GH51 Arabinofuranosidase and Its Role in the Methylglucuronoarabinoxylan Utilization System in Paenibacillus sp. Strain JDR-2

Abstract

Methylglucuronoarabinoxylan (MeGAX_n) from agricultural residues and energy crops is a significant yet underutilized biomass resource for production of biofuels and chemicals. Mild thermochemical pretreatment of bagasse yields MeGAX_n requiring saccharifying enzymes for conversion to fermentable sugars. A xylanolytic bacterium, Paenibacillus sp. strain JDR-2, produces an extracellular cell-associated GH10 endoxylanse (XynA₁) which efficiently depolymerizes methylglucuronoxylan (MeGX_n) from hardwoods coupled with assimilation of oligosaccharides for further processing by intracellular GH67 α-glucuronidase, GH10 endoxylanase, and GH43 β-xylosidase. This process has been ascribed to genes that comprise a xylan utilization regulon that encodes XynA₁ and includes a gene cluster encoding transcriptional regulators, ABC transporters, and intracellular enzymes that convert assimilated oligosaccharides to fermentable sugars. Here we show that Paenibacillus sp. JDR-2 utilized MeGAX_n without accumulation of oligosaccharides in the medium. The Paenibacillus sp. JDR-2 growth rate on MeGAX_n was 3.1-fold greater than that on oligosaccharides generated from MeGAX_n by XynA₁. Candidate genes encoding GH51 arabinofuranosidases with potential roles were identified. Following growth on MeGAX_n, quantitative reverse transcription-PCR identified a cluster of genes encoding a GH51 arabinofuranosidase (AbfB) and transcriptional regulators which were coordinately expressed along with the genes comprising the xylan utilization regulon. The action of XynA₁ on MeGAX_n generated arabinoxylobiose, arabinoxylotriose, xylobiose, xylotriose, and methylglucuronoxylotriose. Recombinant AbfB processed arabinoxylooligosaccharides to xylooligosaccharides and arabinose. MeGAX_n processing by Paenibacillus sp. JDR-2 may be achieved by extracellular depolymerization by XynA₁ coupled to assimilation of oligosaccharides and further processing by intracellular enzymes, including AbfB. Paenibacillus sp. JDR-2 provides a GH10/GH67 system complemented with genes encoding intracellular GH51 arabinofuranosidases for efficient utilization of MeGAX_n.

INTRODUCTION

The increasing use of nonrenewable fossil fuels, along with their negative impact on the environment, has encouraged research to develop biological systems to provide alternative sources of energy. Prominent underutilized sources include lignocellulosics, the structural components of plant biomass that do not directly compete with agricultural commodities for production of food and fiber. These lignocellulosics contain cellulose as a source of fermentable glucose and hemicelluloses as a source of fermentable pentoses for biofuels and chemicals. Current bioprocessing depends upon a combination of technologies for pretreatment to render the cellulose and hemicellulose components accessible to enzyme digestion and the development of microbial biocatalysts to efficiently ferment the products of enzyme digestion (1, 2).

For conversion of sugars to biomass-based products, Gram-negative bacteria (e.g., Escherichia coli, Zymomonas mobilis, and Klebsiella oxytoca for ethanol production), Gram-positive bacteria (e.g., Bacillus species for lactic acid production and Clostridium species for butanol and acetic acid production), and yeast strains (e.g., Saccharomyces cerevisiae for ethanol production) have been developed (1–6). The production of higher yields of fermentable sugars without the formation of inhibitory compounds generated by thermochemical pretreatment may be achieved by developing biocatalysts capable of direct and complete conversion of lignocellulosics to targeted products, and this method of production reduces process costs by promoting simultaneous saccharification and fermentation (SSF) and consolidated bioprocessing (CBP) (1, 7). Alkaline pretreatments, when followed by saccharification using enzymes, for example, endoxylanases, β-xylosidases, α-glucuronidases, and α-l-arabinofuranosidases (8–13) for processing hemicellulosic pentosans and β-glucanases for processing cellulose, may be used to release saccharides for further conversion to biomass-based products.

The sources for lignocellulosics include energy crops (dicots [e.g., sweetgum, poplar, eucalyptus] and monocots [e.g., switchgrass, sweet sorghum]) and agricultural residues (e.g., sugarcane bagasse and corn stover). The hemicelluloses as well as the cellulose components of lignocellulosics provide a resource for bioconversion. The predominant polysaccharide in hemicellulose is 4-O-methylglucuronoxylan (MeGX_n) in dicots and 4-O-methylglucuronoarabinoxylan (MeGAX_n) in monocots. MeGX_n and MeGAX_n are comprised of β-1,4-linked xylopyranosyl units with side chain substitutions, including α-1,2-linked 4-O-methyl-d-glucuronopyranosyl (MeG) residues and acetyl esters. MeGAX_n in grasses and agricultural residues, such as sorghum and sugarcane bagasse, includes other side chain substitutions, including α-1,2- and/or 1,3-linked l-arabinofuranosyl residues, which may comprise as much as 10 to 50% of the carbohydrate composition of the MeGAX_n. Another common feature of MeGAX_n is the presence of O-feruloyl and O-p-coumaroyl esters linked to hydroxyl groups on arabinofuranosyl residues (8, 10, 13–16). Pretreatment of lignocellulosic biomass is important to remove acetyl and other ester linkages from xylan for achieving complete hydrolysis. Bioconversion systems require thermochemical pretreatments, which may include (i) acidic conditions to saccharify hemicelluloses and enzymes to saccharify cellulose or (ii) neutral or basic conditions, which require enzymes for the saccharification of hemicelluloses and cellulose (1, 2, 6, 17).

