Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Oct 2.
Published in final edited form as: Int J Med Biol Front. 2012;18(8):629–644.

Interleukin-17 Induces Expression of Chemokines and Cytokines in Prostatic Epithelial Cells but Does Not Stimulate Cell Growth In Vitro

Zongbing You 1,*, Dongxia Ge 1, Sen Liu 1, Qiuyang Zhang 1, Alexander D Borowsky 2, Jonathan Melamed 3
PMCID: PMC4180499  NIHMSID: NIHMS464287  PMID: 25284972

Abstract

BACKGROUND

Interleukin-17 (IL-17A) expression is increased in prostate cancer. This study investigated the expression of IL-17A receptor C (IL-17RC) in prostatic intraepithelial neoplasia (PIN) lesions and the effects of IL-17A on prostatic epithelial cells in in-vitro studies.

METHODS

IL-17RC expression in human and rodent prostate tissues was detected by immunohistochemistry. Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) and Western blot analyses were used to determine mRNA and protein expression in human and mouse prostatic epithelial cell lines.

RESULTS

IL-17RC protein was increased in human and rodent PIN lesions, compared to the normal human and rodent prostatic epithelium. IL-17A treatment activated the Nuclear Factor-κB (NF-κB) and/or Extracellular signal-Regulated Kinase (ERK) pathways in human PIN and LNCaP cell lines as well as mouse prostate cancer cell line TRAMP-C1. IL-17A treatment did not affect cell growth of the cell lines studied. However, IL-17A induced expression of CXCL1, CXCL2, CCL2, CCL5, and IL-6 in human and mouse prostatic epithelial cell lines. When the full-length IL-17RC was over-expressed in human PIN and LNCaP cell lines, activation of NF-κB and/or ERK pathways and expression of CXCL1, CXCL2, and CCL5 chemokines were significantly enhanced upon IL-17A treatment.

CONCLUSION

These findings suggest that the prostatic epithelial cells in PIN lesions may respond to IL-17A stimuli with augmented synthesis of chemokines, due to increased IL-17RC expression.

Keywords: IL-17, PIN, prostate cancer

INTRODUCTION

Almost all surgical prostate specimens contain evidence of inflammation [1–3]. Chronic inflammation invokes proliferative inflammatory atrophy (PIA) of prostate – a potential precursor lesion to prostatic intraepithelial neoplasia (PIN) and/or carcinoma [4,5]. The cause of prostate inflammation includes infection, urine reflux, diet, estrogen, and physical trauma [6,7]. Normal prostate may contain a small number of T cells, B cells, macrophages, and mast cells that increase in number with aging [8].

In animal models of prostate cancer, chronic inflammation with T cells was noted in a significant proportion of the mice with high-grade PIN [9]. When TRAMP mice were fed with the COX-2 inhibitor celecoxib, only 25% mice developed prostate cancer, compared to a rate of 100% in control mice without celecoxib treatment. None of the celecoxib-treated mice had any metastatic tumor, whereas the control mice showed metastasis to the lymph nodes (65%), lungs (35%) and liver (20%) [10]. This study highlights the role of inflammation in cancer initiation and progression in this model. Inflammatory cells were also noted in the PB-Cre4 × Ptenloxp/loxp model at 26–29 weeks of age [11]. At this stage, more than 80% of the prostate tissue was composed of microinvasive cancer cells and PIN, with less than 20% of stroma and inflammatory cells. The cancer-dominant mouse prostate tissues had 3- to 8-fold increase of some cytokines and chemokines such as CXC ligand 1 (CXCL1), C-C ligand 2 (CCL2) and CCL20, compared to the age-matched normal mouse prostate tissues [11]. In a 2-amino-1-methyl-6-phenylimidazo (4,5-b) pyridine (PhIP)-treated rat model [12], significantly more inflammation occurred in the PhIP-treated rat prostate glands than in the controls and inflammation preceded proliferative atrophy and PIN.

