Insights into the Biosynthesis and Assembly of Cryptophycean Phycobiliproteins

Background: Cryptophytes like Guillardia theta utilize soluble phycobiliproteins for light-harvesting.

Results: Guillardia theta adopted phycoerythrobilin biosynthesis from cyanobacteria, and the phycobiliprotein lyase GtCPES provides structural requirements for transfer of this chromophore to a specific cysteine residue of the apophycobiliprotein.

Conclusion: Phycobiliprotein synthesis in Guillardia theta combines proven and novel components.

Significance: Results provide a better understanding of the evolution and function of unusual phycobiliproteins in cryptophytes.

Abstract

Phycobiliproteins are employed by cyanobacteria, red algae, glaucophytes, and cryptophytes for light-harvesting and consist of apoproteins covalently associated with open-chain tetrapyrrole chromophores. Although the majority of organisms assemble the individual phycobiliproteins into larger aggregates called phycobilisomes, members of the cryptophytes use a single type of phycobiliprotein that is localized in the thylakoid lumen. The cryptophyte Guillardia theta (Gt) uses phycoerythrin PE545 utilizing the uncommon chromophore 15,16-dihydrobiliverdin (DHBV) in addition to phycoerythrobilin (PEB). Both the biosynthesis and the attachment of chromophores to the apophycobiliprotein have not yet been investigated for cryptophytes. In this study, we identified and characterized enzymes involved in PEB biosynthesis. In addition, we present the first in-depth biochemical characterization of a eukaryotic phycobiliprotein lyase (GtCPES). Plastid-encoded HO (GtHo) was shown to convert heme into biliverdin IXα providing the substrate with a putative nucleus-encoded DHBV:ferredoxin oxidoreductase (GtPEBA). A PEB:ferredoxin oxidoreductase (GtPEBB) was found to convert DHBV to PEB, which is the substrate for the phycobiliprotein lyase GtCPES. The x-ray structure of GtCPES was solved at 2.0 Å revealing a 10-stranded β-barrel with a modified lipocalin fold. GtCPES is an S-type lyase specific for binding of phycobilins with reduced C15=C16 double bonds (DHBV and PEB). Site-directed mutagenesis identified residues Glu-136 and Arg-146 involved in phycobilin binding. Based on the crystal structure, a model for the interaction of GtCPES with the apophycobiliprotein CpeB is proposed and discussed.

Introduction

Cryptophytes, cyanobacteria, red algae, and glaucophytes perform oxygenic photosynthesis using chlorophyll-containing antenna complexes and additional light-harvesting proteins, termed phycobiliproteins (PBP)³ (1, 2). PBPs allow the organisms to efficiently absorb light in regions of the visible spectrum that are absorbed poorly by chlorophylls. In contrast to the (αβ)₃ trimeric or hexameric PBPs of cyanobacteria (2–4), the cryptophycean PBPs are (αβ)(α′β) heterodimers and are not organized in phycobilisomes but occur as soluble proteins in the thylakoid lumen (1, 5). In the phycobilisomes of a given cyanobacterial species, the PBPs allophycocyanin and phycocyanin and additionally species-specific phycoerythrin (PE) and/or phycoerythrocyanin are present (6–8). In contrast, each cryptophyte species uses a single modified PBP-type (5, 9). All PBPs are associated with open-chain tetrapyrrole chromophores, the phycobilins. Cyanobacterial PBPs use the phycobilins phycocyanobilin (PCB), phycoerythrobilin (PEB), phycoviolobilin, and phycourobilin as light-harvesting chromophores. Interestingly, in cryptophycean PBPs the uncommon chromophores 15,16-dihydrobiliverdin (DHBV), 18¹,18²-dihydrobiliverdin, bilin 584, and bilin 618 occur in addition to PCB and PEB (8, 10, 11).

The cryptophyte Guillardia theta utilizes a PE with an absorption maximum at 545 nm (PE545) as a PBP (12). In the holoprotein, one molecule of DHBV is covalently linked to each α-subunit, and each β-subunit is associated with three molecules of PEB (13, 14). The biosynthesis of the phycobilin cofactors and their assembly with the PBP apoprotein has been studied extensively in cyanobacteria (15). Generally, phycobilin biosynthesis starts with the oxygenolytic cleavage of heme by ferredoxin-dependent HO yielding the first open-chain tetrapyrrole biliverdin IXα (BV IXα) (16–18). Further reduction of BV obtaining PCB, PEB, and phytochromobilin (PΦB) is catalyzed by ferredoxin-dependent bilin reductases (FDBR) (16, 19, 20). In cyanobacteria, PEB biosynthesis is performed by 15,16-DHBV:ferredoxin oxidoreductase (PebA) converting BV IXα to the intermediate DHBV, which is subsequently reduced to PEB by the second FDBR PEB:ferredoxin oxidoreductase (PebB) (16, 21). Interestingly, PebS from the cyanophage P-SSM2 is capable of performing a four-electron reduction of BV IXα, directly yielding PEB (20).

Once synthesized, the phycobilin is bound by a specific PBP lyase, which then facilitates the ligation of the chromophore to a specific cysteine residue within the apo-PBP (22–24). PBP lyases are distinguishable in the clades of E/F-, S/U-, and T-type lyases, and some members of the E/F-type have an additional isomerase function (25–27).

Because of their evolution by secondary endosymbiosis, cryptophytes are extraordinary organisms. They are derived from a eukaryotic ancestor host cell that engulfed a red algal cell. The red alga was reduced to a complex plastid within the cryptophyte cell (28, 29). Hence, cryptophytes possess the following four genomes: the endosymbiont-derived plastidial and nucleomorph genomes and the mitochondrial and host nuclear genome. Many of the endosymbiotic genes involved were transferred to the host nucleus during evolution (30). Cryptophytes retained the capability of performing oxygenic photosynthesis like red alga or cyanobacteria, but their light-harvesting machinery has been extensively modified as demonstrated by their unusual PBPs. Hence, biosynthesis and assembly of PBPs are largely unexplored in cryptophytes. With the release of the G. theta nuclear genome sequence in 2011, a wealth of information has been made available to study these processes (31). About 51% of the nucleus-encoded proteins are unique, and 49% have homologs in other organisms. For instance, the cryptophycean PBP α-subunits share no homology to those of cyanobacteria or any other known proteins (32). In this study, we investigated the similarities and differences of PBP synthesis and assembly in cryptophytes compared with cyanobacteria. With the help of BLAST analyses of the different genomes of G. theta, we found several genes encoding proteins potentially involved in phycobilin biosynthesis and PBP assembly. We give first insights into cryptophycean PEB biosynthesis, which seems to be adopted from cyanobacteria. Moreover, we present the first crystal structure of a eukaryotic PBP lyase, the CpeS lyase from G. theta (GtCPES). This lyase was also characterized in terms of phycobilin specificity, affinity, and binding kinetics. GtCPES belongs to the clade of S/U-type lyases and is restricted to binding of DHBV and PEB.

EXPERIMENTAL PROCEDURES

Materials

All chemicals were American Chemical Society grade or better unless specified otherwise. All assay components were purchased from Sigma. PreScission protease and expression vector pGEX-6P-1 were obtained from GE Healthcare; pASK-IBA7+ was from IBA, and pGro7 was from TaKaRa. Protino® glutathione-agarose 4B from Macherey-Nagel, Strep-Tactin®-Sepharose from IBA, and TALON® metal affinity resin from Clontech were used. HPLC-grade acetone, acetonitrile, formic acid, and spectroanalytical grade glycerol were obtained from Mallinckrodt Baker. Sep-Pak cartridges were obtained from Waters. BV was obtained from Frontier Scientific, Carnforth, Lancashire, UK.