Paenibacillus sp. strain JDR-2, as well as some other bacteria, is an aggressively xylanolytic bacterium with a GH10/GH67 system for depolymerization and a xylan utilization regulon that accounts for its efficient utilization of MeGX_n (18–20). This study defines the ability of Paenibacillus sp. JDR-2 to utilize MeGAX_n from sweet sorghum and sugarcane bagasse. This ability is correlated with the presence of a gene cluster in Paenibacillus sp. JDR-2 that encodes a GH51 α-l-arabinofuranosidase and transcriptional regulators that are upregulated by growth on MeGAX_n and the ability of this enzyme to process the products generated by the extracellular multimodular cell-associated GH10 endoxylanase (XynA₁). Evidence supports a role of intracellular arabinofuranosidases in the utilization of MeGAX_n processed by the GH10 XynA₁ in which arabinoxylooligosaccharides (AXOS), xylooligosaccharides (XOS), and aldouronates (MeG-linked XOS), as products of extracellular depolymerization, are assimilated through ABC transporters and processed intracellularly to monosaccharides. We have identified genes, abfB and abfA, from Paenibacillus sp. JDR-2 encoding GH51 arabinofuranosidases which may assist other saccharifying enzymes produced by this organism to efficiently convert MeGAX_n to biomass-based products. Although the activity of recombinant AbfA was evaluated, abfA was not considered for detailed studies, as it has no neighboring genes encoding transcriptional regulators and ABC transporters, nor was it upregulated following the growth of Paenibacillus sp. JDR-2 on MeGAX_n. As a xylanolytic bacterium with a fully sequenced genome, including a xylan utilization regulon, Paenibacillus sp. JDR-2 provides a system to further define and develop processes for the efficient conversion of MeGAX_n as well as MeGX_n to targeted products (11, 18, 21, 22).

MATERIALS AND METHODS

Preparation of xylans and oligosaccharides.

MeGX_n was prepared from sweetgum (Liquidambar styraciflua) wood as previously described (22). Alkaline treatment was applied to the extraction of MeGAX_n from stalks of sorghum [Sorghum bicolor (L.) Moench] and sugarcane (Saccharum sp. cv. CP89-2143). Sorghum (PD1 M81-E Citra 2011 batch) and sugarcane stalk bagasse (obtained from John E. Erikson, Agronomy Department at the University of Florida) were processed using the same procedure used for sweetgum (22). Oligosaccharides were prepared by digesting 2% sorghum MeGAX_n in 10 mM sodium phosphate buffer, pH 6.5, with 3.5 U of the recombinant GH10 XynA₁ catalytic domain (XynA₁CD) (22) with mild rotation at 30°C. After 24 h, an additional 2 U of XynA₁CD was added and the incubation was continued for another 24 h. The reaction was stopped by heating the mixture in a 70°C water bath for 10 min. The undigested polysaccharide and the XynA₁CD were separated from lower-molecular-weight oligosaccharides by using an Amicon Centriprep 3,000-molecular-weight-cutoff filter device (Millipore) operated at 3,000 rpm (Sorvall RC-3 swinging bucket rotor). The filtrate was lyophilized and dissolved in deionized water. The total carbohydrate content was determined for all preparations by a phenol-sulfuric acid assay (23) to prepare substrates of the desired concentration. The oligosaccharides were identified by thin-layer chromatographic (TLC) analysis (11, 24). The degree of polymerization in sweetgum MeGX_n was 231 (15), and that in sorghum MeGAX_n was estimated to be 76. The degree of polymerization in sorghum MeGAX_n was determined by Nelson's reducing sugar assay (25) for total reducing sugar content and the phenol-sulfuric acid assay (23).

Growth studies of Paenibacillus sp. JDR-2 and substrate utilization.

Paenibacillus sp. JDR-2 was isolated from decaying sweetgum wood in our laboratory (11, 18, 21, 22). A glycerol freezer stock of Paenibacillus sp. JDR-2 stored at −80°C was resuscitated on 0.5% oat spelt xylan agar plates with Zucker-Hankin minerals (ZH) medium (pH 7.4) (26) containing 0.01% yeast extract and incubated at 30°C for 2 to 3 days. The cultures were regularly transferred onto fresh plates in order to maintain viable cultures throughout the studies. A colony was picked from the plate and was used to inoculate 2 ml of ZH medium with 1% yeast extract in culture tubes (16 by 100 mm), which were incubated at 30°C at high rotation (speed 8) on a Roto-Torque rotator inclined at an angle of 45° overnight. The cells were harvested and used for subculturing at a 2% initial inoculum into 5 ml of fresh ZH medium containing 1% yeast extract in culture tubes (16 by 100 mm) under the conditions described above or into larger volumes of medium in 250-ml baffled culture flasks. The cultures were shaken at 220 rpm using a G-2 gyratory shaker (New Brunswick Scientific) at 30°C until the cultures reached mid-exponential phase. For growth studies, cells from exponential-phase cultures were harvested and suspended in ZH medium containing 0.1% yeast extract with 0.5% sorghum MeGAX_n, sugarcane MeGAX_n, or oligosaccharides derived from XynA₁CD digestion of sorghum MeGAX_n. Growth studies were carried out using a 2% initial inoculum in 20 ml medium cultured at 30°C as described above.

Determination of growth and substrate utilization.

Aliquots of cultures were sampled at regular intervals of time to record the growth and the amount of substrate remaining in the medium. Growth, which was estimated from the turbidity, was determined by measurement of the optical density at 600 nm (OD₆₀₀) using a 1.00-cm cuvette. Cultures were diluted to obtain an OD₆₀₀ between 0.2 and 0.8 and corrected for dilution to generate the growth curves. For substrate utilization studies, aliquots of cultures were centrifuged at room temperature to separate the cell pellet from the medium remaining in the supernatant. To determine the rate and extent of substrate utilization, the cell-free medium was used to determine the total amount of carbohydrate remaining by the phenol-sulfuric acid assay (23) with xylose as the standard. To identify the products accumulating in the medium and to study the rate of hydrolysis of the substrate, 200 to 220 nmol of total carbohydrate xylose equivalents was spotted on a TLC plate (20 by 20 cm; 0.25-mm thickness; Silica Gel 60; Millipore), developed, and analyzed as previously described (11).

Structural modeling of GH51 arabinofuranosidase from Paenibacillus sp. JDR-2.

A Protein Data Bank (PDB) file for AbfB was generated from the amino acid sequence with the Phyre2 program (27). The closest homolog of AbfB was GH51 from Geobacillus stearothermophilus T6 (PDB accession number 1QW9), with which AbfB (GenBank accession no. ACT02231.1) shared 68% similarity and which served as the template for threading. The USCF Chimera (version 1.8) program (28) was used for modeling of the structures. The Pfam program (29) was used to locate the catalytic nucleophile and proton donor sites. The Clustal Omega program (30) was used for the alignment of the amino acid sequences (http://www.ncbi.nlm.nih.gov/) of GH51 arabinofuranosidases.

Preparation of RNA.

