Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Aug 1.
Published in final edited form as: Endocr Relat Cancer. 2014 Aug 13;21(5):825–830. doi: 10.1530/ERC-14-0359

Diagnostic and Prognostic TERT Promoter Mutations in Thyroid Fine Needle Aspiration Biopsy

Rengyun Liu 1, Mingzhao Xing 1
PMCID: PMC4175020  NIHMSID: NIHMS625481  PMID: 25121551

Abstract

Two promoter mutations, chr5:1,295,228C>T and chr5:1,295,250C>T, in the gene for telomerase reverse transcriptase (TERT) have been recently identified in thyroid cancers and shown to be important in thyroid tumor pathogenesis. The diagnostic and prognostic potentials of testing these mutations on thyroid fine needle aspiration biopsy (FNAB) have not been investigated. Here, we examined the two TERT promoter mutations along with the BRAF V600E mutation by direct DNA sequencing on 308 FNAB specimens preoperatively obtained from thyroid nodules with postoperatively confirmed pathological diagnoses. We found TERT promoter mutations in 0.0% (0/179) of benign thyroid nodules and 7.0% (9/129) of thyroid nodules of differentiated thyroid cancer, representing a 100% diagnostic specificity and 7.0% sensitivity, with the latter rising to 38.0% (49/129) when combined with BRAF V600E testing. Several TERT promoter mutation-positive thyroid nodules were cytologically indeterminate on FNAB. Nearly 80% of the TERT promoter mutation-positive thyroid nodules were thyroid cancers with aggressive clinicopathological behaviors, such as extrathyroidal invasion, lymph node metastases, distant metastases, disease recurrence or patient death. Thus, a positive TERT promoter mutation test not only definitively diagnoses a thyroid nodule as cancer but also preoperatively identifies a cancer with aggressive potential. This is the first study of TERT promoter mutations on thyroid FNAB, demonstrating the value of this novel molecular testing in the diagnosis of thyroid nodule and preoperative risk stratification of thyroid cancer. Thus, testing of TERT promoter mutations on FNAB will enhance and improve the current molecular-based approaches to the management of thyroid nodule and thyroid cancer.

Keywords: TERT promoter mutation, thyroid cancer, fine needle aspiration biopsy, BRAF V600E mutation, telomerase reverse transcriptase

Introduction

Thyroid cancer is a common endocrine malignancy, which has seen a worldwide rapid rise in incidence in recent years (Howlader et al. 2014; Jemal et al. 2011). In the United States, there are 62,980 new cases of thyroid cancer and 1,890 deaths from this cancer estimated for 2014 (Howlader et al. 2014). The diagnosis of thyroid cancer typically starts from the evaluation of thyroid nodules, which are extremely common, seen in approximately 5–10% of adult people on physical examination and 50–70% of people over the age of 60 years on ultrasonography (Guth et al. 2009; Mazzaferri 1993). Clinical evaluation of thyroid nodules for malignancy is therefore a major task in the practice of thyroid medicine, in which a diagnostic mainstay is fine needle aspiration biopsy (FNAB). FNAB is accurate in most patients in that it can provide a reliable diagnosis of benign or malignant thyroid tumor (Bose & Walts 2012). In about 25–30% of cases, however, FNAB yields indeterminate cytological findings, leaving the diagnosis of thyroid nodules in this group in dilemma. With an overall risk of about 25% for malignancy associated with the indeterminate cytology on FNAB, patients in this group are conventionally recommended for thyroidectomy and, as a result, most of these patients have to sacrifice their thyroid glands for benign thyroid tumors (Cooper et al. 2009). Along with this diagnostic challenge of thyroid nodules, there are also prognostic issues with thyroid cancer. Although thyroid cancer in most patients is indolent with an excellent prognosis, some cases seem to be destined for poor prognosis with increased disease recurrence and patient mortality. Risk stratification for prognostication of thyroid cancer has been conventionally based on clinicopathological risk factors, which are often inaccurate and preoperatively unavailable.