Construction of Expression Vectors and Site-directed Mutagenesis

For construction of most plasmids, synthetic genes that had been codon-optimized for Escherichia coli K12 (GENEius algorithm, MWG Eurofins Operon) were employed. The synthetic genes were PCR-amplified from vectors supplied by MWG Eurofins Operon containing the appropriate sequence with primers encompassing selected recognition sites for cloning into an appropriate host vector. The plastid-encoded HO from G. theta was PCR-amplified from total genomic DNA, and the corresponding PCR product was also cloned into a host vector. Expression plasmids, the corresponding primers, recognition sites, the host vectors, and GenBank^TM accession numbers of the used synthetic genes are summarized in Table 1. All site-directed variants of GtCPES were generated from pGtCPES using the QuikChange® site-directed mutagenesis kit (Stratagene) with help of primers listed in Table 1 (shown is only the forward primer; the reverse primer is the complement, and introduced base pair changes are underlined). The resulting plasmids were verified by sequencing. The construction of the plasmid pho1pebS was described before (20).

TABLE 1.

Constructed expression plasmids

Plasmid	Host vector	Recognition sites	Primers (5′ to 3′)	GenBankTM; synthetic gene
pGtHo	pASK-IBA7+ (IBA)	EcoRI	CGAATTCATGTCAAATAATTTAGCTAT
		XhoI	CCTCGAGTTAACTAAAATTTAGCATTA
pGtPEBA	pGEX-6P1 (GE Healthcare)	EcoRI	GCGAATTCTTCCCGGAAGGCTT	KJ676828
		NotI	ATGCGGCCGCTCATTCGGCTTT
pGtPEBB	pGEX-6P1 (GE Healthcare)	EcoRI	GGAATTCTTTCAGCTCGGGACTCCCG	KJ676830
		NotI	TGCGGCCGCTCAGAGGGGCGTGG
pGtCPES	pASK-IBA7+(IBA)	BsaI	ATGGTAGGTCTCAGCGCATGTCGGTGGAAGAGTTCTTTGAG	KJ676836
		BsaI	ATGGTAGGTCTCATATCATTTGCTTTTGTCGCGTACTTCGG
pC149A	pGtCPES		CGGATTTACGCATGCGTGCCAGCATCATCAAGACAC
pE136A	pGtCPES		CGTGCTGCAGCCGAAGCACGCATTTGGTTTGCG
pR146A	pGtCPES		GCGACACCGGATTTAGCCATGCGTTGCAGCATC
pR148A	pGtCPES		CGACACCGGATTTACGCATGGCTTGCAGCATCATCAAG
pET-GtCPES	pETDuet (Novagen)	NdeI	ATACATATGTCGGTGGAAGAG	KJ676836
		XhoI	TCCTCGAGTTTGCTTTTGTCGC

Production and Purification of Recombinant Proteins

A culture of E. coli BL21 (DE3) carrying the respective expression plasmid was incubated at 37 °C and 150 rpm in LB medium (GtHo and GtPEBA, supplemented with 100 mm sorbitol and 2.5 mm betaine) to an A_{578 nm} of 0.6. For production of GtCPES co-expression of chaperones, GroEL and GroES (pGro7; TaKaRa) were induced by addition of 0.5 mg/ml l-arabinose, and cells were grown to an A_{578 nm} of 0.7–0.8. Subsequently, cells were induced with isopropyl β-d-thiogalactopyranoside (0.5 mm; pGEX-6P1 derivatives) or anhydrotetracycline (200 ng/ml; pASK-IBA7+ derivatives) and incubated overnight at 17 °C (GtPEBA and GtCPES) or 30 °C (GtHO and GtPEBB). Cells were harvested by centrifugation, resuspended in lysis buffer (50 mm Tris-HCl, pH 7.5, 100 mm NaCl, 10% glycerol), and disrupted by two passages through a Constant Systems Cell Disruptor at 35,000 p.s.i. (GtHo, GtPEBA, and GtPEBB) or two times with a 2.5-min sonication (GtCPES). After separation of cell debris, the supernatant was loaded onto a column containing Protino® glutathione-agarose 4B (Macherey & Nagel; GtPEBA and GtPEBB) or a Strep-Tactin-Sepharose® (IBA; GtCPES). Purification was carried out according to the manufacturer's instructions based on sodium phosphate buffer (60 mm sodium phosphate, 300 mm NaCl, pH 7.5; GtCPES), potassium phosphate buffer (100 mm potassium phosphate, 100 mm NaCl, pH 7.2; GtHo) or TES/KCl buffer (25 mm TES, 100 mm KCl, pH 7.5; GtPEBA and GtPEBB). If required, purified GST-GtPEBB was incubated with PreScission protease (GE Healthcare) and dialyzed against cleavage buffer (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 1 mm EDTA, 1 mm DTT). Tag-free GtPEBB was then obtained by a second affinity chromatography. Purified proteins were dialyzed three times against appropriate buffers mentioned above and concentrated using Vivaspin 6 concentrators (molecular mass cutoff 10,000 Da; Sartorius Stedim). Concentrations of proteins were determined using the calculated molar extinction coefficient ϵ₂₈₀ (33).

Selenomethionine-GtCPES Preparation for Crystallization Studies

For crystallization experiments, StrepII-GtCPES was produced and purified as described above, but transferred into crystallization buffer (20 mm HEPES, 25 mm NaCl, pH 7.5) via size exclusion chromatography (Superdex 200 10/300 GL). Selenomethionyl (SeMet)-GtCPES was produced and purified as described for GtCPES with modifications according to Van Duyne et al. (34). Cells were grown in M9 medium supplemented with 1 mg/ml vitamins (riboflavin, niacinamide, pyridoxine, and thiamine) and trace element mixture. An amino acid mixture (lysine, threonine, and phenylalanine: 0.1 g/liter; leucine, isoleucine, valine, and l(+)-selenomethionine: 0.05 g/liter) was added 30 min prior to induction. All buffers used during purification were supplemented with 10 mm β-mercaptoethanol.

Co-expression Experiments

Heterologous co-expression of GtCPES and PEB biosynthesis enzymes was performed in E. coli BL21(DE3) containing pET-GtCPES and pho1pebS. Cultures were grown in LB medium supplemented with 100 mm sorbitol and 2.5 mm betaine at 37 °C, 150 rpm to an A_{578 nm} of 0.6 prior to induction with 0.5 mm isopropyl β-d-thiogalactopyranoside and incubated overnight at 17 °C (16 h). Afterwards, cells were harvested, and the blue-colored cells were disrupted by sonication, and the supernatant was separated from cell debris by centrifugation. The His₆-GtCPES·PEB complex was purified by affinity chromatography using TALON® metal affinity resin (Clontech). The purification was carried out according to the manufacturer's instructions based on sodium phosphate buffer, pH 7.5.

Preparation of Phycobilins

BV IXα was obtained from Frontier Scientific. The preparative production of DHBV was performed in vitro under anaerobic conditions as described before (21, 35, 36). 3(E)-PCB was isolated from Spirulina cells as described previously (37). For preparation of 3(E)- and 3(Z)-PEB, the plasmids pET-GtCPES and pho1pebS were co-expressed in E. coli BL21(DE3), and the His₆-GtCPES·PEB complex was purified as described above. The dark blue elution fraction was immediately diluted 10-fold in 0.1% TFA to precipitate proteins. PEB was extracted using a Sep-Pak Plus C18 cartridge, concentrated, and dried with help of a SpeedVac concentrator. The isolated PEB/isomer mixture was analyzed and separated into 3(E)- and 3(Z)-PEB via HPLC using a Ultracarb 5μ ODS C18 column (Phenomenex) as described previously (21). Separated 3(E)- and 3(Z)-PEB fractions were collected, pooled, evaporated until dryness with a SpeedVac concentrator, and stored at −20 °C. Phycobilins were resuspended in an appropriate amount of DMSO immediately before use. Concentrations were determined using ϵ₅₇₁ = 46.9 mm⁻¹ cm⁻¹ (3(E)-PEB) (38) and ϵ₆₈₅ = 37.15 mm⁻¹ cm⁻¹ (3(E)-PCB) (39). Because of the absence of a reported extinction coefficient for 3(Z)-PEB and DHBV, ϵ₅₇₁ and ϵ₅₆₄ of the related 3(E)-PEBs were used.