In human PIA lesions, over 80% of inflammatory cells are CD3+ T cells, of which most are CD4+ [4,13,14]. The CD4+ T helper cells are classified into TH1, TH2, and TH17 subtypes. TH1 cells produce interferon (IFN)-γ and interleukin (IL)-2, while TH2 cells produce IL-4, IL-5, and IL-13. TH17 is a new subtype that produces IL-17A and IL-17F [15,16]. The inflammatory cells and the inflammation-stimulated prostatic epithelial and stromal cells produce a variety of cytokines, chemokines, and growth factors [13,14,17]. It is known that sequence variants of IL-1β, IL-8, IL-10, tumor necrosis factor (TNF) α and vascular epithelial growth factor are associated with human prostate cancer risk [18].

IL-17A is a pivotal cytokine that stimulates expression of other cytokines and chemokines such as TNFα, IL-6, and IL-8 [19–22]. The percentage of TH17 cells in prostate-infiltrating lymphocytes was higher than that in the peripheral blood, though this TH17 skewing was inversely correlated with Gleason grade [23]. IL-17A expression is increased in 79% of benign prostate hyperplasia (BPH) and 58% of prostate cancer specimens [14]. IL-17RA and IL-17RC are the receptors for IL-17A and IL-17F [24–27]. Both receptors have been found in prostate cancer [14,28,29]. The full-length IL-17RC protein inhibited TNFα-induced apoptosis in a human prostate cancer cell line LNCaP [30]. IL-17RC protein expression as detected by the anti-IL-17RC intracellular domain (anti-ICD) antibodies was significantly increased in castration-resistant prostate cancer, compared to hormone sensitive prostate cancer [30,31].

In this study, we found that IL-17RC expression was increased in PIN lesions from human, rat, and mouse prostate tissues. In addition, we found that recombinant human IL-17A acted through Nuclear Factor-κB (NF-κB) and/or Extracellular signal-Regulated Kinase (ERK) pathways to stimulate expression of a variety of chemokines and cytokines in prostatic epithelial cell lines.

MATERIALS AND METHODS

Antibodies and Reagents

Rabbit anti-IL-17RC intracellular domain (anti-ICD) antibodies that recognize an intracellular domain of IL-17RC protein were affinity-purified [28,30–32]. pERK1/2 antibodies were obtained from Santa Cruz Biotechnology, Santa Cruz, CA. ERK1/2, pIκBα, IκBα, pAKT (serine 473), and pSTAT3 (Tyr705) antibodies were obtained from Cell Signaling Technology, Beverly, MA. Mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibodies were obtained from Chemicon, Temecula, CA. The VECTSTAIN elite ABC Reagent and DAB Substrate Kit were obtained from Vector Laboratories, Burlingame, CA.

Cell Culture

The RWPE-1 [33] and pRNS-1-1 [34] cells (immortalized human prostatic epithelial cell lines) were cultured in a serum-free keratinocyte medium. The PIN cell line, derived from a human high-grade PIN lesion [35,36], was cultured in a keratinocyte medium supplemented with 10% fetal bovine serum (FBS). Human prostate cancer cell line LNCaP and mouse prostate cancer cell line TRAMP-C1 were obtained from the American Type Culture Collection (Manassas, VA). The LNCaP cells were cultured in the T-medium (custom formula # 02-0056) supplemented with 5% FBS. The TRAMP-C1 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 4.5 g/L glucose, 5 ng/ml recombinant human insulin, 10 nM R1881 (synthetic androgen), and 10% FBS. The cell lines over-expressing human full-length IL-17RC (PIN-RC and LNCaP-RC) and the control cell lines (PIN-C and LNCaP-C, transfected with empty vector) were established as described previously [30]. Medium and supplements were obtained from Invitrogen, Carlsbad, CA, unless noted otherwise. The cells were cultured in a 37°C, 5% CO2 humidified incubator.

Immunohistochemical Staining

Sixty of human prostate tissue samples were provided by the New York University Prostate Cancer Tissue Resource, Department of Pathology, New York University School of Medicine. The prostate tissues were collected from either radical prostatectomy specimens or transurethral resection specimens. The tissue sections contained high-grade PIN lesions that were confirmed by a pathologist (J.M.). The use of these archival tissues was approved by the Tulane University Institution Review Board.