In recent years, molecular-based diagnostic and prognostic approaches for thyroid cancer have been extensively investigated and some molecular markers have been identified and proven to be clinically useful (Xing et al. 2013a). These include diagnostically the gene expression classifier (Alexander et al. 2012), genetic marker panel (Nikiforov et al. 2011), and galctin-3 (Bartolazzi et al. 2008) and prognostically BRAF V600E mutation (Xing et al. 2014a; Xing et al. 2013b). The diagnostic and prognostic accuracy of these markers, however, still have much room for improvement and new markers are needed to this end.

Two recently discovered mutations in the promoter of the gene for telomerase reverse transcriptase (TERT) in thyroid cancer provide promises in this regard— chr5:1,295,228C>T and chr5:1,295,250C>T (termed here as C228T and C250T, respectively), which represent nucleotide changes of-124 C>T and −146 C>T from the ATG translation start site of the TERT gene, respectively. These mutations increase the transcriptional activities of the TERT promoter (Horn et al. 2013; Huang et al. 2013). As such, this discovery has important implications for human cancers as TERT has been known to play an important role in cellular immortality by maintaining telomere length at the end of chromosomes and in promoting other cellular functions such as proliferation and cell cycles (Smekalova et al. 2012; Mocellin et al. 2013). Our group reported the first study on these two mutations in thyroid cancer (Liu X et al. 2013), in which we found a prevalence of mutations of 0.0% (0/85), 11.7% (30/257), 13.9% (11/79), 37.5% (3/8), and 46.3% (25/54) in benign thyroid tumors, papillary thyroid cancers (PTC), follicular thyroid cancer (FTC), poorly differentiated thyroid cancers, and anaplastic thyroid cancer (ATC), respectively. This study also demonstrated an exclusive occurrence of TERT promoter mutations in thyroid cancer but not in benign thyroid tumors and also their association with poor clinicopathological characteristics of thyroid cancer. These findings were confirmed in our and others’ subsequent studies (Liu X et al. 2014; Melo et al. 2014;Vinagre et al. 2013; Liu T et al. 2013 ). We have recently also demonstrated that TERT promoter and BRAF V600E mutations cooperatively identify the most aggressive PTC with the highest recurrence (Xing et al. 2014b). These studies strongly suggest that TERT promoter mutations are potential novel diagnostic and prognostic biomarkers for thyroid cancer. Here, we performed the first study to directly evaluate the value of preoperatively testing TERT promoter mutations on thyroid FNAB specimens in the diagnostic evaluation of thyroid nodules and preoperative prognostic evaluation of thyroid cancer.

Materials and Methods

FNAB samples and DNA preparation

Three hundreds and eight FNAB specimens were obtained preoperatively by FNAB to thyroid nodules in 308 patients who underwent thyroidectomy for established thyroid cancer, cytologically indeterminate thyroid nodules or symptomatic goiter as described previously (Xing, et al. 2009; Xing et al. 2004). Genomic DNA from FNAB specimens was isolated using standard procedures of protease K digestion, phenol–chloroform extraction, and ethanol precipitation. The study was conducted based on an institutional review board-approved protocol and written informed patient consents were obtained where appropriate.

Genomic DNA sequencing to identify TERT promoter and BRAF V600E mutations

Standard polymerase chain reaction (PCR) was performed for direct genomic DNA sequencing to identify TERT promoter mutations as we described previously (Liu X et al. 2013). Briefly, a fragment of the TERT promoter, which contained the sites for TERT promoter mutations C228T and C250T,was amplified by PCR on genomic DNA from FNAB specimens using primers 5' AGTGGATTCGCGGGCACAGA 3'(sense) and 5' CAGCGCTGCCTGAAACTC 3'(antisense). PCR of standard reaction mixture containing about 40–50 ng genomic DNA/reaction was performed with an initial denaturation at 95°C for 3 min, followed by 10 cycles of 95°C denaturation for 30 seconds, 55°C annealing for 30 seconds, and 68°C elongation for 1 min. This was then followed by 30 cycles of the same settings except for the elongation for additional 5 seconds in each cycle and the completion with an elongation at 68°C for 7 min. Quality confirmation of the PCR products was achieved by gel electrophoresis and sequencing PCR was performed using a Big Dye terminator v3.1 cycle sequencing reaction kit (Applied Biosystems) and an ABI PRISM 3730 automated next generation genetic analyzer (Applied Biosystems) at our institutional sequencing facility.