Analysis of HO and FDBR Activity

After expression of GtHo in E. coli BL21 (DE3), the green-colored cells were disrupted using a Constant Systems Cell Disrupter at 35,000 p.s.i., and cell debris and supernatant were separated by centrifugation. The supernatant was diluted 1:10 in 0.1% TFA to precipitate proteins. Pigments were extracted using a Sep-Pak Light C18 cartridge, concentrated, and dried with help of a SpeedVac concentrator. The isolated phycobilins were analyzed via HPLC as described previously (21).

Anaerobic bilin reductase assays were performed utilizing an Agilent 8453 UV-visible spectrophotometer as described previously (35) with the following modifications. Reaction mixtures were incubated at 20 °C for 10 min, and the reaction was followed spectroscopically every 30 s. Phycobilins were extracted using a Sep-Pak Light C18 cartridge, concentrated, and dried with the help of a SpeedVac concentrator. The isolated phycobilins were analyzed via HPLC.

GtCPES-Phycobilin Binding Studies

Equimolar amounts (10 μm) of PBP lyase and phycobilin were mixed in sodium phosphate buffer, pH 7.5. Absorption spectra (Agilent 8453 UV-visible spectrophotometer) of the mixture and free phycobilins in the same buffer were compared.

Stopped Flow Kinetics

For stopped flow experiments, an SFM-400 apparatus with MOS-200 optics was used (Bio-Logic). Measurements were performed at 20 °C in sodium phosphate buffer, pH 7.5. Different concentrations of GtCPES were rapidly mixed with a constant amount (2 μm) of DHBV, 3(E)-PEB, or 3(Z)-PEB, and the increase in the absorption maximum was detected at 600 nm (PEB) or 610 nm (DHBV). Six to eight time traces were accumulated and averaged, and an exponential equation was fitted to the experimental data yielding the k_obs value for each concentration. All experiments were repeated twice.

Isothermal Titration Calorimetry

Isothermal titration calorimetry (ITC) for analyzing GtCPES/PEB interaction was performed at 20 °C in sodium phosphate buffer, pH 7.5, using an isothermal titration microcalorimeter (MicroCal Auto-iTC200, GE Healthcare). The temperature-controlled sample cell contained 40 μm 3(E)- or 3(Z)-PEB, respectively, and GtCPES (400 μm) was injected in 1.7-μl steps, whereupon the change in heating power was recorded over 180 s until equilibrium was reached after each injection. Background heat generation from dilution of PEB or GtCPES in buffer was subtracted and fitted to each measurement. Measurements with 3(E)-PEB were averaged over two ITC experiments.

Size Exclusion Chromatography

The oligomerization state of proteins was determined using a GE Healthcare Superdex 200 HR10/300 GL size exclusion column. The column was equilibrated in appropriate buffer at a flow rate of 0.5 ml/min. Standards with known molecular weight (i.e. alcohol dehydrogenase, 150,000; bovine serum albumin, 66,000; carbonic anhydrase, 29,000; cytochrome c, 12,400) were applied to the column, and their elution volumes were determined spectroscopically at 280 nm. For chromatography of GtCPES sodium phosphate buffer, pH 7.5, of GtHo potassium phosphate buffer, pH 7.2, and of GtPEBA and GtPEBB, TES-KCl buffer at pH 7.5 was used.

Crystallization of GtCPES

StrepII-GtCPES was concentrated to 10 mg/ml in 20 mm HEPES, 25 mm NaCl, pH 7.5. Crystallization conditions were screened by the sitting drop vapor diffusion method applying 200/100- and 100/100-nl mixtures of the protein solution/reservoir solution incubated at 18 °C. Crystals were obtained in 0.01 m CoCl₂, 0.085 m sodium acetate, pH 4.6, 0.98 m 1,6-hexanediol, 15% glycerol and directly frozen in liquid N₂ using no additional cryoprotection.

Phases were determined experimentally by single-wavelength anomalous dispersion. GtCPES substituted with SeMet was screened, and crystals were obtained in 0.015 m CoCl₂, 0.085 m sodium acetate, pH 4.6, 0.85 m 1,6-hexanediol, 7% glycerol. Prior to freezing in liquid N₂, crystals were soaked in reservoir solution supplemented with 15% glycerol.

Data Collection and Structure Determination

The x-ray diffraction data of native GtCPES and SeMet-GtCPES were collected at the Swiss Light Source (SLS) in Villigen, Switzerland, on beamline X10SA. All data were processed and scaled using XDS and XSCALE (40). Phenix.autosol (41) was used to obtain phases, searching for four selenium positions up to a resolution of 4.3 Å with phase extension to 1.95 Å using the native dataset. Phenix.autobuild calculated an initial model that was manually improved using Coot (42). The structure was refined using phenix.refine (41) against experimental phases and the native dataset. Refinement included individual B-factors and hydrogens. Data, model, and refinement statistics are given in Table 2. Although the data between 2.0 and 1.95 Å still improve model refinement, but fall below the classically used criteria for resolution limits, we use 2.0 Å as the resolution of the structure throughout this work.

TABLE 2.

X-ray data quality and structure refinement statistics

	Native data set (Lys-22)	Anomalous data set (SeMet; Lys-15)
Beamline	SLS X10SA	SLS X10SA
Space group	C 2 2 21	C 2 2 21
Cell dimensions a, b, c (Å)	80.83, 116.58, 58.75	80.75, 117.13, 58.69
Wavelength (Å)	0.97794	0.97856
Resolution (Å)	1.95 (2.00–1.95)	2.5 (2.56–2.5)
Rmeas (%)	5.2 (217.6)	14.2 (168.6)
I/σ(I)	24.26 (1.42)	10.68 (1.3)
Correlation coefficient	100.0 (59.3)	99.7 (46)
No. of reflections, observed	266,849 (20319)	129,810 (9941)
No. of reflections, unique	20,588 (1496)	18,581 (1402)
Phasing
Selenium sites		4
Figure of merit		0.303
Refinement
PDB code	4TQ2
Rwork/Rfree	20.1 / 22.9
Root mean square deviation bond length (Å)	0.015
Root mean square deviation angles (°)	1.544
Ramachandran favored (outliers)	96.49 (0)
isotropic B-factor (range)	66.43 (32.81–211.18)
No. of atoms in model (without riding hydrogens)
Protein	1467
Water	28
1,6-Hexanediol	8

RESULTS

Phycobilin Biosynthesis in the Cryptophyte G. theta

To obtain insights into phycobilin biosynthesis in the cryptophyte G. theta, the potentially involved plastid encoded heme oxygenase GtHo,⁴ and the nucleus-encoded FDBRs GtPEBA and GtPEBB were heterologously produced in E. coli and subsequently examined with regard to their enzymatic activity.

The plastid-encoded GtHo shares 51% identity with HO1 from Synechocystis sp. PCC6803, but only 12% identity with HY1 and HO3 from Arabidopsis thaliana. Heterologously produced recombinant GtHo was found to bind heme but was inactive in in vitro HO assays (data not shown). Gel permeation experiments indicated that inactivity of GtHo was likely due to aggregation of the protein, which was presumably caused by incorrect protein folding. Based on these results, intensive efforts to optimize the production of recombinant GtHO were made. Expression of StrepII-tagged GtHo in E. coli in LB medium supplemented with the osmolytes betaine and sorbitol led to green-colored cells, indicating that StrepII-GtHo was able to convert heme produced by E. coli yielding the green-colored open-chain tetrapyrrole BV IXα in vivo. To confirm the identity of BV IXα, the cells were disrupted, and open-chain tetrapyrroles were extracted and analyzed via HPLC (Fig. 1). The extracted pigment eluted with a retention time of 37.8 min, which resembles that of commercially available BV IXα. Therefore, GtHo is an α-meso carbon-specific HO.