Paenibacillus sp. JDR-2 was cultured as described above. Paenibacillus sp. JDR-2 cells harvested from mid-exponential-phase cultures were used to make a 2% inoculum of ZH medium containing 0.1% yeast extract with 20 ml 0.5% of sorghum MeGAX_n, sugarcane MeGAX_n, sweetgum MeGX_n, or xylose, and the culture was incubated at 30°C in 250-ml baffled culture flasks with shaking, as described above. Cultures growing in ZH medium containing 0.5% yeast extract without carbohydrate were used as controls. The cultures were allowed to grow until the estimated early mid-exponential growth phase. These cultures were used for RNA isolation and purification and were streaked onto xylan agar plates to confirm the purity of the cultures. The cells were harvested by centrifugation at a relative centrifugal force of 4,300 × g for 10 min at 4°C, resuspended in 25 mM sodium phosphate buffer, pH 7.0, and centrifuged as described above. The procedure derived from the FastLane Cell RT-PCR Handbook (Qiagen) was used for RNA isolation and purification. RNA was treated with DNase using a Turbo DNA-free kit following the prescribed protocol (Ambion). The RNA concentrations were determined by measurement of the absorbance at 260 nm (A₂₆₀), and the ratio of A₂₆₀/A₂₈₀ was determined to estimate the purity of the RNA.

qRT-PCR.

Quantitative reverse transcription-PCR (qRT-PCR) was carried out using a QuantiTect SYBR green RT-PCR kit (Qiagen) following the protocol prescribed in the accompanying handbook. The quality of the RNA preparations was characterized by evaluation for DNA contamination by carrying out reactions for known transcript targets with and without reverse transcriptase. The qRT-PCR was conducted in 25-μl reaction mixtures containing primers corresponding to the genes of interest (which yielded products that were 100 to 150 bp in size), 0.5 μg of RNA, 2× QuantiTect SYBR green RT-PCR master mix, QuantiTect reverse transcriptase mix, and RNase-free water. The qRT-PCRs were carried out using a CFX96 real-time C1000 thermal cycler (Bio-Rad) under conditions of 50°C for 30 min; 95°C for 15 min; and 40 cycles at 94°C for 15 s, 56°C for 30 s, and 72°C for 30 s, followed by melting curve determination. The primer pairs designed for the target genes, which are identified by their locus tags, are listed in Table 1. A standard curve was generated using genomic DNA isolated from Paenibacillus sp. JDR-2 and purified using the protocol derived from that provided by the manufacturer of the DNeasy blood and tissue kit (Qiagen); PCR was performed using a QuantiTect SYBR green PCR kit (Qiagen) following the manufacturer's protocol.

TABLE 1.

Primers used in qRT-PCR and cloning and production of recombinant enzymes

Locus tag	Gene	Primer orientationa	Sequence
PJDR2_3599	abfB	Fb	CTGGTTGGCTCCGATGTTAT
		Rb	AAGTACCGCCAGGATGATTG
PJDR2_3598	arsR	Fb	ATGCGGAATGTCCAGTTGAT
		Rb	GGTGGTCCAGCGATGTTAAT
PJDR2_0221	xynA1	Fb	ACCGTTATCAGATGGCTTGG
		Rb	GCTTTGTTGAGCTGGGAGTC
PJDR2_1323	aguA	Fb	GCATGGCTGAGATACGATCA
		Rb	ATCCCTTCCATCGGTACTCC
PJDR2_1318	araC	Fb	GGAATCGCTTGGCTATGAAA
		Rb	GGATATCCGCGATAACGAGA
PJDR2_1320	lplA	Fb	GGCGCATTTATTCCTCTTGA
		Rb	ATTTTGCCGTCTGCTTGTCT
PJDR2_3599	abfB	Fc	GAAGGAGATATACATATG
			ACTATTCGTTCCAGCATGCT
		Rc	GTGATGGTGGTGATGATG
			TCCTTTTTTCGTCTGCAGGC
PJDR2_3019	abfA	Fc	GAAGGAGATATACATATG
			GTTCAAACGAAGCTTGGC
		Rc	GTGATGGTGGTGATGATG
			TTCGACCGGAACGCGAAA

^aF and R, forward and reverse primers, respectively.

^bPrimers for 100- to 150-bp transcript targets used in qRT-PCR.

^cPrimers used for cloning and production of recombinant enzymes, where the sequence in bold refers to the defined vector sequence, including the start codon on the forward primer and 6× histidine anticodons on the reverse primer.

Construction of abfB and abfA expression vectors.

Using Paenibacillus sp. JDR-2 gene sequences, the open reading frames were selected and used for designing the primer pairs with cloning sites for the abfB gene (locus tag, PJDR2_3599; GenBank accession no. ACT02231.1) and the abfA gene (locus tag, PJDR2_3019; GenBank accession no. ACT01665.1) (Table 1). Paenibacillus sp. JDR-2 was cultured in Luria-Bertani (LB) broth, also referred to as lysogeny broth, at 30°C with shaking as described earlier, until the culture reached an OD₆₀₀ of 0.5, and genomic DNA was extracted as described above. The abfB gene (1,512 bp) and the abfA gene (1,521 bp) were produced and amplified by PCR using Hot Start high-fidelity DNA polymerase (Thermo Scientific) under conditions of 95°C for 5 min; 10 cycles of 94°C for 9 s, 50°C for 1 min, and 72°C for 2.3 min; 30 cycles of 94°C for 9 s and 68°C for 2.3 min; and an additional extension at 72°C for 10 min. The purification of the products was carried out by agarose gel electrophoresis using a QIAquick gel extraction kit (Qiagen). The sizes of the purified products were confirmed by restriction digestion.

Production and purification of AbfB and AbfA.