Identification of the BRAF V600E mutation was similarly achieved by direct genomic DNA sequencing as described previously (Xing et al. 2005). Briefly, PCR was performed to amplify exon 15 of the BRAF gene containing the site for the T1799A (V600E) mutation using primers TCATAATGCTTGCTCTGATAGGA (sense) and GGCCAAAAATTTAATCAGTGGA (antisense). This resulted in a 212-bp PCR product. The PCR settings included one cycle of 95°C for 5 min; two cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min; two cycles of 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min; 35 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 1 min, followed by an extension at 72°C for 5 min. After quality confirmation by gel electrophoresis, the PCR products were subjected to Big Dye reaction and sequencing analysis.

Results

Diagnostic potential of testing thyroid FNAB specimens for TERT promoter mutations

We analyzed the status of the two TERT promoter mutations and BRAF V600E mutation on 308 FNAB specimens obtained preoperatively from 308 patients with confirmed postoperative pathological diagnosis of the biopsied thyroid nodules. These included 111 PTC, 18 FTC, and 179 benign thyroid nodules (including 111 cases of adenomas, 55 cases of multinodular hyperplasia, and 13cases of Hashimoto's thyroiditis). As shown in Table 1, no TERT promoter mutation was found in any of the 179 benign thyroid nodules. TERT promoter mutations C228T and C250T were found in 9 cases of thyroid cancers, including 5 PTC and 4 FTC, with a collective prevalence of 7.0% (9/129) in thyroid cancers, which was slightly lower than the reported prevalence in these cancers (Liu et al. 2013; Liu et al. 2014; Melo et al. 2014; Vinagre et al. 2013), likely reflecting the compromised detection sensitivity of direct genetic sequencing on FNAB specimens which often contain sparse cancer cells as addressed previously (Xing et al. 2004). The BRAF V600E mutation was found solely in thyroid nodules of PTC, being 37.8% (42/111), which was slightly lower than the prevalence of this mutation generally seen in PTC (Xing 2005; Xing 2007), again reflecting an under detection by direct genetic sequencing on FNAB specimens (Xing et al. 2004). There were two cases of BRAF V600E-positive PTC that additionally harbored TERT promoter mutations, with one harboring TERT C228T and the other harboring TERT C250T. If any mutation was counted, the collective prevalence of TERT promoter and BRAF V600E mutations was 40.5% (45/111) in thyroid nodules of PTC. When thyroid nodules of PTC and FTC were collectively analyzed, BRAF V600E was found in 32.6% (42/129) and TERT promoter and BRAF mutations were collectively found in 38.0% (49/129) of the cases. Based on these results, the diagnostic specificity of TERT promoter mutations on FANB specimens for thyroid cancer was 100% and sensitivity 7.0%. When TERT promoter mutations were used in combination with BRAF V600E, the diagnostic specificity remained to be 100% and the sensitivity rose to 38.0%. This also represented an increase from the diagnostic sensitivity of 32.6% when BRAF mutation alone was used (Table 1). Three cases of the TERT promoter mutation-positive thyroid nodules of FTC showed indeterminate cytological findings on FNAB. Thus preoperative testing for TERT promoter mutations on FNAB could help make a definitive diagnosis of thyroid cancer in these cases of thyroid nodules.

Table 1.

