Abstract
A long-established epidemic of enteritis, caused by an unidentified pathogen distinct from parvovirus, has now been recognized in mink. In 2013, we identified a novel circovirus by degenerate PCR and fully sequenced its genome. This virus differs substantially from currently known members of the genus Circovirus and represents a new species.
Keywords: Circovirus, mink, diarrhea, China, viruses
Members of the family Circoviridae are nonenveloped, icosahedral viruses with diameters of 16–26 nm and a small, circular, single-stranded DNA genome (the smallest known autonomously replicating viral genome) (1). The family Circoviridae is currently composed of 2 genera, Gyrovirus and Circovirus, each of which has been associated with diseases in birds, pigs, and dogs (1,2). Among birds, circovirus infections have been associated with beak abnormalities, lethargy, and anorexia in parrots and pigeons and production losses and death in geese (3,4). Among pigs, porcine circovirus type 2 (PCV-2) causes respiratory and enteric diseases, dermatitis, and reproductive problems, resulting in major economic losses to the pork industry (5,6). A proposed new genus (Cyclovirus) within the family Circoviridae consists of cycloviruses. Genomes of cycloviruses have been identified in human and chimpanzee feces and human cerebrospinal fluid (7,8). Recently, circoviruses have been found in bats and have shown high genetic diversity (9,10). We describe a novel circovirus in mink (mustelids). This mink circovirus (MiCV) was found in the liver, digestive tract, and fecal specimens from mink with diarrhea as their main clinic sign.
Mink enteritis is caused by a parvovirus (11). However, around 1978, on some mink farms in Dalian, Liaoning Province, China, ≈7% of mink that had received the inactivated parvovirus vaccine had diarrhea and anorexia that resulted in death. The farmers called this refractory diarrhea. According to the observations of the farmers, the incubation period of this disease was <10 days. The preliminary clinical signs included lethargy, anorexia, pale muzzle, and unkempt fur. The feces were initially white and then became jelly red or yellow. Several days after the appearance of red or yellow feces, ≈7% of affected mink died. All mink from farms with disease seemed to have been affected; 70%–80% showed clinical signs, but most recovered.
Within a few years of farmers first noticing the disease, a major outbreak occurred during 1985–1990 in Dalian and on mink farms in the surrounding mountain regions. The mink in this area are pedigree breeds with premium quality fur; all other farms introducing stock from this area were also affected. Spread of the infection seemed to be horizontal because mink were usually affected after a mink on the same farm became ill. However, the epidemic now seems to be limited, potentially in part because of the practice of autogenous vaccination that uses formalin-inactivated supernatant from tissue suspension from affected minks.
The Study
During September–October 2013, we collected liver, digestive tract (gut), and fecal samples from 43 mink (26 with diarrhea and 17 healthy) ≈6–10 months of age from 3 mink farms in Dalian, China. Using PCR-based methods, we excluded the following as causative agent: mink enteritis virus, canine distemper virus, Aleutian mink disease virus, mink orthoreovirus, and mink coronavirus. To identify the causative agent, we separately homogenized fecal, liver, and gut samples from diseased unvaccinated mink in phosphate-buffered saline and then submitted the supernatants to negative staining and observation under an electron microscope. We found circovirus-like particles, but not in typical lattice arrangement, in liver and gut samples. We performed PCRs with degenerate primers (CV-F1, CV-R1, CV-F2, and CV-R2; Table 1) based on highly conserved amino acid motifs in the Rep proteins of circoviruses and cycloviruses. Products of ≈400 bp were purified and sequenced by using primer CV-R2.
Table 1. Oligonucleotide sequences of primers used in study of novel circovirus isolated from mink, Dalian, China.