The pETite expression vector from the Expresso T7 cloning and expression system (Lucigen) was used, and the C-terminal histidine-tagged abfB or abfA gene was cloned into Escherichia coli 10G (Lucigen). After transformation, the clones were selected on LB plates containing kanamycin (30 μg/ml). The plasmids were isolated, and digestion (NdeI and NotI sites on the vector) was performed to confirm insertion of the gene into the vector. pETite-abfB (expression vector carrying abfB) or pETite-abfA (expression vector carrying abfA) and pRARE (Novagen) were cotransformed into E. coli BL21(DE3). The transformants were selected on LB plates containing 30 μg/ml kanamycin and 34 μg/ml chloramphenicol (LB-Kan30-Cm34). Single colonies were inoculated in 2 ml of LB-Kan30-Cm34 in culture tubes (13 by 100 mm), incubated overnight at 37°C and 250 rpm, and stored at −80°C in 25% glycerol. These stocks were used for streaking out fresh LB-Kan30-Cm34 plates, and the plates were incubated overnight at 37°C. Single colonies of BL21(DE3) harboring pETite-abfB or pETite-abfA and pRARE were used to inoculate 20 ml LB-Kan30-Cm34 into 125-ml culture flasks, the flasks were incubated as described above, and the contents of the flasks were transferred to 650 ml LB-Kan30-Cm34 medium in a 2.8-liter flask and cultured as described above. When the OD₆₀₀ reached 1.0, 1.00 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) was added and the incubations were continued at 24°C and 150 rpm for 3 h. Protein expression was verified by SDS-PAGE. Cells were harvested and disrupted for purification of proteins using histidine tag columns as described previously (11). Desalting of proteins was carried out using PD-10 columns (GE Healthcare), which were eluted with 50 mM sodium acetate, pH 6.5. The purity of AbfB and AbfA was verified by SDS-PAGE using Precision Plus protein standards (Bio-Rad). An SDS- 4% to 15% polyacrylamide gel was used and stained with Coomassie brilliant blue.

Determination of optimal conditions and kinetic parameters for AbfB activity.

A bicinchoninic acid assay (Thermo Scientific) was used for determination of the protein concentrations using bovine serum albumin as the standard. Enzymatic assays were carried out in 100-μl reaction mixtures by using the chromogenic substrate para-nitrophenyl-α-l-arabinofuranoside (pNP-A) in 50 mM sodium acetate buffer, pH 6.5, at 30°C, and the increase in the absorbance at 405 nm was monitored over time. The optimal conditions for AbfB were determined by carrying out assays using 0.2 mM pNP-A, 0.3 μg AbfB, and 50 mM sodium acetate buffer, pH 6.5, at 30°C, unless a different condition was specified. Optimal conditions of buffer and pH were determined by assaying in 50 mM citrate buffer (pH 4 to 6), 50 mM sodium acetate buffer (pH 5 to 8), and 50 mM potassium phosphate buffer (pH 5 to 8) at 30°C. To determine the optimal temperature, the resulting optimum pH and optimum buffer were used to measure activity at temperatures ranging from 30°C to 50°C. Temperature stability analysis was carried out by incubating AbfB at different temperatures and assaying aliquots (under defined assay conditions) at regular intervals of time to estimate the amount of activity remaining. Determination of specific activities and kinetic studies of purified AbfB and AbfA were carried out by performing enzymatic assays using pNP-A in 50 mM sodium acetate buffer, pH 6.5, at 30°C. One unit of activity was defined as the amount of enzyme that released 1 μmol of product per min at the defined temperature.

Specificity of AbfB and its reaction with MeGAX_n and arabinoxylooligosaccharides.

Reaction mixtures containing 1.5% sorghum MeGAX_n in the presence of 15 μg XynA₁CD (22) and/or AbfB per 1 ml mixture were incubated at 30°C for 16 h. A fraction of the reaction mixture where MeGAX_n was digested by XynA₁CD was filtered (as described above) to obtain oligosaccharides, which were further treated with AbfB in 50 mM sodium acetate buffer, pH 6.5, at 30°C for 16 h. The reactions were stopped by heating in a 70°C water bath for 10 min, and the samples (200 nmol/sample) were examined by TLC, as described above (11).

The remaining reaction mixtures were filtered, and the amount of arabinose released was determined by high-pressure liquid chromatography (HPLC) using an Aminex HPX87-H column (Bio-Rad) connected to Hewlett-Packard HP1090 filter photometric and refractive index detectors in series (Agilent Technologies) (5).

The activity of AbfB on MeGAX_n with and without XynA₁CD was estimated by carrying out reactions with 0.5% sorghum MeGAX_n and 30 μg/ml of enzyme in 50 mM sodium acetate buffer, pH 6.5, at 30°C for 4 h. Aliquots were removed from the reaction mixture every 30 min to carry out Nelson's assay for estimation of total reducing sugars (25).

RESULTS

Growth of Paenibacillus sp. JDR-2 and substrate utilization.

Paenibacillus sp. JDR-2 showed rapid growth on both sorghum and sugarcane MeGAX_n substrates, with the efficient and nearly complete utilization of the substrates. The substrate utilization curve closely corresponded to the growth curve (Fig. 1A and B). Growth patterns were observed to be similar in both cases. Upon reaching stationary phase, Paenibacillus sp. JDR-2 sporulated, as confirmed by phase-contrast microscopy (data not shown). Oligosaccharides (generated from sorghum MeGAX_n with XynA₁CD) as the substrate were observed to have a lower rate and extent of utilization than MeGAX_n (Fig. 1C and D), indicating that the cell-associated XynA₁ catalyzes the depolymerization of MeGAX_n, followed by the rapid assimilation of oligosaccharides into the cell with minimal diffusion into the medium. The rate of Paenibacillus sp. JDR-2 growth on MeGAX_n was 3.1-fold greater than that on oligosaccharides generated by digestion of MeGAX_n by XynA₁CD (Fig. 1D). These experiments were repeated, and the results were reproducible.

FIG 1.

Growth and MeGAX_n utilization by Paenibacillus sp. JDR-2. Paenibacillus sp. JDR-2 was cultured in 20 ml ZH medium containing 0.1% yeast extract supplemented with 0.5% sorghum MeGAX_n (A), 0.5% sugarcane MeGAX_n (B), or 0.5% oligosaccharides (derived from sorghum MeGAX_n digested by XynA₁CD) (C) in 250-ml baffled flasks at 30°C and 220 rpm. Closed squares and open squares, growth (OD₆₀₀) and the amount of substrate remaining (percent), respectively. The total amount of substrate remaining was determined by the phenol-sulfuric acid assay. (D) Comparison of the rate of utilization of substrates during the exponential phase of growth derived from panels A and C for sorghum MeGAX_n (open circles) and sorghum oligosaccharides (open triangles). The rate of utilization was determined as the slope (K). R² values were 0.9683 and 0.9377 for sorghum MeGAX_n and sorghum oligosaccharides generated by XynA₁CD digestion, respectively.

