM, McAuley DF, Schwendener R, Matthay MA. Alveolar macrophages contribute to alveolar barrier dysfunction in ventilator-induced lung injury. American journal of physiology. Lung cellular and molecular physiology. 2006;291:L1191–1198. doi: 10.1152/ajplung.00055.2006. [DOI] [PubMed] [Google Scholar]
  • 38.Zhao M, Fernandez LG, Doctor A, Sharma AK, Zarbock A, Tribble CG, Kron IL, Laubach VE. Alveolar macrophage activation is a key initiation signal for acute lung ischemia-reperfusion injury. American journal of physiology. Lung cellular and molecular physiology. 2006;291:L1018–1026. doi: 10.1152/ajplung.00086.2006. [DOI] [PubMed] [Google Scholar]
  • 39.Naidu BV, Krishnadasan B, Farivar AS, Woolley SM, Thomas R, Van Rooijen N, Verrier ED, Mulligan MS. Early activation of the alveolar macrophage is critical to the development of lung ischemia-reperfusion injury. J Thorac Cardiovasc Surg. 2003;126:200–207. doi: 10.1016/s0022-5223(03)00390-8. [DOI] [PubMed] [Google Scholar]
  • 40.Lentsch AB, Czermak BJ, Bless NM, Van Rooijen N, Ward PA. Essential role of alveolar macrophages in intrapulmonary activation of NF-kappaB. American journal of respiratory cell and molecular biology. 1999;20:692–698. doi: 10.1165/ajrcmb.20.4.3414. [DOI] [PubMed] [Google Scholar]
  • 41.Crockett ET, Remelius C, Hess K, Al-Ghawi H. Gene deletion of P-Selectin and ICAM-1 does not inhibit neutrophil infiltration into peritoneal cavity following cecal ligation-puncture. BMC Clin Pathol. 2004;4(1):2. doi: 10.1186/1472-6890-4-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Cantwell CA, Sterneck E, Johnson PF. Interleukin-6-specific activation of the C/EBPdelta gene in hepatocytes is mediated by Stat3 and Sp1. Mol Cell Biol. 1998;18:2108–2117. doi: 10.1128/mcb.18.4.2108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Shanley TP, Schmal H, Friedl HP, Jones ML, Ward PA. Regulatory effects of intrinsic IL-10 in IgG immune complex-induced lung injury. Journal of immunology. 1995;154:3454–3460. [PubMed] [Google Scholar]
  • 44.Norling LV, Dalli J, Flower RJ, Serhan CN, Perretti M. Resolvin D1 limits polymorphonuclear leukocyte recruitment to inflammatory loci: receptor-dependent actions. Arterioscler Thromb Vasc Biol. 2012;32:1970–1978. doi: 10.1161/ATVBAHA.112.249508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Krishnamoorthy S, Recchiuti A, Chiang N, Fredman G, Serhan CN. Resolvin D1 receptor stereoselectivity and regulation of inflammation and proresolving microRNAs. The American journal of pathology. 2012;180:2018–2027. doi: 10.1016/j.ajpath.2012.01.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Krishnamoorthy S, Recchiuti A, Chiang N, Yacoubian S, Lee CH, Yang R, Petasis NA, Serhan CN. Resolvin D1 binds human phagocytes with evidence for proresolving receptors. Proceedings of the National Academy of Sciences of the United States of America. 2010;107:1660–1665. doi: 10.1073/pnas.0907342107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Lukacs NW, Glovsky MM, Ward PA. Complement-dependent immune complex-induced bronchial inflammation and hyperreactivity. American journal of physiology. Lung cellular and molecular physiology. 2001;280:L512–518. doi: 10.1152/ajplung.2001.280.3.L512. [DOI] [PubMed] [Google Scholar]
  • 48.Cappelletti M, Alonzi T, Fattori E, Libert C, Poli V. C/EBPbeta is required for the late phases of acute phase genes induction in the liver and for tumour necrosis factor-alpha, but not Interleukin-6, regulation. Cell Death Differ. 1996;3:29–35. [PubMed] [Google Scholar]

RESOURCES