Primer | Oligonucleotide sequence, 5′→3′ | Reference. |
---|---|---|
CV-F1 | GGIAYICCICAYYTICARGG | (7) |
CV-R1 | AWCCAICCRTARAARTCRTC | (7) |
CV-F2 | GGIAYICCI CAYYTICARGGITT | (7) |
CV-R2 | TGYTGYTCRTAICCRTCCCACCA | (7) |
CV-F3 | GCCCGCTTAAACGGCTCAAACCGCATTTTC | Designed for this study |
CV-R3 | TGGGAGGGGCCTGAGGGATTACGTCATACA | Designed for this study |
CV-F4 | GCAGTAAGTCTCCCCCTTTACTGCAATATC | Designed for this study |
CV-R4 | CTTGCTGAATAATGGCGGAACAATGACTGA | Designed for this study |
All samples from mink with diarrhea were positive by PCR for the same circovirus-like Rep sequence; all samples from healthy mink were negative (Table 2), showing a strong relationship between the identified virus and disease. A BLAST search (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) showed the sequence to be an authentic circovirus sequence, with closest similarity (73%) to the bat circavirus (BtCV) from the Rhinolophus ferrumequinum group XO bat (XOR) genome, recently identified in bats by metagenomic analysis of tissue samples (10).
Table 2. Prevalence of mink circovirus DNA in mink, Dalian, China.
Specimen tested | No. mink | Age of mink, mo. (no. mink) | Farm* | Positive for mink circovirus |
---|---|---|---|---|
Mink with diarrhea |
|
|
|
|
Liver | 12 | 6–7 (8), 7–8 (3), 9–10 (1) | 4 from farm 1, 5 from farm 2, 3 from farm 3 | 12 |
Gut | 12 | 6–7 (8), 7–8 (3), 9–10 (1) | 4 from farm 1, 5 from farm 2, 3 from farm 3 | 12 |
Feces |
19 |
6–7 (12),
7–8 (5),
9–10 (2) |
7 from farm 1,
8 from farm 2,
4 from farm 3 |
19 |
Healthy mink |
|
|
|
|
Liver | 9 | 6–7 (6), 7–8 (3) | 4 from farm 1, 3 from farm 2, 2 from farm 3 | 0 |
Gut | 9 | 6–7 (6), 7–8 (3) | 4 from farm 1, 3 from farm 2, 2 from farm 3 | 0 |
Feces | 11 | 6–7 (7), 7–8 (3), 9–10 (1) | 4 from farm 1, 5 from farm 2, 2 from farm 3 | 0 |
*Farms 1 and 2 located in Zhuanghe County, Dalian, China; farm 3 located in Pulandian County, Dalian
.
To obtain the complete genome sequence of MiCV, we used primers CV-F3, CV-R3, CV-F4, and CV-R4 (Table 1) for inverse PCR, together with Premix PrimeSTAR HS DNA polymerase (Takara Bio, Inc., Dalian, China). The product was sequenced in duplicate. The complete circular genome of MiCV-DL13 contained 1,753 nt (GenBank accession no. KJ020099); highest similarity was 64.1% with the genome of BtCV-XOR. The putative Rep protein of MiCV-DL13 was 297 aa, and it shared 50.7%, 51.6%, 55.4%, and 79.7% aa identity with the Rep protein of pig (PCV2 AUT1, AY424401), bird (GoCV, AJ304456), dog (DogCV-1698, NC_020904) (2), and bat (BtCV-XOR, JX863737), respectively, circoviruses. The results of phylogenetic analyses based on the amino acid sequence of the Rep protein are shown in the Figure. The deduced capsid protein is 227 aa; highest similarity is 47.3% with porcine circovirus 2 (EU-RO-WB2006–38, JN382157) from wild boars in Romania (12).
The International Committee for the Taxonomy of Viruses has suggested criteria for circovirus species demarcation: genome nucleotide identities of <75% and capsid protein amino acid identities of <70% (1). The MiCV reported here therefore represents a new circovirus species.
Conclusions
Apart from the well-documented pathogenicity of porcine circovirus in pigs, of dog circovirus in dogs, and of other circoviruses in birds, the biological significance of widespread cyclovirus, circovirus, and circovirus-like virus infections in other domesticated and wild animals remains unknown. In this study, the novel circovirus, MiCV, was identified in liver and digestive tract samples from mink with diarrhea. No MiCV DNA was found in any healthy mink, thereby indicating a strong relationship between the isolated virus and disease. Whether other mustelids (e.g., weasels, badgers, and ferrets) or even humans in close contact with infected mink are susceptible to this virus merits further study.