The oligomeric products generated by extracellular XynA₁CD did not accumulate in the medium during the growth of Paenibacillus sp. JDR-2 on 0.5% sorghum MeGAX_n (Fig. 2A). The absence of detectable arabinose accumulation indicates an absence of an extracellular arabinofuranosidase associated with Paenibacillus sp. JDR-2. The growth of Paenibacillus sp. JDR-2 on 0.5% oligosaccharides obtained by digestion of sorghum MeGAX_n by XynA₁CD (Fig. 2B) indicates incomplete utilization of the substrates. This suggests that Paenibacillus sp. JDR-2 assimilates the oligosaccharides (including AXOS, XOS, and aldouronates) as they are generated on the cell surface by XynA₁ acting on MeGAX_n. The increase in the amount of xylose from 18 to 24 h may result from cells that have entered the sporulation phase and have released intracellular enzymes, which may digest the remaining substrate in the medium (Fig. 2B). It was observed that Paenibacillus sp. JDR-2 grows rapidly and preferably on polysaccharides, such as sorghum or sugarcane MeGAX_n, as well as sweetgum MeGX_n, rather than monosaccharides, including glucose and xylose (22), as well as arabinose (unpublished data). The growth yield and rate of growth of Paenibacillus sp. JDR-2 on monosaccharides were lower than those on MeGAX_n (unpublished data).

FIG 2.

Carbohydrate utilization and product accumulation by Paenibacillus sp. JDR-2. Paenibacillus sp. JDR-2 in 20 ml ZH medium containing 0.1% yeast extract supplemented with 0.5% sorghum MeGAX_n (A) or 0.5% oligosaccharides derived from sorghum MeGAX_n digested by XynA₁CD (B) was cultured in 250-ml baffled flasks at 30°C and 220 rpm. First lane, xylose (X₁), xylobiose (X₂), xylotriose (X₃), and xylotetraose (X₄) as standards (10 nmol each); second lane, MeGX₁, MeGX₂, MeGX₃, and MeGX₄ aldouronates as standards (10 nmol each); third lane, arabinose (A) as a standard (10 nmol); lanes labeled with different times, aliquots of cell-free supernatants from cultures collected at regular time intervals. The cell-free supernatants were spotted on the TLC plate and developed as described in Materials and Methods.

Genomic organization of abfB and abfA and structural comparisons of encoded arabinofuranosidases.

The genes with locus tags PJDR2_3599 and PJDR2_3019, encoding AbfB and AbfA, respectively, of the GH51 family of arabinofuranosidases, were selected for further consideration because they are close homologs of the fully characterized arabinofuranosidase from Geobacillus stearothermophilus T6, which has been implicated in the efficient processing of MeGAX_n (31, 32). The abfB gene was considered for further study on the basis of its location in the genome and the presence of neighboring genes encoding transcriptional regulators and ABC transporters (Fig. 3C). The MeGAX_n utilization system of Paenibacillus sp. JDR-2 should then include a gene encoding an extracellular multimodular cell surface-anchoring GH10 endoxylanase which depolymerizes xylan, 9 genes comprising an aldouronate utilization gene cluster, and a separate gene cluster including abfB, all contributing to the rapid assimilation of oligosaccharides and further intracellular processing (Fig. 3A to C).

FIG 3.

Genes comprising the MeGAX_n utilization system and encoded products. (A) xynA₁; (B) aldouronate utilization gene cluster; (C) abfB and neighboring genes.

The CAZy (http://www.cazy.org/) database, which classifies enzymes on the basis of protein folding patterns, predicts the members of the GH51 family to possess alpha-beta barrel structures. The (α/β)₈ structure of AbfB was modeled (Fig. 4), and the closest homolog was arabinofuranosidase from Geobacillus stearothermophilus T6, with which AbfB shares 68% similarity and for which the structure-function relationship is defined. On the basis of sequence alignments (data not shown) and information from Pfam, the catalytic activity of AbfB is conferred by catalytic nucleophile E293 and proton donor E174.

FIG 4.

Alpha-beta barrel (α/β)₈ structure of GH51 AbfB. This structure was developed using the PDB file generated by the Phyre2 and Chimera programs, with the closest homolog being to the arabinofuranosidase from Geobacillus stearothermophilus T6. The catalytic role of AbfB is conferred to catalytic nucleophile Glu293 and proton donor Glu174, based on alignment and information from Pfam. The distance between Glu293 and Glu174 was calculated to be 4.6 Å.

Coregulation of abfB with xylan utilization genes.

The levels of expression of the following genes in cultures growing on different substrates were studied by qRT-PCR: abfB (PJDR2_3599) and a neighboring gene, arsR (PJDR2_3598; encoding a transcriptional regulator), along with genes comprising the xylan utilization regulon, xynA₁ (PJDR2_0221), aguA (PJDR2_1323), araC (PJDR2_1318; encoding a transcriptional regulator), and lplA (PJDR2_1320; encoding an ABC transporter). Compared to growth in yeast extract without carbohydrate, the xynA₁ and aguA genes were significantly upregulated when Paenibacillus sp. JDR-2 was grown on sorghum MeGAX_n, sugarcane MeGAX_n, or sweetgum MeGX_n relative to their regulation when it was grown on xylose. Constitutive expression of the abfB gene and its neighboring arsR gene was observed when Paenibacillus sp. JDR-2 was grown on xylan or monosaccharides. Higher numbers of abfB mRNA molecules were determined with sorghum MeGAX_n and sugarcane MeGAX_n as the substrates than with sweetgum MeGX_n as the substrate, indicating upregulation in the presence of MeGAX_n compared to the level of regulation in the presence of MeGX_n. This indicates a possible role of AbfB in digesting arabino-linked substrates. The coregulation of xynA₁ and genes comprising an aldouronate utilization gene cluster, which has been studied previously to define the MeGX_n utilization system (18), was extended here to evaluate the expression of xynA1 and the aldouronate utilization gene cluster in coordination with expression of abfB and its neighbors to define the MeGAX_n utilization system in Paenibacillus sp. JDR-2 (Fig. 5).

FIG 5.

MeGAX_n utilization system gene expression in Paenibacillus sp. JDR-2. Paenibacillus sp. JDR-2 cultures were grown in ZH medium containing 0.1% yeast extract with different substrates containing 0.5% carbohydrate (▪, sorghum MeGAX_n; , sugarcane MeGAX_n; ▨, sweetgum MeGX_n; , xylose) or without carbohydrate () as a control. The cultures were grown in 250-ml baffled flasks at 30°C and 220 rpm. The cells were harvested from the early mid-exponential phase, and RNA was isolated, purified, and treated with DNase. qRT-PCR was carried out to study the levels of expression of abfB and the neighboring gene, arsR, encoding a transcriptional regulator, along with those of xylan utilization regulon genes xynA₁, aguA, araC (encoding a transcriptional regulator), and lplA (encoding an ABC transporter). The expression studies were carried out using threshold cycle (C_T) values to determine the number of mRNA molecules and employing the genomic DNA to generate the standard curve by PCR.