FIGURE 1.

Heme cleavage activity of GtHo in E. coli. HPLC elution profiles of an open-chain tetrapyrrole isolated from E. coli BL21 (DE3)-pGtHo and BV IXα (Frontier Scientific) as a standard. HPLC analyses were performed using C18 reverse-phase column Luna 5 μ (Phenomenex). BV IXα was detected at 650 nm with subsequent whole spectrum analysis of elution peaks. The inset shows a picture of E. coli cells expressing StrepII-GtHo in LB medium supplemented with betaine and sorbitol.

The PBP PE545 uses DHBV associated with the α-subunits and PEB attached to the β-subunits as light-harvesting chromophores. We therefore presumed the presence of at least one gene encoding an FDBR. In fact, two genes encoding putative FDBRs were identified in the nuclear genome of the cryptophyte G. theta. Because of their eukaryotic origin, synthetic genes adapted to the codon usage of E. coli K12 (GENEius, MWG Eurofins Operon) were used for construction of expression plasmids. The corresponding proteins were designated GtPEBA and GtPEBB due to tBLASTn searches and sequence identities of 31.5% to PebA and 29% to PebB of Synechococcus sp. WH8020, respectively. Both proteins were heterologously produced in E. coli as GST fusion proteins. GST-GtPEBA was found to form inactive aggregates, and GST-GtPEBB was purified to homogeneity after removal of the GST tag. To probe their catalytic activities, these putative FDBRs were analyzed using an anaerobic bilin reductase assay as described for other FDBRs (36). GtPEBB did not bind or reduce BV IXα, and only unspecific degradation of the bilin was observed (Fig. 2A). In contrast, GtPEBB was able to bind DHBV as indicated by a shift of the absorption maxima of 335 and 561 nm of free DHBV to 340 and 606 nm after a short incubation time (Fig. 2B, UV-Vis). Immediately after starting the reaction, an increase of absorbance at ∼670 nm was observed, which disappeared in the course of the reaction and is probably due to the formation of the substrate radical intermediate as shown for other FDBR enzymes (35, 36, 43). The absorbance of bound DHBV decreases during the reaction concomitant with the formation of a product with an absorption maximum at 535 nm. In subsequent HPLC analysis, the reaction product was identified as a mixture of 3(E)- and 3(Z)-PEB (Fig. 2B, HPLC), confirming the enzyme's PEB:ferredoxin oxidoreductase activity.

FIGURE 2.

Recombinant GtPEBB is a catalytically active PEB:ferredoxin oxidoreductase. Anaerobic bilin reductase assays of GtPEBB with BV, DHBV, and in combination with SynPebA and BV IXα followed spectroscopically (A–C) and subsequent HPLC analysis of reaction products (D–F). Equimolar amounts of FDBR and bilin (10 μm) were incubated for 5 min, and the reaction was started by addition of an NADPH-regenerating system. The course of the reaction was monitored spectroscopically for 10 min every 30 s. In the case of combined assay with SynPebA, GtPEBB was added 3 min after addition of NADPH-regenerating system. A, decrease of BV IXα absorption at 685 nm and lack of increasing absorption due to product formation indicate unspecific bilin degradation. B, DHBV reduction results in decrease of absorption at 580 and 606 nm results, and PEB absorption at 535 nm increases. C, BV IXα conversion results in decrease of absorption at 692 nm and increase of absorption at 589 nm indicates DHBV formation. After addition of GtPEBB, this absorption decreases due to conversion to PEB (538 nm). Asterisks indicate absorption of substrate radical intermediates. After the reaction was stopped, reaction products were analyzed via HPLC using C18 reverse-phase column Luna 5 μ (Phenomenex). Bilins were detected at 560 and 650 nm with subsequent whole spectrum analysis of elution peaks (D–F).

PebA from cyanobacteria is thought to transfer the intermediate DHBV to PebB without releasing it to the solvent via metabolic channeling (21). As no active PebA-like enzyme from G. theta was available, PebA from Synechococcus sp. WH8020 (SynPebA) was used to perform a coupled anaerobic bilin reductase assay employing GtPEBB (Fig. 2C). Addition of the NADPH-regenerating system to start the reaction resulted in a decrease of absorbance at ∼690 nm followed by an increase of absorbance at ∼590 nm due to conversion of BV IXα to DHBV by SynPebA. GtPEBB was added to the reaction mixture after complete production of DHBV and the formation of a substrate radical intermediate, and subsequently, PEB was observed (Fig. 2B). Hence, GtPEBB is able to functionally replace its cyanobacterial counterpart and act together with SynPebA in PEB formation.

These results give first insights into phycobilin biosynthesis in cryptophyte algae. The plastid-encoded GtHO provides the open-chain tetrapyrrole BV IXα as a substrate for further reduction steps by two FDBRs. Although an additional function of GtPEBA cannot be ruled out, it is most likely that GtPEBA converts BV to DHBV, the substrate of GtPEBB. GtPEBB reduces DHBV to PEB, the chromophore attached to the β-subunits of PE545.

PBP Lyase Homologs in G. theta

The covalent attachment of phycobilin chromophores to apo-PBPs in cyanobacteria is mediated by PBP lyases. Although spontaneous binding of phycobilins to the apo-PBPs can be observed, the lyases ensure the correct binding of the chromophore with regard to the specific attachment site and stereospecificity (24, 44, 45). As of 2014, only one eukaryotic lyase has been studied in detail. The open reading frame orf222 of chromosome 1 of the nucleomorph genome of G. theta was found to encode a T-type lyase (GtCPET), which is able to complement the function of its homolog slr1649 from Synechocystis sp. PCC 6803 by attaching PCB to Cys-β155 of phycocyanin (46). Because G. theta does not use PCB in its PE545, the PBP lyase GtCPET seems to have a low substrate specificity. Expressed sequence tags (EST) encoding two additional putative PBP lyases were mentioned in the literature as follows: a phycocyanin α:PCB-like lyase (GtCPCX: GenBank^TM accession number CAH25359.1 and KJ676834) and a CpeZ-like lyase (GtCPEZ: GenBank^TM accession number CAJ73184.1 and KJ676835) (47, 48). GtCPCX shows low homology to any characterized lyase but possesses a Huntington, elongation factor (EF3), protein phosphatase 2A (HEAT)-repeat domain typical for E/F-type lyases and a predicted Armadillo-type fold. The putative lyase GtCPEZ can be classified into the CpeZ family, which also belongs to the E/F-type lyases (49). However, GtCPEZ shares only 18% identity with the only characterized member of this family (50). Furthermore, GtCPEZ lacks the HEAT-repeat domain, but an Armadillo-type fold can also be predicted. In 2011, the nuclear genome data of G. theta were released by the Department of Energy Joint Genome Institute (31). tBLASTn searches confirmed the localization of genes encoding GtCPCX and GtCPEZ in the nuclear genome. In addition, with GtCPES (GenBank^TM accession numbers EKX47022.1 and KJ676836), we were able to identify a fourth putative PBP lyase, which was assigned to the clade of S/U-type lyases.