Testing for TERT promoter and BRAF V600E mutations on thyroid fine needle aspiration biopsy

Thyroid
conditions		 TERT C228T
mutation, n/N
(%)		 TERT C250T
mutation, n/N
(%)		 Two TERT
mutations
collectively		 BRAF V600E
mutation, n/N
(%)		 Any
mutation**
Benign thyroid
nodules* 		0/179(0) 0/179(0) 0/179(0) 0/179(0) 0/179(0)
PTC 4/111(3.6) 1/111(0.9) 5/111(4.5) 42/111(37.8) 45/111(40.5)
FTC 3/18(16.7) 1/18(5.6) 4/18(22.2) 0/18(0) 4/18(22.2)
PTC+FTC 7/129(5.4) 2/129(1.6) 9/129(7.0) 42/129(32.6) 49/129(38.0)
Open in a new tab
*

Benign thyroid nodules included 111cases of adenomas, 55 cases of multinodular hyperplasia, and 13cases of Hashimoto's thyroiditis.

**

One case of PTC harbored both TERT C228T and BRAF V600E mutations and another harbored both TERT C250T and BRAF V600E mutations. PTC, papillary thyroid cancer; FTC, follicular thyroid cancer.

Prognostic potential of preoperatively testing thyroid FNAB specimens for TERT promoter mutations

The TERT promoter mutation-positive thyroid nodules mostly were thyroid cancers that exhibited aggressive clinicopathological outcomes, such as lymph node metastases, extrathyroidal invasion, distant metastases, tumor recurrence or even patient death. Four of the five patients with TERT promoter mutation-positive thyroid nodules of PTC had such outcomes. Specifically, patient 1 (MX225), positive on preoperative FNAB for TERT C228T, was a 51-year-old man, in whom thyroidectomy revealed a 2.0-cm PTC in the right thyroid lobe with extrathyroidal invasion and metastases in 20/85 neck lymph nodes. Patient 2 (MX 249), positive on preoperative FNAB for TERT C228T, was also a 51-year-old man, in whom thyroidectomy revealed a 3.5 cm tumor with mixed PTC and ATC in the left thyroid lobe with extrathyroidal invasion and metastases in 11 of 18 lymph nodes. Post-surgery imaging showed extensive metastases in the lungs. He died one year after the initial diagnosis. Patient 3 (MX279), positive on preoperative FNAB for both the TERT C228T and BRAF V600E mutations, was a 54-year-old man, in whom thyroidectomy revealed a 2.5-cm PTC with tall cell component in the right thyroid lobe, with metastases in 7/16 lymph nodes and invasion to trachea, requiring tracheotomy. He had metastatic recurrence to the right posterior ilium and the lungs at the follow-up of 31 months after the initial treatments, which were radioiodine non-avid. Patient 4 (MX466), positive on preoperative FNAB both for TERT C250T and BRAF V600E, was a 74-year-old man, in whom thyroidectomy revealed multifocal PTC with the largest being 3.0 cm in the left thyroid lobe with vascular invasion and metastases in 4 of 11 lymph nodes. Even with radioiodine ablation after thyroidectomy, thyrotropin-stimulated thyroglobulin rose to 3.0 ng/mL 38 months after the initial treatments, which was undergoing further diagnostic evaluations at the time of this writing. Patient 5 (MX525), positive for TERT C228T mutation on preoperative FNAB, was a 47-year-old man, in whom thyroidectomy revealed a 2.5-cm PTC in the right thyroid lobe without lymph node removal. He continued to be doing well with no apparent disease recurrence 55 months after the initial treatments. The two cases of patients with coexisting TERT promoter and BRAF V600E mutations both had disease recurrence.