The rat prostate tissues were obtained from a prior study [12]. The age-matched control and PhIP-treated rat prostate tissues were collected from 45- and 65-week-old rats. The mouse prostate tissues were collected from 9-week-old TRAMP mice [37] [C57BL/6 background, strain name C57BL/6-Tg(TRAMP)8247Ng/J, the Jackson Laboratory, Bar Harbor, ME]. Ptenloxp/loxp (PtenL/L) mice [11] (129S4/SvJae*BALB/c background, strain name C;129S4-Ptentm1Hwu/J) were obtained from the Jackson Laboratory, Bar Harbor, ME. PB-Cre4 mice [38] (B6.Cg background, strain name B6.Cg-Tg(Pbsn-cre)4Prb) were obtained from Mouse Models of Human Cancers Consortium (MMHCC) of the National Cancer Institute. Cross-breeding of PB-Cre4 mice and PtenL/L mice generated Pten conditional knockout male mice with PIN lesions in the prostate at 6 weeks of age according to the published protocol [11]. The use of the animals was approved by the Institutional Animal Use and Care Committees at the University of California Davis and Tulane University.

The human and rodent prostate tissue slides were stained with 7.5 µg/ml anti-ICD antibodies, using the VECTSTAIN elite ABC Reagent and DAB Substrate Kit with hematoxylin counterstaining according to the manufacturer’s protocol [30–32]. The stained slides were assessed by two pathologists (A.D.B. for rodent tissues and J.M. for human tissues). Representative photomicrographs of the prostate tissues were captured under a microscope with digital camera.

Western Blot Analysis

The cells were cultured in serum-free medium for 16 hours and treated with or without 20 ng/ml of recombinant human IL-17A (R&D Systems Inc., Minneapolis, MN) for 10 to 120 minutes. Proteins were extracted from the cultured cells in RIPA lysis buffer [50 mM sodium fluoride, 0.5% Igepal CA-630 (NP-40), 10 mM sodium phosphate, 150 mM sodium chloride, 25 mM Tris pH 8.0, 1mM phenylmethylsulfonyl fluoride, 2 mM ethylenediaminetetraacetic acid (EDTA), 1.2 mM sodium vanadate] supplemented with protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO). Equal amount of proteins was subjected to 10% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membrane. The membranes were blocked with 5% nonfat dry milk in TBST (25 mM Tris-HCl, 125 mM NaCl, 0.1% Tween 20) for 2 hours and probed with the indicated primary antibodies overnight and then IRDye®800CW- or IRDye®680-conjugated secondary antibodies (LI-COR Biosciences, Lincoln, NE) for 1 hour. The results were visualized by using an Odyssey Infrared Imager (LI-COR Biosciences, Lincoln, NE). For loading control, the membranes were stripped and probed for non-phosphorylated proteins and/or GAPDH.

Cell Growth Assay

About 2 × 104 cells per well were cultured in the complete culture medium in 12-well plates. Triplicate wells per group were treated with or without 20 ng/ml of IL-17A for 4 days. The medium was replaced by serum-free DMEM containing 5 mg/ml of 3-[4,5-dimethylthiazol-2-yl]-2,-5-diphenyl-tetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MO). After 4 hours of incubation, medium was carefully removed, the formazan dye was dissolved by dimethylsulfoxide, and absorbance at 595 nm was read on a Plate Reader.

Analysis of mRNA Expression by Quantitative Real-time RT-PCR

The cells were cultured in serum-free medium for 16 hours and treated with or without 20 ng/ml of IL-17A for 2 hours. Total RNA was extracted from the cells using RNeasy Mini Kit (QIAGEN, Valencia, CA) with on-membrane DNase I digestion to avoid genomic DNA contamination. cDNA was made from total RNA using Superscript™ First-Strand Synthesis System with oligo dT primers (Invitrogen, Carlsbad, CA). Human and mouse GAPDH primers were obtained from Applied Biosystems (Foster City, CA). The PCR primers specific for each chemokine and cytokine have been published previously [39–43], except that the mouse Il-6 primers were obtained from Real Time Primers, LLC., Elkins Park, PA (see Table I for primer sequences). Real-time quantitative PCR was performed in triplicates with an iQ5®iCycler (Bio-Rad Laboratories, Hercules, CA) following the recommended protocols. Results were normalized to GAPDH levels using the formula ΔCt (Cycle threshold) = Ct of target gene – Ct of GAPDH. The mRNA level of the untreated control cells was used as the baseline; therefore, ΔΔCt was calculated using the formula ΔΔCt = ΔCt of target gene - ΔCt of the baseline. The fold change of mRNA level was calculated as fold = 2ΔΔCt.