Purification and Co-expression of Recombinant PBP Lyases of G. theta

To investigate the attachment of light-harvesting chromophores to the PBPs of the cryptophyte alga G. theta, synthetic genes adapted to the codon usage of E. coli K12 (GENEius, MWG Eurofins Operon) encoding the putative lyases were used to construct appropriate (co-)expression vectors. GtCPCX, GtCPEZ, and GtCPET fusion proteins were found to be insoluble, but StrepII-GtCPES was purified almost to homogeneity (Fig. 3A). Moreover, the co-expression of His₆-tagged GtCPES with PEB biosynthesis enzymes in E. coli yielded intensely blue-colored cells, indicating the formation of His₆-GtCPES:PEB. Indeed, a blue protein complex was purified by affinity chromatography. However, the elution fraction contained two proteins, namely His₆-GtCPES (22.1 kDa) and co-purified His₆-PebS, which could not be removed by size exclusion chromatography (28 kDa; PEB biosynthesis enzyme PebS from co-expression) (Fig. 3A). One may assume that the blue color of the protein fraction is due to binding of PEB to PebS, but the absorption spectrum of the blue fraction (Fig. 3B) shared no similarity with the spectrum of the PebS·PEB complex (51), but rather to the Prochlorococcus marinus MED4 CpeS·PEB complex (52). The bilin was separated from GtCPES via simple denaturing of the protein by dilution in 0.1% TFA, indicating a noncovalent binding of the bilin. HPLC analysis of the isolated bilins confirmed the bilin as PEB (Fig. 3C). This provides an improved method for preparing large amounts of PEB isomers. Compared with the conventional PEB isolation after Glazer and Hixson (53) and Terry (37), co-expression of GtCPES and PEB biosynthesis enzymes in E. coli and subsequent preparation by denaturing the GtCPES·PEB complex and PEB isomer separation via HPLC is much faster, easier, and cheaper. Moreover, this procedure overcomes the use of harmful substances like acetone, methanol, and mercury.

FIGURE 3.

Bilin binding to the PBP lyase GtCPES. A, SDS-PAGE analysis of purified StrepII-GtCPES (21.6 kDa) and His₆-GtCPES·PEB complex (22.1 kDa) after co-expression with PEB biosynthesis enzymes in E. coli. The asterisk indicates co-purified His₆-PebS (28 kDa). B, absorption spectra of 3(Z)-PEB (solid line) and purified His₆-GtCPES·PEB (dashed line). The inset shows the blue-colored His₆-GtCPES·PEB elution fraction after purification. C, HPLC analysis of PEB produced by co-expression of GtCPES and PEB biosynthesis enzymes in E. coli using C18 reverse-phase column Ultracarb 5 μ ODS C18 (Phenomenex). Bilins were detected at 560 nm with subsequent whole spectrum analysis of elution peaks. Absorption spectra of free DHBV (D), 3(E)-PEB (E), and 3(Z)-PEB (F) (solid lines) compared with absorption spectra after addition of equimolar amounts (10 μm) of StrepII-GtCPES (dashed lines).

GtCPES Binds DHBV, 3(E)-PEB, and 3(Z)-PEB in Vitro

Because of the presence of hemO, PEBA, and PEBB genes, G. theta shows all prerequisites for direct synthesis of the phycobilins DHBV and PEB. GtCPES binds PEB co-produced in E. coli. S/U-type lyases are known to exhibit a low apoprotein and bilin specificity but a high specificity for attachment of chromophores to positions homologous to Cys-84 (24, 45, 52, 54–56). GtCPES shares equal values of sequence identity to characterized PCB and PEB transferring S-type lyases (data not shown). Hence, we tested the bilin stereoselectivity with a broad range of bilins. Absorption spectra of free bilins were compared with those after addition of equal amounts (10 μm) of GtCPES. Bilins are found to reside in a cyclic, helical conformation in solution resulting in characteristic absorption properties. Upon binding to a protein, the conformation and thereby the absorption properties of the bilin change (57, 58). For instance, a shift to longer wavelength in combination with a more distinct absorption maximum indicates a more stretched conformation of the bilin (59). Incubation of BV IXα and PCB with GtCPES caused no change of the absorption properties of these bilins (data not shown). In contrast, addition of GtCPES to free DHBV (559 nm), 3(E)-PEB (538 nm), and 3(Z)-PEB (536 nm) resulted in a higher and more distinct absorption maximum at a longer wavelength as follows: GtCPES·DHBV 611 nm; GtCPES·3(E)-PEB 603 nm; and GtCPES·3(Z)-PEB, 600 nm (Fig. 3, D–F). The GtCPES·bilin complexes were nonfluorescent and no zinc-induced fluorescence was detectable suggesting a noncovalent binding of the bilin (data not shown). Comparison of the absorption maxima of the GtCPES·PEB complex after co-expression (Fig. 3B) is in agreement with those of the in vitro reconstituted GtCPES·3(Z)-PEB complex (Fig. 3F). This result identified 3(Z)-PEB as the bilin bound by GtCPES under native conditions, which is in agreement with findings for CpeS from P. marinus MED4 (52).

Dimeric GtCPES Binds DHBV and PEB with Similar Binding Kinetics and High Affinity

S-type lyases are found to function as monomers, homodimers, or heterodimers (52, 55, 56, 60). Size exclusion chromatography of both apo-GtCPES and GtCPES·bilin complexes revealed comparable elution profiles with deducible relative molecular masses of about ∼42 kDa, and it coincides with the calculated molecular mass of GtCPES homodimers (∼43 kDa). Titration experiments of GtCPES with DHBV, 3(E)-PEB, and 3(Z)-PEB indicated that two bilin molecules were bound by dimeric GtCPES (data not shown). Binding kinetics and thermodynamics of the rapid GtCPES·bilin complex formations were further investigated by stopped flow and ITC experiments. A constant amount of bilin was mixed with stepwise increasing concentrations of GtCPES, and increase of absorption was monitored at 611 nm (DHBV) or 600 nm (PEB isomers). The observed rate constant k_obs was obtained by fitting a single exponential function to the experimental data and plotted against the protein concentration (Fig. 4A). The association rate constant k_on is represented by the slope of the linear regression. The results were averaged over two independent experiments, and the standard errors were in a range of 5% for the PEB isomers and 20% for DHBV. In case of the PEB isomers, similar k_on values were observed (3(E)-PEB, 2.1 μm⁻¹ s⁻¹; 3(Z)-PEB, 2.6 μm⁻¹ s⁻¹; see Table 3), whereas association with DHBV (1.3 μm⁻¹ s⁻¹) was slightly slower. However, the association rate constants were in a similar range, and the lower k_on value of DHBV can only be a vague indication for a faster binding of PEB in vivo.

FIGURE 4.

Kinetics and thermodynamics of GtCPES:bilin binding. A, stopped flow experiments were performed by mixing 2 μm bilin with increasing concentrations of GtCPES. Increase in absorption at 611 nm (GtCPES·DHBV; triangles) and 600 nm (GtCPES·3(E)-PEB, filled circles; and GtCPES·3(Z)-PEB, circles) was exponentially fitted to obtain the observed rate constant (k_obs). k_obs was plotted against the GtCPES concentration. B, ITC of GtCPES·3(E)-PEB binding. GtCPES (black squares) and buffer control (black squares) was titrated into a temperature-controlled sample cell containing 3(E)-PEB, and change in heating power was detected (upper panel). The generated heat was obtained by integration and plotted against the GtCPES/3(E):PEB ratio in combination with the one-site fit isotherm. Values for stoichiometry (N), binding constant (K_a), enthalpy (ΔH₀), and entropy change (ΔS₀) were obtained from this fit.

TABLE 3.

Kinetic and thermodynamic parameters of GtCPES·bilin complex formation

Association rate constant (k_on) was obtained by stopped flow experiments and stoichiometry value (N), association constant (K_a), enthalpy (ΔH₀), and entropy change (ΔS₀) via ITC measurements. From those values, K_d = 1/K_a and k_off = k_on × K_d were calculated. ITC results with 3(E)-PEB were averaged over two measurements; ITC with 3(Z)-PEB was performed once due to insufficient amounts of bilin. ND means not determined.