Three of the four patients with TERT promoter mutation-positive thyroid nodules of FTC exhibited poor clinicopathological outcomes. Specifically, patient 1 (MX39), positive on preoperative FNAB for TERT C228T, was a 54-year-old woman, in whom thyroidectomy revealed a worrisome large FTC of 6.5 cm and she is currently clinically followed. Patient 2 (MX66), positive on preoperative FNAB for TERT C250T, was a 77-year-old man, in whom thyroidectomy reveled a 8.0- cm FTC in the left thyroid lobe, with gradually rising serum thyroglobulin in the subsequent years, and a 6.0-cm recurrent FTC in the left neck as well as lungs metastases were found 11 years after the initial treatments. Patient 3 (MX238), positive for TERT C228T mutation on preoperative FNAB, was a 74-year-old man, in whom thyroidectomy revealed a 5.0-cm FTC in the right thyroid lobe with extensive extrathyroidal and vascular invasion. Post-radioiodine therapy body scan showed wide bony metastasis to clivus in the skull base, sternum, proximal right upper extremity, right proximal humerus, thoracic and lumbar spine, a left posterior inferior rib, right scapula, pelvis, and bilateral femurs. The patient died from extensive FTC metastases 10 months after the initial diagnosis and treatments. Patient 4 (MX488), positive on preoperative FNAB for TERT C250T, was a 67-year-old woman, in whom thyroidectomy revealed a 1.5-cm FTC in the left thyroid lobe with no recurrence at 32 months of follow-up after the initial treatments.

Overall, seven of nine (78%) thyroid cancer patients who were TERT promoter mutation-positive on preoperative FNAB testing of the thyroid nodules exhibited aggressive tumor behaviors and poor clinical outcomes, including disease recurrence and patient deaths in several cases. This represents a poorer prognosis than generally seen with PTC and FTC.

Discussion

This is the first study directly investigating the diagnostic and prognostic potentials of preoperatively testing on thyroid FNAB specimens for the recently discovered TERT promoter mutations in thyroid cancer. The prevalence of TERT promoter mutations in differentiated thyroid cancer (PTC and FTC) found in the present study was lower than the generally reported prevalence in primary tumors, reflecting an expected underestimate on mutation testing by direct DNA sequencing on FNAB specimens due to spare cancer cells sometimes (Xing et al. 2004). This test sensitivity can be expected to be improved by using more sensitive testing modalities, such as the Mutector colorimetric assay (Xing et al. 2009; Xing et al. 2004) or the real-time Light Cycler PCR and fluorescence melting curve analysis (Nikiforov et al. 2011). Nevertheless, the present study principally demonstrates the feasibility of testing TERT promoter mutations on routine FNAB specimens. Compared with the BRAF V600E mutation, the prevalence of TERT promoter mutations is relatively low in thyroid cancer. Thus, the diagnostic sensitivity of TERT promoter mutation testing alone on FANB is low. The sensitivity, however, could be increased when TERT promoter mutations are used in combination with other diagnostic molecular markers. This may be true particularly when more sensitive testing methods are used and TERT promoter mutations are tested in conjunction with the currently known molecular markers, such as BRAF mutation, RAS mutation, and RET-PTC and PAX8/PPARγ rearrangements, which had a sensitivity of close to 90% for thyroid nodules of indeterminate cytology on FNAB (Nikiforov et al. 2011). BRAF mutation has an established diagnostic and prognostic utility for thyroid cancer when detected on FNAB specimens (Xing et al. 2004; Xing et al. 2009; Mekel et al. 2010). The present study demonstrated that addition of TERT promoter mutations could increase the diagnostic sensitivity of BRAF V600E mutation for thyroid cancer and were helpful in making a definitive diagnosis of thyroid cancer in some cases of cytologically indeterminate thyroid nodules. Thus, it is expectable that inclusion of TERT promoter mutations would improve the diagnostic sensitivity of the currently used panel of diagnostic genetic molecular markers for thyroid cancer, likely brining the sensitivity to above 90%. It is also possible that addition of TERT promoter mutations may improve the diagnostic values of the gene expression classifier (Alexanderet al. 2012) and galectin-3 (Bartolazziet al. 2008). Importantly, in a large number of benign FNAB specimens, we found no TERT promoter mutation, consistent with the similar findings in primary tumors in several recent studies (Liu X et al. 2013; Liu X et al. 2014; Melo et al. 2014; Vinagre et al. 2013), thus demonstrating a 100% diagnostic specificity. This means that a positive TERT promoter mutation test result on FNAB makes a definitive diagnosis of thyroid cancer. Therefore, testing of TERT promoter mutations on FANB, particularly when used in conjunction with testing of the currently established molecular markers, will most likely have a useful diagnostic value that may improve the current diagnostic evaluation of thyroid nodules.