Table I.

Sequences of PCR primers used for qRT-PCR

Gene Sequence (5’ to 3’)
hCXCL1 Forward AACCGAAGTCATAGCCACAC
Reverse GTTGGATTTGTCACTGTTCAGC
hCXCL2 Forward CTGCGCTGCCAGTGCTT
Reverse CCTTCACACTTTGGATGTTCTTGA
hCCL2 Forward CAAGCAGAAGTG GGTTCAGGAT
Reverse TCTTCGGAGTTTGGGTTTGC
hCCL5 Forward CCTCGCTGTCATCCTCATTG
Reverse GGGTTGGCACACACTTGG
hIL6 Forward GGTACATCCTCGACGGCATCT
Reverse GTGCCTCTTTGCTGCTTTCAC
mCxcl1 Forward CACCCAAACCGAAGTCATAG
Reverse AAGCCAGCGTTCACCAGA
mCxcl2 Forward CGCCCAGACAGAAGTCATAG
Reverse TCCTCCTTTCCAGGTCAGTTA
mCcl2 Forward GCCTGCTGTTCACAGTTGC
Reverse TGTATGTCTGGACCCATTCCT
mCcl5 Forward CACCACTCCCTGCTGCTT
Reverse ACACTTGGCGGTTCCTTC
mIl6 Forward CTACCCCAATTTCCAATGCT
Reverse ACCACAGTGAGGAATGTCCA
Open in a new tab

Statistical Analysis

The difference of IL-17RC staining (negative versus positive) between the normal human prostatic epithelium and human PIN lesions was analyzed by χ2 test. The Student’s t test was used to analyze the other quantitative data. P < 0.05 was considered statistically significant.

RESULTS

IL-17RC Protein Expression Was Increased in Human and Rodent PIN Lesions

In human prostate tissues with high-grade PIN, we found that 38 of the 60 cases (63%) of high-grade PIN lesions showed positive staining for IL-17RC (Fig.1A and 1B). The typical high-grade PIN lesions showed micropapillary growth pattern of stratified cells with enlarged nuclei and prominent nucleoli. The normal epithelium in all of the 60 cases stained negatively for IL-17RC expression (Fig.1A and 1B). Thus, IL-17RC expression is significantly increased in human PIN lesions compared to the normal prostatic epithelium (P < 0.001). The endothelium of adjacent blood vessels also stained positively for IL-17RC (Fig. 1B).

Fig. 1. IL-17RC expression was increased in human and rodent PIN lesions as shown by immunohistochemical staining.

Fig. 1

Open in a new tab

A. Human high-grade PIN lesions (in the three circles); original magnification, ×100. B. High magnification (×400) of a representative PIN lesion; ar rows indicate PIN; open arrow indicates normal epithelium; and arrowhead indicates a blood vessel. C. Rat normal prostatic epithelium (open arrow) and a blood vessel (arrowhead). D. Rat normal atrophic prostatic epithelium (open arrow) and epithelial hyperplasia (arrow). E. Rat normal prostatic epithelium (open arrow) and PIN (arrow). F. TRAMP mouse PIN lesions (arrows) and adjacent normal epithelium (open arrows). G. Pten wild-type mouse normal prostatic epithelium (open arrow). H. Pten conditional knockout mouse PIN (arrows). Original magnification, × 400.

The normal prostatic epithelium from the untreated rats stained negatively for IL-17RC expression, though the adjacent endothelium of blood vessels stained positively (Fig. 1C), suggesting that the normal rat prostatic epithelium is truly negative for IL-17RC staining. In contrast, the prostatic epithelium of the PhIP-treated rats showed focal lesions of crowded cells with enlarged and hyperchromatic nuclei. The focal lesions were diagnosed as epithelial hyperplasia according to the Bar Harbor Classification [44]. These focal lesions stained moderately positive for IL-17RC (Fig. 1D). Strong staining for IL-17RC was found in typical rat PIN lesions (Fig. 1E). The PIN lesions were characterized by a cribriform architecture with neoplastic epithelial cells forming solid bridges within the glandular lumen. The lesions filled the glandular lumen but did not show signs of stromal invasion (Fig. 1E). In TRAMP mouse prostate tissues, PIN lesions were characterized by crowded and/or stratified cells with enlarged and atypical nuclei. The mouse PIN lesions stained moderately positive for IL-17RC (Fig. 1F). Of note, the adjacent normal prostatic epithelium stained negatively for IL-17RC (Fig. 1F). In Pten wild-type mouse prostates, the prostatic epithelium stained negatively for IL-17RC (Fig. 1G). In contrast, the neoplastic epithelium stained strongly positive for IL-17RC in the PIN lesions of Pten conditional knockout mice (Fig. 1H).