Cloning, expression, and characterization of AbfB and AbfA.

The abfB or abfA PCR product was cloned into the pETite vector and cotransformed along with pRARE into E. coli BL21(DE3). The overexpressed 6× His-tagged protein AbfB (503 amino acid residues with a molecular mass of 56 kDa; ExPASy) or AbfA (506 amino acid residues with a molecular mass of 57 kDa; ExPASy) was purified and verified to be a single band of the appropriate molecular mass on an SDS-polyacrylamide gel stained with Coomassie brilliant blue. The optimal buffer and optimal pH for the maximum activity of AbfB at 30°C were defined (Fig. 6A). AbfB showed optimal activity at pH 6.5 in 50 mM sodium acetate buffer. This condition was used to determine that activity was optimal at 42°C (Fig. 6B). AbfB was stable for at least 6 h from 30°C to 50°C, lost 50% of its activity in less than 2 h and almost all of its activity in 6 h at 60°C, and lost all of its activity in less than 30 min at 70°C and above (Fig. 6C). The kinetic parameters of AbfB were evaluated using pNP-A in 50 mM sodium acetate buffer, pH 6.5, at 30°C. The specific activity of AbfB was 12.9 U/mg (1 U of activity is equal to 1 μmol of product formed/min); K_m was 1.08 mM, V_max was 13.2 U/mg, and k_cat was 12.5/s (Fig. 6D). The activity was determined by measurement of the increase in the absorbance at 405 nm over time, and it was observed that the reaction velocity increased with an increase in the substrate concentration and then reached saturation (Fig. 6E). The arabinofuranosidase activity of AbfA was characterized, and it was found to have a specific activity of 9.5 U/mg for pNP-A at pH 6.5 and 30°C.

FIG 6.

Optimal conditions and kinetic parameters of AbfB. (A) pH optimization was carried out at 30°C using 50 mM buffers, such as sodium acetate buffer (closed squares), citrate buffer (open diamonds), or potassium phosphate buffer (open triangles); (B) temperature optimization was carried out using 50 mM sodium acetate buffer, pH 6.5, at 30 to 50°C; (C) temperature stability analysis was carried out by incubating AbfB at different temperatures, such as 30°C (open circles), 37°C (open triangles), 42°C (closed squares), 50°C (dashes), 60°C (closed circles), 70°C (closed triangles), and 80°C (open squares), followed by assaying of aliquots at regular intervals of time to estimate the remaining activity; (D) Lineweaver-Burk plot generated using the relation between reaction velocity (V) and pNP-A substrate concentration ([S]) to determine the kinetic parameters of AbfB. (E) Velocity of the AbfB reaction plotted against the pNP-A substrate concentration. The specific activity of AbfB was 12.9 U/mg (1 U of activity is equal to 1 μmol of product formed/min); K_m was 1.08 mM, V_max was 13.2 U/mg, and k_cat was 12.5/s.

Products generated by the action of AbfB on sorghum MeGAX_n and its complementary role with XynA₁.

TLC analysis was carried out to study (i) the action of recombinant AbfB and XynA₁CD together on MeGAX_n, (ii) the action of XynA₁CD on MeGAX_n followed by the action of AbfB, and (iii) the action of AbfB on filtered oligomers generated from MeGAX_n that had previously been digested by XynA₁CD (Fig. 7). Lanes 5 to 9 display the dominant oligomeric products xylobiose (X₂), xylotriose (X₃), and MeGX₃, along with small amounts of MeGX₄ and xylose, generated by the action of GH10 XynA₁CD on MeGAX_n as the substrate. These were also seen with MeGX_n as the substrate (22). Other significant components with mobilities slightly lower than those of the X₂ and X₃ standards were detected as well. The action of AbfB along with that of XynA₁CD (lanes 6 and 9) resulted in the conversion of these to XOS with mobilities corresponding to those of X₂, X₃, and arabinose, supporting their identities as arabinoxylobiose (AX₂) and arabinoxylotriose (AX₃). The absence of detectable arabinose in lane 7 indicates that AbfB is not very active in cleaving the arabinose side chains by acting directly on the polysaccharide and that it requires XynA₁CD to first depolymerize the MeGAX_n. The lanes with dark spots at the origin indicate the remaining amount of undigested MeGAX_n in the reaction mixtures (Fig. 7). This experiment clearly indicates that the GH10/GH67 system does not require pretreatment of MeGAX_n by arabinofuranosidase; rather, the AXOS generated on digestion of MeGAX_n by XynA₁ are preferable substrates for the action of AbfB to remove the arabinofuranose substitutions.

FIG 7.

Products generated by the action of recombinant AbfB and XynA₁CD on sorghum MeGAX_n. AbfB and/or XynA₁CD was incubated in MeGAX_n in 50 mM sodium acetate buffer, pH 6.5, at 30°C for 16 h, with the reaction components being resolved by TLC, as described in Materials and Methods. Lane 1, xylose (X₁), xylobiose (X₂), xylotriose (X₃), and xylotetraose (X₄) as standards (10 nmol each); lane 2, MeGX₁, MeGX₂, MeGX₃, and MeGX₄ aldouronates as standards (10 nmol each); lane 3, arabinose (A) as a standard (10 nmol); lane 4, MeGAX_n control (200 nmol); lanes 5 to 9, reaction mixture containing 200 nmol of MeGAX_n that was incubated with the indicated enzymes. The oligomers were obtained by digesting MeGAX_n with XynA₁CD and filtering out the oligomeric products to be treated with AbfB, as shown in lanes 8 and 9.

The amount of arabinose released during these reactions was estimated by HPLC, and it was observed that AbfB has an extremely low specificity toward polysaccharides but has high specificity toward oligomers generated from MeGAX_n digested by XynA₁CD (Table 2; Fig. 8). The amount of arabinose released from MeGAX_n when digested by the combined action of XynA₁CD and AbfB was 17 times greater than that generated by the direct action of AbfB on MeGAX_n. On the basis of determination of the total carbohydrate content by the phenol-sulfuric acid assay and on the basis of the results of HPLC for determination of the amount of arabinose released after complete removal of the arabino linkages from oligosaccharides by AbfB, the arabinofuranoside substitution on the sorghum stalk MeGAX_n backbone was estimated to be 1.0 arabinose residue for every 9.4 xylose residues. The specific activities of AbfB on MeGAX_n with and without XynA₁CD were 0.23 and 0.07 U/mg, respectively, as determined by Nelson's reducing sugar assay (25).