Several studies demonstrated an association of TERT promoter mutations with aggressive clinicopathological characteristics (Liu X et al. 2013; Liu X et al. 2014; Melo et al. 2014; Xing et al. 2014b; Liu T et al. 2013). Consistent with these studies on primary tumors, the present study demonstrated that TERT promoter mutation-positive thyroid nodules were not only 100% malignant tumors but these cancers mostly also behaved aggressively. Seven of the nine (78%) TERT promoter mutation-positive thyroid nodules turned out to be aggressive cancers with multiple aggressive clinicopathological behaviors, including lymph node metastasis, extrathyroidal and local invasion, distant metastasis, tumor recurrence or patient deaths. In a cohort of 507 cases of PTC patients, we recently demonstrated that coexistence of TERT promoter and BRAF mutations was associated with particularly aggressive clinicopathological outcomes of PTC, including a dramatically increased recurrence risk (Xing et al. 2014b). To be consistent with these findings, the present study found two such cases of PTC with dual mutations, both of which had aggressive tumor behaviors and disease recurrence. The lower rate of coexisting TERT promoter and BRAF mutations found in the present study again likely reflects the relatively low sensitivity of direct genetic sequencing on FNAB specimens (Xing et al. 2004). The present results on directly testing TERT promoter mutations on FANB specimens provide the first direct evidence demonstrating the prognostic potential of preoperatively testing these mutations for thyroid cancer— a positive result of TERT promoter mutation predicts preoperatively poorer clinicopathological outcomes of thyroid cancer. Thus, such a positive preoperative TERT promoter mutation test result would favor more aggressive treatments of the patient, such as more aggressive initial thyroid surgery and subsequent more vigilant monitoring for disease recurrence.

In summary, this is the first study of preoperatively testing TERT promoter mutations along with BRAF V600E on FNAB, demonstrating strong diagnostic and prognostic potentials of this novel molecular test for thyroid cancer. The results provide important evidence supporting the inclusion of TERT promoter mutations in the currently used thyroid molecular testing to assist the diagnosis of thyroid nodules and preoperative risk stratification for better management of thyroid cancer.

Acknowledgements

This study was supported by NIH grant R01CA113507 to M Xing.