IL-17A Induced Activation of ERK and/or NF-κB Signaling Pathways

When PIN-C cells were treated with 20 ng/ml of IL-17A, phosphorylated ERK1/2 was not obviously increased (Fig. 2A). When IL-17RC was over-expressed in PIN-RC cells, phosphorylated ERK1/2 was slightly increased upon IL-17A treatment (Fig. 2A). Phosphorylated ERK1/2 was transiently increased in TRAMP-C1 cells after 10 to 15 min of IL-17A treatment (Fig. 2B). Phosphorylated IκBα was transiently increased in LNCaP-C cells after 10 min of IL-17A treatment (Fig. 2C), but not in PIN-C or TRAMP-C1 cells (data not shown). Phosphorylated ERK1/2 was also transiently increased in LNCaP-C cells after 10 min of IL-17A treatment (Fig. 2C). When IL-17RC was over-expressed in LNCaP-RC cells, phosphorylated IκBα and phosphorylated ERK1/2 were increased to higher levels and sustained up to 60 min after IL-17A treatment, compared to LNCaP-C cells (Fig. 2C). Phosphorylated AKT or STAT3 (Signal Transducer and Activator of Transcription 3) was not increased in any of the cells studied (Fig. 2C and data not shown).

Fig. 2. Effects of IL-17A on signaling pathways and cell growth in the prostati c epithelial cell lines.

Fig. 2

Open in a new tab

A. Western blot analysis of phosphorylated ERK1/2 (pERK1/2) and regular ERK1/2 in human PIN -C and PINRC cells. B. Western blot analysis of pERK1/2 and ERK1/2 in mouse TRAMP -C1 cells. C. Western blot analysis of pIκBα, IκBα, pERK1/2, ERK1/2, pAKT, and pSTAT3 in human LNCaP-C and LNCaP-RC cells. For loading control, the membranes were stripped and probed for GAPDH. D. Cell growth assay. The cells were cultured in the complete culture medium in 12-well plates. Triplicate wells per group were treated with or without 20 ng/ml of IL-17A for 4 days. The medium was replaced by serum-free DMEM containing 5 mg/ml of MTT. After 4 hours of incubation, medium was removed and the formazan dye was dissolved by dimethylsulfoxide. Absorbance at 595 nm was read. The difference between the groups in comparison was not statistically significant (P > 0.05).

IL-17A Did Not Affect Cell Growth but Stimulated Expression of Chemokines and Cytokines

We did not observe any difference in cell growth when IL-17RC was over-expressed in LNCaP or PIN cells or when the cells were treated with IL-17A (Fig. 2D). However, we found that IL-17A induced expression of CXCL1 and CXCL2 chemokines by approximately 2-fold in RWPE-1, pRNS-1-1, PIN-C, and LNCaP-C cells (see Table II for a summary of the results). IL-17A also induced expression of CCL2 chemokine and IL-6 cytokine by approximately 2-fold in LNCaP-C cells. Expression of CCL2, CCL5 and IL-6 was not noticeably induced by IL-17A in RWPE-1, pRNS-1-1, and PIN-C cells. IL-17A induced expression of CXCL1 and CXCL2 by 3-fold in PIN-RC cells (P < 0.05, compared to PIN-C cells). Expression of CXCL1 and CCL5 was induced by 15- and 9-fold in LNCaP-RC cells (P < 0.05, compared to LNCaP-C cells). In TRAMP-C1 cells, IL-17A induced expression of CXCL1, CXCL2, CCL2, CCL5, and IL-6 by approximately 3- to 33-fold (Table II).

Table II.