Acknowledgments
This research was funded by the China National “973” Program (approval no. 2011CB504700), the National Science Foundation of China (approval no. 31372456), and the Science and Technology Development Foundation of Jilin Province (approval no. 20130101092JC).
Biography
Dr Lian is associate professor in the Laboratory of Epidemiology, Veterinary Research Institute, Academy of Military Medical Sciences. His main research interests are animal virology and molecular epidemiology.
Footnotes
Suggested citation for this article: Lian H, Liu Y, Li N, Wang Y, Zhang S, Hu R. Novel circovirus from mink, China. Emerg Infect Dis [Internet]. 2014 Sep [date cited]. http://dx.doi.org/10.3201/eid2009.140015
These authors contributed equally to this article.
References
- 1.Biagini P, Bendinelli M, Hino S, Kakkola L, Mankertz A, Niel C, et al. Circoviridae. Virus taxonomy. classification and nomenclature of viruses: ninth report of the International Committee on the Taxonomy of Viruses. London: Elsevier Academic Press; 2011. p. 343–9. [Google Scholar]
- 2.Li L, McGraw S, Zhu K, Leutenegger CM, Marks SL, Kubiski S, et al. Circovirus in tissues of dogs with vasculitis and hemorrhage. Emerg Infect Dis. 2013;19:534–41 . 10.3201/eid1904.121390 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Todd D, McNulty MS, Adair BM, Allan GM. Animal circoviruses. Adv Virus Res. 2001;57:1–70 . 10.1016/S0065-3527(01)57000-1 [DOI] [PubMed] [Google Scholar]
- 4.Todd D. Avian circovirus diseases: lessons for the study of PMWS. Vet Microbiol. 2004;98:169–74 . 10.1016/j.vetmic.2003.10.010 [DOI] [PubMed] [Google Scholar]
- 5.Finsterbusch T, Mankertz A. Porcine circoviruses—small but powerful. Virus Res. 2009;143:177–83 . 10.1016/j.virusres.2009.02.009 [DOI] [PubMed] [Google Scholar]
- 6.Ramamoorthy S, Meng XJ. Porcine circoviruses: a minuscule yet mammoth paradox. Anim Health Res Rev. 2009;10:1–20 . 10.1017/S1466252308001461 [DOI] [PubMed] [Google Scholar]
- 7.Li L, Kapoor A, Slikas B, Bamidele OS, Wang C, Shaukat S, et al. Multiple diverse circoviruses infect farm animals and are commonly found in human and chimpanzee feces. J Virol. 2010;84:1674–82. 10.1128/JVI.02109-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Smits SL, Zijlstra EE, van Hellemond JJ, Schapendonk CM, Bodewes R, Schürch AC, et al. Novel cyclovirus in human cerebrospinal fluid, Malawi, 2010–2011. Emerg Infect Dis. 2013;19:1511–3. 10.3201/eid1909.130404 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ge X, Li J, Peng C, Wu L, Yang X, Wu Y, et al. Genetic diversity of novel circular ssDNA viruses in bats in China. J Gen Virol. 2011;92:2646–53. 10.1099/vir.0.034108-0 [DOI] [PubMed] [Google Scholar]
- 10.He B, Li Z, Yang F, Zheng J, Feng Y, Guo H, et al. Virome profiling of bats from Myanmar by metagenomic analysis of tissue samples reveals more novel mammalian viruses. PLoS ONE. 2013;8:e61950. 10.1371/journal.pone.0061950 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Uttenthal A, Larsen S, Lund E, Bloom ME, Storgård T, Alexandersen S. Analysis of experimental mink enteritis virus infection in mink: in situ hybridization, serology, and histopathology. J Virol. 1990;64:2768–79 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Cadar D, Cságola A, Lorincz M, Tombácz K, Spînu M, Tuboly T. Detection of natural inter- and intra-genotype recombination events revealed by cap gene analysis and decreasing prevalence of PCV2 in wild boars. Infect Genet Evol. 2012;12:420–7. 10.1016/j.meegid.2012.01.014 [DOI] [PubMed] [Google Scholar]