Bilin	kon	Ka	Kd	koff	ΔH0	ΔS0	N
	μm−1 s−1	×106m−1	μm	s−1	kcal mol−1	cal mol−1 K−1
DHBV	1.3 ± 0.3	ND	ND	ND	ND	ND	ND
3(E)-PEB	2.1 ± 0.1	1.7 ± 0.9	0.6 ± 0.3	1.5	−4.2 ± 2	13.4 ± 7.7	0.6 ± 0.3
3(Z)-PEB	2.6 ± 0.1	1.7	0.6	1.5	−3.2	17.5	1. 3

The thermodynamics of the GtCPES·bilin complex formation was analyzed by ITC. Because of insufficient DHBV amounts, the binding affinity of GtCPES to DHBV could not be determined. ITC measurements were performed in duplicate with 3(E)-PEB and once with 3(Z)-PEB. The averaged thermodynamic parameters are summarized in Table 3. A representative ITC measurement with 3(E)-PEB is shown in Fig. 4B. The K_D values of GtCPES·3(E)-PEB (0.6 μm) and GtCPES·3(Z)-PEB (0.6 μm) complexes were nearly identical, indicating tight binding of both isomers. These K_D values are in line with findings for other PBP lyases (52, 61, 62). The stoichiometry value N (3(E)-PEB, 0.6) indicates binding of one molecule PEB per GtCPES monomer.

GtCPES Crystal Structure

GtCPES is the first biochemically characterized eukaryotic PBP lyase. To obtain insights into substrate binding and reaction mechanism of this S-type lyase with high specificity toward DHBV and PEB, the x-ray crystal structure was determined at 2.0 Å resolution. Data, model, and refinement statistics are given in Table 2. The atomic structure of GtCPES displays a 10-stranded, antiparallel β-barrel with a central internal cavity (Fig. 5A). The bottom of the β-barrel is closed off by the N-terminal α-helix α₁, whereupon helix α₀ is formed by the N-terminal StrepII-tag. A third α-helix is inserted between strands β₂ and β₃ near the open side of the β-barrel. Strands β₅ and β₆ are relatively short. Because of flexibility of some loop regions, the GtCPES atomic structure lacks residue Phe-25 and residues 104–108. Generally, loop regions, particularly toward the opening of the β-barrel and around the missing amino acids, show considerably higher B-factors than the average B-value. GtCPES belongs to the structural family of FABP within the superfamily of calycins (15, 63). Members of this widely distributed superfamily are known to bind small, hydrophobic molecules in the barrel interior (15, 64). For instance, they are involved in diverse transport and signal transduction processes and serve as a protein matrix for pheromones or coloring substances (65, 66).

FIGURE 5.

Crystal structure of the eukaryotic PBP lyase GtCPES (2.0 Å) from the cryptophyte G. theta and amino acid residues involved in PEB binding. A, single GtCPES molecule in the asymmetric unit of the crystal. α-Helices are colored cyan, β-strands green, and loop regions blue. Missing residues are indicated by a dotted line. B, homodimeric GtCPES covalently connected by a disulfide bond in the center of the largest predicted interaction site (1077 Ų). The dimer is formed by two molecules related by a crystallographic symmetry operation. Sulfur atoms of Cys-149 are shown in yellow. The alternative conformation with free –SH groups is likely due to x-ray damage. C, top view of GtCPES turned 90° compared with A with co-crystallized 1,6-hexanediol (HEZ) and potential coordinating amino acids. 1,6-Hexanediol (HEZ) is colored black, nitrogen atoms blue, and oxygen atoms red. D, detail of potential ligand-binding site. Glu-136 and Arg-146 were experimentally shown to be involved in PEB binding but Cys-149 and Arg-148 are not.

GtCPES was found to form homodimers in gel permeation experiments as well as in the crystal (Fig. 5B). The crystal structure revealed a disulfide bond between the Cys-149 residues of two GtCPES monomers. This cysteine residue intercepts strand β₉ by forming a β-bulge within the strand. To test whether this disulfide bond is essential for dimer formation, gel permeation experiments were repeated under reducing conditions and with a C149A protein variant. In both cases, the elution behavior was unchanged (data not shown), demonstrating that the disulfide bond is not essential for dimerization. Furthermore, the C149A variant fully retained its phycobilin-binding ability (Table 4). Interface analysis using PDB ePISA (67) ranked the dimer contact around the disulfide bond first with an interaction area of 1077 Ų. Two additional interfaces observed in the crystal between the openings of the funnels of two molecules (1012 Ų) and between α-helices α₀ and α₁ of one and α₂ of a second molecule (496 Ų) are classified with a lower score. In addition, GtCPES superposes well with the other structurally known PBP lyase TeCpcS (PDB code 3BDR (68)) both on the monomer level (root mean square deviation of 1.32 Å for 106 superposed C_α atoms), but also on the level of the proposed biologically active dimers (root mean square deviation of 1.90 Å for 284 aligned C_α atoms).

TABLE 4.

Absorption maxima of phycobilin before and after incubation with different GtCPES variants

	Absorption maxima			Phycobilin binding
	nm
DHBV	335	558
GtCPES	338	566	611	Yes
GtCPES-C149A	341	565	611	Yes
GtCPES-E136A	340	565		No
GtCPES-R146A	337	563		No
GtCPES-R148A	341	566	612	Yes
3(E)-PEB	319	538
GtCPES	334	558	603	Yes
GtCPES-C149A	333	558	602	Yes
GtCPES-E136A	320	541		No
GtCPES-R146A	319	536		No
GtCPES-R148A	329	558	605	Yes
3(Z)-PEB	316	536
GtCPES	330	554	600	Yes
GtCPES-C149A	328	553	598	Yes
GtCPES-E136A	317	540		No
GtCPES-R146A	316	538		No
GtCPES-R148A	325	554	600	Yes

Based on the classification as a member of the FABP family and the functional data available for TeCpcS, the actual binding site of PEB can be expected to lie within the funnel of GtCPES. The crystal structure showed additional density within this region, which was modeled as 1,6-hexanediol from the crystallization buffer. Interestingly, 1,6-hexanediol is coordinated by the side chains of amino acid residues Arg-146, Glu-136, and Arg-148, which are highly conserved among S-type lyases (Fig. 5, C and D). To verify their role in phycobilin binding, GtCPES variants E136A, R146A, and R148A were generated and analyzed. Indeed, absorption spectra of free DHBV, 3(E)-PEB, and 3(Z)-PEB did not change significantly after incubation with the GtCPES variants E136A and R146A (Table 4), indicating a loss of binding capability of phycobilins in these two variants. In contrast, variant R148A showed absorption shifts comparable with those of wild type complexes.

DISCUSSION

PEB Biosynthesis in G. theta Adopted from Cyanobacteria

In addition to chlorophyll a and c₂-containing antenna complexes, the cryptophyte G. theta uses the PBP PE545 for light-harvesting. The α-subunits of PE545 are associated with the chromophore DHBV, whereas the β-subunits carry three molecules of PEB (14). In cyanobacteria, DHBV represents the intermediate of PEB biosynthesis, but it has not yet been identified as a protein-bound chromophore. Although the crystal structure and the identity of the bound chromophores of PE545 have been known since 1999, phycobilin biosynthesis and the assembly of PBP in cryptophytes are poorly understood. Here, we provide the first insights into PEB biosynthesis in the cryptophyte G. theta. We identified an enzymatically active, plastid-encoded HO, specific for cleavage of the α-meso carbon bridge of heme. GtHo provides the substrate BV IXα, which is further reduced to PEB by two nucleus-encoded FDBRs. The enzymatic activity of the first FDBR, GtPEBA, could not be shown experimentally, but the second FDBR, GtPEBB, was found to reduce DHBV to PEB exclusively. Like other FDBRs (35, 36), GtPEBB seems to act via a substrate radical mechanism. Furthermore, GtPEBB is able to bind and convert DHBV produced by SynPebA in vitro indicating the capability to perform metabolic channeling (21). Although another or an additional function of GtPEBA cannot be ruled out, a DHBV:ferredoxin oxidoreductase function for conversion of BV IXα to DHBV is most likely, because DHBV is the sole substrate of GtPEBB, and no genes encoding other FDBRs were found in the completely sequenced genome of G. theta. Taken together, even though the cryptophyte G. theta utilizes a modified PBP distinct from cyanobacterial ancestors, it apparently has retained the PEB biosynthesis machinery from cyanobacteria.