References

  1. Alexander EK, Kennedy GC, Baloch ZW, Cibas ES, Chudova D, Diggans J, Friedman L, Kloos RT, LiVolsi VA, Mandel SJ, et al. Preoperative diagnosis of benign thyroid nodules with indeterminate cytology. New England Journal of Medicine. 2012;367:705–715. doi: 10.1056/NEJMoa1203208. [DOI] [PubMed] [Google Scholar]
  2. Bartolazzi A, Orlandi F, Saggiorato E, Volante M, Arecco F, Rossetto R, Palestini N, Ghigo E, Papotti M, Bussolati G, et al. Galectin-3-expression analysis in the surgical selection of follicular thyroid nodules with indeterminate fine-needle aspiration cytology: a prospective multicentre study. Lancet Oncology. 2008;9:543–549. doi: 10.1016/S1470-2045(08)70132-3. [DOI] [PubMed] [Google Scholar]
  3. Bose S, Walts AE. Thyroid fine needle aspirate: a post-Bethesda update. Adv Anat Pathol. 2012;19:160–169. doi: 10.1097/PAP.0b013e3182534610. [DOI] [PubMed] [Google Scholar]
  4. Cooper DS, Doherty GM, Haugen BR, Kloos RT, Lee SL, Mandel SJ, Mazzaferri EL, McIver B, Pacini F, Schlumberger M, et al. Revised American Thyroid Association management guidelines for patients with thyroid nodules and differentiated thyroid cancer. Thyroid. 2009;19:1167–1214. doi: 10.1089/thy.2009.0110. [DOI] [PubMed] [Google Scholar]
  5. Guth S, Theune U, Aberle J, Galach A, Bamberger CM. Very high prevalence of thyroid nodules detected by high frequency (13 MHz) ultrasound examination. European Journal of Clinical Investigation. 2009;39:699–706. doi: 10.1111/j.1365-2362.2009.02162.x. [DOI] [PubMed] [Google Scholar]
  6. Horn S, Figl A, Rachakonda PS, Fischer C, Sucker A, Gast A, Kadel S, Moll I, Nagore E, Hemminki K, et al. TERT promoter mutations in familial and sporadic melanoma. Science. 2013;339:959–961. doi: 10.1126/science.1230062. [DOI] [PubMed] [Google Scholar]
  7. Howlader N, Noone AM, Krapcho M, Garshell J, Miller D, Altekruse SF, Kosary CL, Yu M, Ruhl J, Tatalovich Z, et al. SEER Cancer Statistics Review, 1975–2011. Bethesda, MD: National Cancer Institute; 2014. http://seer.cancer.gov/csr/1975_2011/, based on November 2013 SEER data submission, posted to the SEER web site, April 2014. [Google Scholar]
  8. Huang FW, Hodis E, Xu MJ, Kryukov GV, Chin L, Garraway LA. Highly recurrent TERT promoter mutations in human melanoma. Science. 2013;339:957–959. doi: 10.1126/science.1229259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA: A Cancer Journal for Clinicians. 2011;61:69–90. doi: 10.3322/caac.20107. [DOI] [PubMed] [Google Scholar]
  10. Liu X, Bishop J, Shan Y, Pai S, Liu D, Murugan AK, Sun H, El-Naggar AK, Xing M. Highly prevalent TERT promoter mutations in aggressive thyroid cancers. Endocrine-Related Cancer. 2013;20:603–610. doi: 10.1530/ERC-13-0210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Liu X, Qu S, Liu R, Sheng C, Shi X, Zhu G, Murugan AK, Guan H, Yu H, Wang Y, et al. TERT promoter mutations and their association with BRAF V600E mutation and aggressive clinicopathological characteristics of thyroid cancer. Journal of Clinical Endocrinology and Metabolism. 2014;99:E1130–E1136. doi: 10.1210/jc.2013-4048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Liu T, Wang N, Cao J, Sofiadis A, Dinets A, Zedenius J, Larsson C, Xu D. The age- and shorter telomere-dependent TERT promoter mutation in ollicular thyroidcell-derived carcinomas. Oncogene. 2013 doi: 10.1038/onc.2013.446. 2013 Oct 21 [Epub ahead of print] [DOI] [PubMed] [Google Scholar]
  13. Mazzaferri EL. Management of a solitary thyroid nodule. N Engl J Med. 1993;328:553–559. doi: 10.1056/NEJM199302253280807. [DOI] [PubMed] [Google Scholar]