TABLE 2.

AbfB-mediated release of arabinose from MeGAX_n and oligosaccharides derived from MeGAX_n digested with XynA₁CD^a

Substrate	XynA1CD	AbfB	Arabinose concn (mM)
MeGAXn	−	−	NDb
MeGAXn	−	+	0.023
MeGAXn	+	+	0.39
Oligosaccharides	−	−	ND
Oligosaccharides	−	+	0.341

^aMeGAX_n was treated with XynA₁CD and/or AbfB in 50 mM sodium acetate buffer, pH 6.5, at 30°C for 16 h. A fraction of the reaction mixture where MeGAX_n was digested with XynA₁CD was filtered to separate out oligosaccharides from the undigested xylan. The oligosaccharides were treated with AbfB in 50 mM sodium acetate buffer, pH 6.5, at 30°C for 16 h. The reaction was stopped by heating in a 70°C water bath for 10 min. The reaction mixtures were filtered, and the amount of arabinose released was determined by HPLC.

^bND, not detected.

FIG 8.

HPLC profiles quantifying the release of arabinose on treatment of oligosaccharides generated from XynA₁CD -digested sorghum MeGAX_n with and without AbfB. Components were resolved using an HPX87-H column and detected by differential refractometry, as described in Materials and Methods. The retention times of the xylose and arabinose standards are 14.7 and 16.1 min, respectively. The area of eluted xylose was an average of 4,397 units, equivalent to an average concentration of 0.140 mM, and the area of eluted arabinose was 9,270 units, equivalent to a concentration of 0.341 mM. (A) Oligosaccharides without AbfB treatment; (B) oligosaccharides with AbfB treatment. Norm., arbitrary units.

AbfA, a close homolog of the GH51 arabinofuranosidase from Geobacillus stearothermophilus T6 and AbfB, was similar to AbfB with respect to the k_cat and K_m values obtained with pNP-A as the substrate, and AbfA also generated products from oligosaccharides derived from the xylanolytic digestion of MeGAX_n similar to those generated by AbfB. AbfA was not considered for detailed studies, as the abfA gene did not have neighboring genes encoding transcriptional regulators and ABC transporters. Moreover, abfA was not upregulated following the growth of Paenibacillus sp. JDR-2 on MeGAX_n (unpublished data).

DISCUSSION

The fully sequenced genome of Paenibacillus sp. JDR-2 identified genes comprising a GH10/GH67 system for the processing of MeGAX_n as well as MeGX_n. For the processing of MeGAX_n, this system includes xynA₁, which encodes extracellular multimodular cell-associated GH10 endoxylanase (22); an aldouronate utilization gene cluster with aguA, xynA₂, xynB, and genes encoding transcriptional regulators and ABC transporters (18); and the distally located abfB. All of these genes participate in a process that includes the depolymerization of MeGAX_n, the rapid assimilation of oligomeric products, and intracellular metabolism (Fig. 3). Paenibacillus sp. JDR-2 utilizes MeGAX_n more efficiently and with a higher growth yield than MeGX_n, suggesting that the larger amounts of neutral sugars (AXOS and XOS) and smaller amounts of acidic sugars (aldouronates) generated by the depolymerization of MeGAX_n are more preferable for the growth of Paenibacillus sp. JDR-2 (unpublished data). The higher growth rate and the preference that Paenibacillus sp. JDR-2 shows for growth on and utilization of MeGAX_n rather than the oligosaccharide products of depolymerization, also shown for the utilization of MeGX_n (11, 22), support a process in which assimilation and metabolism are coupled thermodynamically, if not mechanistically, to the depolymerization catalyzed by the cell-associated XynA₁ GH10 endoxylanase. The rapid disappearance and lack of accumulation of AXOS as well as XOS and aldouronates in the medium further support this interpretation. XynA₁, which has carbohydrate binding modules to interact with xylan and surface layer homology domains to anchor to the bacterial cell surface, is expected to generate oligosaccharides at the cell surface, where they may associate with substrate binding components of the ABC transporter complex, enabling the rapid assimilation of oligosaccharides without their diffusion into the medium (22). This interpretation is also supported by the lower rate of substrate utilization by Paenibacillus sp. JDR-2 when grown on oligosaccharides produced by the in vitro enzymatic hydrolysis of MeGAX_n using XynA₁CD (Fig. 2). The unique property of Paenibacillus sp. JDR-2 of carrying out efficient depolymerization of MeGAX_n and MeGX_n coupled with the assimilation and intracellular metabolism of the products of depolymerization supports its further development as a biocatalyst for the bioconversion of hemicelluloses to targeted products (11). Paenibacillus sp. JDR-2 appears to have evolved a process allowing the conservation of ATP by transporting more xylose and arabinose units in the form of AXOS, XOS, and aldouronates. The bioenergetics involved in the transport of AXOS may support the efficient growth and utilization of MeGAX_n by Paenibacillus sp. JDR-2, as described in studies of the cellulose utilization of Clostridium thermocellum (33).

The characterized GH51 arabinofuranosidases from Clostridium thermocellum ATCC 27405 (34), Geobacillus stearothermophilus T6 (31, 32), and Bacillus subtilis 168 AbfA (35) are very closely related to AbfB and AbfA from Paenibacillus sp. JDR-2. The properties of these arabinofuranosidases are comparable to those of the arabinofuranosidases from Paenibacillus sp. JDR-2, where AbfB has a structure predicted to be very similar to that of the GH51 arabinofuranosidase from Geobacillus stearothermophilus T6. Purified AbfB has a K_m of 1.08 mM for pNP-A at pH 6.5 and 30°C and no loss of activity for 6 h at 50°C, suggesting that abfB may be a suitable candidate for development of a bacterial biocatalyst in SSF. It has greater specificity toward AXOS than MeGAX_n. It also has slight xylosidase activity of 0.07 U/mg (where 1 U of activity is equal to 1 μmol of product formed/min) when para-nitrophenyl-xylopyranoside is used as the substrate in 50 mM sodium acetate buffer, pH 6.5, at 30°C (unpublished data). Geobacillus stearothermophilus T6, which possesses a GH51 arabinofuranosidase along with the GH10/GH67 system, has been evaluated as a candidate for biomass processing (20), and the findings for G. stearothermophilus signify the need to explore the metabolic potential of Paenibacillus sp. JDR-2 and its unique properties for development as a biocatalyst to directly and efficiently convert hemicellulosic biomass to biomass-based products.