PE545 Assembly in G. theta

The attachment of phycobilins to apo-PBPs is usually mediated by PBP lyases that in general have high attachment site specificity (24). Although cyanobacterial PBP lyases have been investigated for some time, those of cryptophytes are largely unexplored.

Overall, the PBP PE545 of G. theta has to be assembled with four bilin chromophores, each of which is covalently linked to one or two specific cysteine residues (Fig. 6). Although the β-subunit harbors three PEB molecules at position Cys-β50/61, Cys-β82, and Cys-β158, the α-subunit carries only one chromophore (DHBV) at position Cys-α19. Prior to this study, the only identified PBP lyase of G. theta is encoded by orf222 on the nucleomorph genome and is the T-type lyase GtCPET (46). This lyase has a low substrate specificity and is involved in the attachment of PEB to position Cys-β158 (46). GtCPES investigated in this study is likely involved in the chromophorylation of Cys-β82. Unfortunately, due to insoluble recombinant apo-GtCPEB protein, we were unable to show this transfer directly (data not shown).

FIGURE 6.

Proposed PE545 assembly in G. theta. 1, transcription of the nucleus encoded genes GtPEBA, GtPEBB, GtCPEAs, GtCPCX, GtCPEZ, and GtCPES and co-translational transport of unfolded proteins into the endoplasmic reticulum (ER) via a size exclusion chromatography translocon. 2, transport into the periplastidial space is presumably carried out using an ERAD-like system. 3, transcription of the nucleomorph-encoded GtCPET and transport of all unfolded proteins into the plastid stroma via an unknown transporter in the outer plastidial membrane (OPM) and a TIC-translocon in the inner plastidial membrane (IPM). 4, location of chromophore biosynthesis and PBP assembly. 5, GtHo and GtCpeB are plastid-encoded and translated by 70 S ribosomes. 6, translocation of the assembled PE545 into the thylakoid lumen via a twin arginine translocase (TAT) and the RR-signal peptide of the GtCPEA′ subunit. Abbreviations used are as follows: rER, rough endoplasmic reticulum; SEC, Sec-translocon; PPM, periplastidial membrane; ERAD, endoplasmic reticulum-associated degradation system; OPM, outer plastidial membrane; IPM, inner plastidial membrane; TIC, translocator of the inner membrane of chloroplasts; TAT, twin arginine transporter; RR, twin arginine transporter-translocation signal; TM, thylakoid membrane; 80S, eukaryotic 80 S-ribosome; 70S, prokaryotic 70 S ribosome.

Thus far, the lyase(s) involved in the attachment of the doubly linked PEB molecule at position Cys-β50/61 is thus far unknown. The likely candidate would be GtCPCX and/or GtCPEZ. Furthermore, one of these lyases (or even both) might be involved in the chromophorylation of the α-subunit GtCPEA. Alternatively, this attachment could be autocatalytic (Fig. 6).

Eukaryotic PBP Lyase GtCPES

With GtCPES, we identified the first cryptophycean S/U-type lyase and provided not only biochemical but also structural insights into the function of this eukaryotic PBP lyase. Cyanobacterial S/U-type lyases occur in monomeric, homo-, or heterodimeric forms and show high positional specificity for ligation of phycobilins to homologs of the residue Cys-84 (50, 52, 55, 56, 60). At the same time, their apoprotein specificity is low, because they mediate the chromophore transfer to this position of PBP α- or β-subunits, with the exception of α-phycocyanin, which requires CpcEF lyases. Substrate specificity for different phycobilins varies among S/U-type lyases (50, 52, 55, 56, 60). For instance, the CpcS lyase from T. elongatus (TeCpcS) binds PCB and PEB as well as PΦB (68), whereas PmCpeS from P. marinus is specific for binding of DHBV and PEB (52).

GtCPES was found to be homodimeric and to exclusively bind DHBV, 3(E)-, and 3(Z)-PEB. Neither BV IXα nor PCB was bound by GtCPES. The K_D values (0.6 μm) for the complex formation with both PEB isomers were similar and suggest a tight binding of the substrate, which is in line with findings for other PBP lyases (23, 45, 52, 54, 62). Based on our results, a covalent binding of the phycobilins by GtCPES comparable with TeCpcS (68) is unlikely. The slightly lower association rate constants for the formation of the GtCPES·DHBV complex compared with those of the GtCPES·3(E)-/3(Z)-PEB complex formation indicate PEB and the co-expression experiments in particular 3(Z)-PEB as the naturally bound substrates of GtCPES. In E. coli, only PEB is bound by GtCPES, and the absorption properties of the GtCPES·PEB complex are similar to the in vitro reconstituted GtCPES·3(Z)-PEB complex. This correlates with the observation that PmCpeS can transfer both 3(E)- and 3(Z)-PEB to the apoprotein CpeB, but only the attachment of 3(Z)-PEB results in stereochemically correct reconstituted PEB·Cys-β84-PE (52). Notably, FDBRs are known to produce predominantly the 3(Z)-phycobilin isomers in vivo (35). Therefore, it is likely that in G. theta, GtPEBB provides the 3(Z)-PEB isomer for attachment to the CpeB apoprotein by GtCPES and other lyases as well.

GtCPES Exhibits a Lipocalin-like Fold

The x-ray structure of the S-type lyase GtCPES from the cryptophyte G. theta consists of a 10-stranded antiparallel β-sheet displaying a modified lipocalin fold. Based on this structure, GtCPES is assigned to be a member of the FABP family within the structural superfamily of calycins. Calycins generally bind small hydrophobic molecules and carry out diverse functions (15, 64). For instance, they act as transport molecules or play a role in olfaction or coloration of insects by binding and enhancing features of appropriate ligands (69, 70). One example is the bilin-binding protein of the butterfly Pieris brassicae that binds biliverdin IXγ leading to the blue color of the insect (66). Additionally, there are three more bilin-binding members of the calycin superfamily, whose crystal structures were recently published. UnaG originates from the Japanese eel Anguilla japonica, and its green fluorescence is based on a bound bilirubin molecule (71). Furthermore, the structure of the PBP lyase TeCpcS was determined within the National Institutes of Health Protein Structure Initiative in 2007 and published by Kronfel et al. (68). TeCpcS is a homodimeric universal PBP lyase capable of binding a wide range of phycobilins like PCB, PEB, and PΦB, transferring them to residue Cys-84 of diverse α and β apo-PBPs (68). Utilizing the similarity to UnaG, which has been crystallized with bound bilirubin, a docking model for an extended PCB molecule in TeCpcS was described, which buries the bilin's D-ring in the barrel and exposes the A-ring on the barrel mouth. GtCPES shows 36% sequence identity with TeCpcS (Fig. 7A) and shares a similar overall structure (Fig. 8A). Furthermore, an identical homodimerization was observed for both lyases, but in the case of GtCPES, this interaction is not only formed by a large hydrophobic interaction site but is also strengthened by a disulfide bond. The third solved crystal structure is that of the PCB-specific PBP lyase CpcT from the cyanobacterium Nostoc sp. PCC7120 (72). Thus far, this is the first crystal structure of a PBP lyase with a bound chromophore. The overall structure of CpcT is similar to that of CPES and is also retained upon chromophore binding. However, arginine residues located at the opening of the binding pocket undergo major rearrangements when PCB is bound. The crystal structure furthermore revealed that PCB adopts a ZZZsss geometry in an M-helical conformation (72). Our spectroscopic data on the CPES·PEB complex would, however, rather suggest a more extended chromophore conformation. We therefore will have to await the crystal structure of the CPES·PEB complex to get an insight into PEB binding of CPES.