  14. Mekel M, Nucera C, Hodin RA, Parangi S. Surgical implications of B-RafV600E mutation in fine-needle aspiration of thyroid nodules. American Journal of Surgery. 2010;200:136–143. doi: 10.1016/j.amjsurg.2009.08.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Melo M, da Rocha AG, Vinagre J, Batista R, Peixoto J, Tavares C, Celestino R, Almeida A, Salgado C, Eloy C, et al. TERT promoter mutations are a major indicator of poor outcome in differentiated thyroid carcinomas. Journal of Clinical Endocrinology and Metabolism. 2014;99:E754–E765. doi: 10.1210/jc.2013-3734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Mocellin S, Pooley KA, Nitti D. Telomerase and the search for the end of cancer. Trends in Molecular Medicine. 2013;19:125–133. doi: 10.1016/j.molmed.2012.11.006. [DOI] [PubMed] [Google Scholar]
  17. Nikiforov YE, Ohori NP, Hodak SP, Carty SE, LeBeau SO, Ferris RL, Yip L, Seethala RR, Tublin ME, Stang MT, et al. Impact of mutational testing on the diagnosis and management of patients with cytologically indeterminate thyroid nodules: a prospective analysis of 1056 FNA samples. Journal of Clinical Endocrinology and Metabolism. 2011;96:3390–3397. doi: 10.1210/jc.2011-1469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Smekalova EM, Shubernetskaya OS, Zvereva MI, Gromenko EV, Rubtsova MP, Dontsova OA. Telomerase RNA biosynthesis and processing. Biochemistry (Mosc) 2012;77:1120–1128. doi: 10.1134/S0006297912100045. [DOI] [PubMed] [Google Scholar]
  19. Vinagre J, Almeida A, Populo H, Batista R, Lyra J, Pinto V, Coelho R, Celestino R, Prazeres H, Lima L, et al. Frequency of TERT promoter mutations in human cancers. Nature Communications. 2013;4:2185. doi: 10.1038/ncomms3185. [DOI] [PubMed] [Google Scholar]
  20. Xing M, Alzahrani AS, Carson KA, Shong YK, Kim TY, Viola D, Elisei R, Bendlová B, Yip L, Mian C, et al. Association between BRAF V600E mutation and recurrence of papillary thyroid cancer. Journal of Clinical Oncology. 2014a doi: 10.1200/JCO.2014.56.8253. [In press]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Xing M, Haugen BR, Schlumberger M. Progress in molecular-based management of differentiated thyroid cancer. Lancet. 2013a;381:1058–1069. doi: 10.1016/S0140-6736(13)60109-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Xing M, Alzahrani AS, Carson KA, Viola D, Elisei R, Bendlova B, Yip L, Mian C, Vianello F, Tuttle RM, et al. Association between BRAF V600E mutation and mortality in patients with papillary thyroid cancer. JAMA-Journal of the American Medical Association. 2013b;309:1493–1501. doi: 10.1001/jama.2013.3190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Xing M, Clark D, Guan H, Ji M, Dackiw A, Carson KA, Kim M, Tufaro A, Ladenson P, Zeiger M, et al. BRAF mutation testing of thyroid fine-needle aspiration biopsy specimens for preoperative risk stratification in papillary thyroid cancer. Journal of Clinical Oncology. 2009;27:2977–2982. doi: 10.1200/JCO.2008.20.1426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Xing M, Liu R, Liu X, Murugan AK, Zhu G, Zeiger MA, Pai S, Bishop J. BRAF V600E and TERT Promoter Mutations Cooperatively Identify the Most Aggressive Papillary Thyroid Cancer With Highest Recurrence. Journal of Clinical Oncology. 2014b doi: 10.1200/JCO.2014.55.5094. pii: JCO. 55.5094. [Epub ahead of print]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Xing M, Tufano RP, Tufaro AP, Basaria S, Ewertz M, Rosenbaum E, Byrne PJ, Wang J, Sidransky D, Ladenson PW. Detection of BRAF mutation on fine needle aspiration biopsy specimens: a new diagnostic tool for papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism. 2004;89:2867–2872. doi: 10.1210/jc.2003-032050. [DOI] [PubMed] [Google Scholar]
  26. Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, Carson KA, Vasko V, Larin A, Tallini G, et al. BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism. 2005;90:6373–6379. doi: 10.1210/jc.2005-0987. [DOI] [PubMed] [Google Scholar]
  27. Xing M. BRAF mutation in thyroid cancer. Endocrine-Related Cancer. 2005;12:245–262. doi: 10.1677/erc.1.0978. [DOI] [PubMed] [Google Scholar]
  28. Xing M. BRAF mutation in papillary thyroid cancer: pathogenic role, molecular bases, and clinical implications. Endocrine Reviews. 2007;28:742–762. doi: 10.1210/er.2007-0007. [DOI] [PubMed] [Google Scholar]

RESOURCES