The higher level of abfB expression obtained when Paenibacillus sp. JDR-2 is grown in the presence of MeGAX_n than when it is grown in the presence of MeGX_n supports the significance of AbfB in cleaving the arabinofuranose side chain substitutions from the assimilated oligosaccharides generated by depolymerization of MeGAX_n. The upregulation of abfB expression when Paenibacillus sp. JDR-2 is cultured with MeGAX_n compared to its level of expression when it is cultured with MeGX_n and its cooperative expression with the distally located xynA₁ and aldouronate utilization gene cluster further support its role in the MeGAX_n utilization system. The genes encoding ABC transporters in the aldouronate utilization gene cluster are highly upregulated when Paenibacillus sp. JDR-2 is cultured on MeGAX_n and MeGX_n, contributing to the assimilation of oligosaccharides produced by the depolymerization of xylan. The levels of expression of these genes have recently been evaluated by Paenibacillus sp. JDR-2 transcriptomic analysis by RNA sequencing (RNA-seq) of cells grown on substrates such as sorghum MeGAX_n, sweetgum MeGX_n, xylose, arabinose, and glucose (unpublished data). Among all the genes in Paenibacillus sp. JDR-2 predicted to encode arabinofuranosidases of the GH51 and GH43 families, only abfB was upregulated, as determined by RNA-seq (unpublished data).

AbfB is highly active and more specific toward AXOS than polysaccharide MeGAX_n. XynA₁ has previously been shown by TLC analysis to digest MeGX_n to produce X₂, X₃, and MeGX₃ (22). With MeGAX_n, AbfB generates two additional components, one with a mobility slightly less than that of X₂ and a second one with a mobility slightly less than that of X₃. The observation that treatment with AbfB converts these components to products with TLC mobilities corresponding to those of X₂, X₃, and arabinose indicates that they are AX₂ and AX₃ (Fig. 7). The genome of Paenibacillus sp. JDR-2 revealed the absence of a sequence corresponding to the signal peptide on abfB, thereby indicating that it is an intracellular enzyme and hence more efficient in processing AXOS than MeGAX_n. Since the action of XynA₁CD on MeGAX_n generates AX₂ and AX₃ as prominent oligosaccharides, along with X₂, X₃, and MeGX₃, the arabino linkages on the AXOS prevent the release of xylose for metabolism until AbfB removes the arabinose from AXOS. With arabinose representing 10% of the pentoses and with the AXOS AX₂ and AX₃ being generated in equal amounts, following extracellular processing as much as 40% of the MeGAX_n may require intracellular removal of arabinose by AbfB for further conversion to form pentoses for fermentation.

Species such as Bacillus subtilis 168 have evolved a GH11/GH30 xylan utilization system which produces extracellular GH30 and GH11 (36, 37) as well as XynD (9), which release smaller products, including xylose, X₂, X₃, MeGX₃, and arabinose. These species may possess ABC transporters that may aid with the assimilation of xylose, XOS, and arabinose. This system is not as efficient as a GH10/GH67 system for the generation of xylose for fermentation, since it accumulates MeGX₃ in the medium, which cannot be assimilated and metabolized (15, 37). In Paenibacillus sp. JDR-2, the GH10/GH67 system complemented with intracellular processing by enzymes, including GH51 arabinofuranosidases, provides an advantage for the intracellular removal of arabinose since it efficiently assimilates AXOS. Moreover, the GH10/GH67 xylan utilization system in Paenibacillus sp. JDR-2 achieves the complete conversion of xylan (11, 18, 22). This system possesses ABC transporters to assimilate all the oligosaccharides, including AXOS, XOS, and aldouronates, to achieve complete conversion to produce fermentable sugars in higher yields, allowing the complete conversion of the xylose in MeGAX_n as well as MeGX_n to biofuels and chemicals. The presence of arabinofuranose side chains on the oligosaccharides may prevent further processing by intracellular xylanase (XynA₂) and β-xylosidase (XynB) enzymes, making the arabinofuranosidase activity of AbfB required for the generation of products that can be processed by these intracellular enzymes encoded by the genes belonging to the aldouronate utilization gene cluster (Fig. 9).

FIG 9.

Model displaying the coupling of depolymerization, assimilation, and intracellular metabolism for utilization of MeGAX_n or MeGX_n in Paenibacillus sp. JDR-2. X, β-1,4-linked xylopyranosyl units (X, xylose; X₂, xylobiose; X₃, xylotriose); MeG, α-1,2-linked 4-O-methyl-d-glucuronopyranosyl residues (MeG, methylglucuronate; MeGX₃, aldotetrauronate); A, α-1,2- and/or 1,3-linked l-arabinofuranosyl residues (A, arabinose; AX₂, arabino-linked X₂; AX₃, arabino-linked X₃); XynA₁, extracellular cell-associated GH10 endoxylanse; AguA, GH67 α-glucuronidase; AbfB, GH51 α-l-arabinofuranosidase; XynA₂, GH10 endoxylanse; XynB, GH43 β-xylosidase; ABC, ABC transporters.

The genome of Paenibacillus sp. JDR-2 includes genes that play a prominent role in the complete hydrolysis of a variety of polysaccharides, such as MeGAX_n, MeGX_n, starch, arabinan, and barley glucan, producing cell-associated enzymes. Paenibacillus sp. JDR-2 has the ability to grow more rapidly on the polysaccharides than on the oligosaccharides derived from them or monosaccharides. Paenibacillus sp. JDR-2 has evolved a GH10/GH67 system for the complete and direct conversion of MeGAX_n for metabolism. This bacterium also has the potential to hydrolyze aldouronates like MeGX₃ and MeGX₁, which are otherwise not metabolized. Paenibacillus sp. JDR-2 has been shown to grow under oxygen-limiting conditions and produce small quantities of lactate, acetate, and ethanol (22), and work is in progress to improve yields. The metabolic potential of Paenibacillus sp. JDR-2 supports its further development as a biocatalyst for the efficient and complete conversion of hemicelluloses to fermentable sugars.