FIGURE 7.

Proposed amino acid residues involved in phycobilin binding and PBP lyase activity in different S-type lyases. A, sequence alignment of different S-type lyases. Gt, G. theta; Pm, P. marinus MED4; Fd, Fremyella diplosiphon; N, Nostoc sp. PCC7120; Te, T. elongatus (PDB code 3BDR). Identical residues and those with 60% similarity are shown with colored background. Consensus: identical (*); conserved substitution (:); semi-conserved substitution (.). Residues involved in phycobilin binding in GtCPES, black arrows; residues involved in phycobilin binding and PBP lyase activity in NCpcS-III (red arrows); and TeCpcS (gray arrows). Corresponding homolog residues in GtCPES are blue, NCpcS-III red, and TeCpcS gray. B, GtCPES structure with residues essential for phycobilin binding (black) and homologs (blue) to important residues in NCpcS-III (red) and TeCpcS (gray).

FIGURE 8.

Overlay of known Calyx-shaped bilin-binding proteins. A, structural alignment of GtCPES in green, TeCpcS (3BDR) in blue, and UnaG (4I3B) in magenta. Ligands are indicated. B, structural alignment of GtCPES and TeCpcS in top view. C, surface representation of GtCPES to show the central pocket (black) surrounded by hydrophobic residues. D, surface representation of TeCpcS (3BDR) exhibiting a less restricted ligand binding pocket.

Glu-136 and Arg-146 of GtCPES Are Involved in Bilin Binding

To get a glimpse of the location of the PEB-binding site in the barrel interior, we exchanged conserved residues close to the bound artificial ligand 1,6-hexanediole. Binding studies with these GtCPES variants and different phycobilins revealed a participation of Glu-136 and Arg-146 in phycobilin binding. The importance of Arg-146 or homologous amino acid residues for phycobilin binding has previously been confirmed for TeCpcS and NCpcS-III (where N is Nostoc) (23, 68). Interestingly, the TeCpcS-R151G variant still bound enough PCB to confer transfer to the apoprotein CpcB in E. coli (68). For Glu-136, the carboxylic function might be involved in positioning of the substrate by interaction with the tetrapyrrole nitrogens, as found for bilin-binding in FDBRs (51, 73, 74).

In the case of NCpcS-III, several other residues have been shown to be involved in PBP lyase activity (23). Two conserved tryptophan residues are noteworthy. Replacement of the conserved Trp-69 (homolog to GtCPES Trp-69, see Fig. 7) by a methionine residue resulted not only in a reduced binding capacity of NCpcS-III but also in a stereochemically incorrect attachment of PCB to the apoprotein CpcB (23). As Trp-69 is facing the ligand binding pocket, this suggests a participation in PEB binding by forming π-π interactions with ring B or C of the tetrapyrrole. Presumably, the π-π stacking may be responsible for the stabilization of the ligand conformation and therefore the position of ring A, resulting in a stereochemically correct attachment to the apoprotein. NCpcS-III Trp-75 (homologous to GtCPES Trp-75) has been found to be only indirectly involved in activity (23). Although it is disordered in the TeCpcS structure, in our GtCPES structure Trp-75 is placed at the upper side of the GtCPES barrel, pointing toward the barrel center (Fig. 7B). Here, it might play a role during interaction with PE545 and could provide a kind of greasy slide for transfer of the substrate during the reaction.

Previous studies focused on PBP lyases like TeCpcS and NCpcS-III, which bind and transfer a broad range of phycobilins (PCB, PEB, and PΦB) (23, 68). In contrast, GtCPES is only capable of binding phycobilins with a reduced C15=C16 double bond (DHBV and PEB). The resulting single bond between C15 and C16 allows rotation of the D-ring and therefore a better adaptation to a tight binding pocket. In contrast, ring D of PCB is restrained to the tetrapyrrole plane by the C15=C16 double bond. When comparing the two barrel pockets of GtCPES and TeCpcS, two main differences are striking (Fig. 8). The general barrel diameter at the mouth is much narrower for GtCPES (21.3 Å versus 26.1 Å in diameter, Fig. 8B). Although the diameter at the bottom of the barrel is nearly identical on the basis of the main chain (Fig. 8B), the bulkier hydrophobic side chains of residues Phe-123, Leu-89, Ile-65, and Met-67 of GtCPES lead to a restriction at the proposed position of the D-ring in the region of the critical residues Glu-136 and Arg-146 (Fig. 8C). The equivalent amino acid residues of TeCpcS (Leu-128, Pro-92, Ala-69, and Val-71) have substantially smaller side chains (Fig. 8D). These data would support the requirement of a flexible D-ring of the tetrapyrrole for efficient binding to the smaller binding pocket. In contrast, the more open binding pocket of TeCpcS would support the binding of a wider range of bilins. Manual docking of PEB into the GtCPES structure with energy minimization was unsuccessful, because residues Arg-148 and Met-67, for instance, restrict access to residue Arg-146, whose importance for PEB binding was demonstrated experimentally. Therefore, an induced fit of GtCPES upon ligand binding is likely.

GtCPES Structure Provides Requirements for Bilin Transfer to Cys-β82

The bathochromic shift of the absorption spectrum and the formation of a more distinct absorption peak upon binding of PEB to GtCPES suggest a more or less stretched conformation (57, 58) of the bound phycobilin in accordance with a binding mode similar to the model of PCB in TeCpcS. Phycobilins are usually linked to the apoprotein via a thioether bond between the ethylidene group of ring A of the phycobilin and a conserved cysteine residue of the apoprotein (24). Therefore, it is likely that ring A of PEB is exposed at the upper side of the ligand-binding site of GtCPES. The surface electrostatics of GtCPES and the β-subunit of PE545 from Rhodomonas sp. CS24 (which shares 94% sequence identity with the respective G. theta homolog) (14) suggested a potential docking site for the upper side of the GtCPES molecule to an area around Cys-82 of the PE545 β-subunit (Fig. 9). Indeed, a docking model consistent with this proposal was ranked first by the GRAMM-X Protein-Protein Docking Web Server (75). Hence, the area around PE545-Cys-β82, particularly made up by positively charged and neutral amino acids (Fig. 9C), is likely to bind the negatively charged part of the upper site of GtCPES (Fig. 8D). In contrast, all conserved cysteine residues of the β-subunit are especially surrounded by negatively charged and neutral amino acids, and thus they would not provide an ideal binding surface for the negatively charged patches of GtCPES. This is indicative of a strong selection of Cys-82 by the S-type lyase GtCPES. However, we expect a considerable structural change in PE545, as Cys-82 is not directly accessible and needs to be exposed to the attachment of the chromophore by GtCPES. In the case of cyanobacterial PBP chromophorylation and assembly, it is postulated that the PBP subunits are folded prior to chromophorylation and subsequent assembly of the PBP oligomers (76). Therefore, it is likely that the tertiary structure of the PBP subunit is important for recognition by and docking of PBP lyases.

FIGURE 9.

Proposed protein-protein interaction model of GtCPES and PE545-CpeB. Protein-protein docking model of GtCPES and a single PE545 β-subunit (PDB code 1XG0) predicted with GRAMM-X Protein-Protein Docking Web Server version 1.2.0. The corresponding vacuum electrostatic surface models were generated with PyMOL. A, schematic illustration of interaction model. Dimeric GtCPES, green/cyan; PE545-CpeB, violet; conserved Cys-82 associated with a single bonded PEB molecule, red circle; sulfur atom, yellow. B, electrostatic surface representation of interacting proteins. Negatively charged areas, red; positively charged areas, blue; neutral/hydrophobic areas, white. C, PE545-CpeB turned 90° counterclockwise; interaction site is facing toward the observer. D, GtCPES turned 90° clockwise; interaction site is facing toward the observer.