Chemokines and cytokines induced by IL-17A in human and mouse prostatic epithelial cell lines

Gene Human normal cells Human PIN cells Human cancer cells Mouse cancer cells
RWPE-1 pRNS-1-1 PIN-C PIN-RC LNCaP-C LNCaP-RC TRAMP-C1
CXCL1 2.7±1.8 2.0±1.7 1.9±0.6 3.1±0.5* 2.8±1.6 15.0±3.3* 32.7±1.1
CXCL2 2.3±1.1 1.9±1.3 2.0±0.4 3.0±0.7* 2.0±1.1 2.4±1.5 9.3±1.5
CCL2 1.0±0.5 1.2±0.3 1.2±0.4 1.8±1.1 2.4±1.9 2.8±1.3 4.5±1.0
CCL5 0.4±0.5 1.3±0.3 1.3±1.2 1.0±0.5 1.5±1.2 9.2±2.8* 2.8±1.1
IL-6 1.3±0.3 1.5±0.4 1.7±0.3 1.3±0.3 2.3±1.4 1.8±0.6 5.6±1.0
Open in a new tab

The cell lines were treated with or without 20 ng/ml of IL-17A for 2 h. The mRNA expression was analyzed by qRT-PCR, which was normalized by GAPDH and presented as mean ± standard deviation of fold increase of three experiments using the untreated control cells as baseline. Asterisk indicates that the fold increase was of statistical significance (P < 0.05), compared to the PIN-C or LNCaP-C cells, respectively.

DISCUSSION

IL-17RC gene was originally identified from prostate cancer [28]. We have previously reported that protein expression of the IL-17RC isoform recognized by the anti-ICD antibodies was significantly increased in castration-resistant prostate cancer, compared to androgen-dependent prostate cancer [30,31]. We recently reported that the normal human prostatic epithelium stained negatively using the anti-ICD antibodies [32]. The rationale to investigate IL-17RC expression in PIN lesions is to complete our study of IL-17RC expression in a spectrum of normal prostatic epithelium, PIN, androgen-dependent prostate cancer, and castration-resistant prostate cancer. In this study, we found that normal human prostatic epithelium stains negatively for IL-17RC expression, whereas 38 of the 60 cases (63%) of high-grade PIN lesions stain positively. The IL-17RC-positive rate in PIN lesions is significantly higher than in normal prostatic epithelium (P < 0.001). In order to determine whether or not the increased IL-17RC expression is unique in human PIN lesions, both rat and mouse PIN lesions were stained for IL-17RC expression. We found that in both rat and mouse PIN lesions, IL-17RC expression is increased compared to the adjacent normal prostatic epithelium. In addition, we found that IL-17RC expression is also increased in the alveolar hyperplasia lesions in a K-rasLA1 transgenic mouse model of lung adenocarcinoma [45] (You, et al., unpublished observation). Taken together, these findings suggest that increase of IL-17RC expression is possibly a common phenomenon in epithelial hyperplasia and PIN lesions.

IL-17A and IL-17F cytokines act through IL-17RA and IL-17RC to activate intracellular signalling pathways [24–27,46]. We found that ERK1/2 and/or NF-κB pathways in human and mouse prostate epithelial cells are activated by IL-17A treatment. This is consistent with the reports in the literature that ERK1/2 and NF-κB pathways are the two major IL-17-induced signalling pathways [47]. It is worth noting that activation of ERK1/2 and/or NF-κB pathways is enhanced in PIN-RC and LNCaP-RC cells that over-express IL-17RC, compared to the control cell lines PIN-C and LNCaP-C. This finding implies that increased IL-17RC expression in prostatic epithelium may enhance cellular responses to IL-17 stimuli.

TH17 cell number and IL-17A expression have been found to be increased in prostate cancer [14,23]. IL-17-expressing macrophages and neutrophils also accumulate in the PIA lesion - a potential precursor to PIN and carcinoma [4,48]. However, the effects of IL-17A on prostatic epithelium have not been well studied. In this study, we found that IL-17A does not affect cell growth rate of the cultured prostatic epithelial cells. This is consistent with previous in-vitro studies showing that IL-17 does not stimulate cellular proliferation in other cell types [49–52]. However, it has been reported that IL-17A induced expression of a variety of chemokines and cytokines in some mesenchymal cell lines [43]. We have recently reported that IL-17A induces expression of chemokines and cytokines in human gynecologic cancer cell lines [53]. It is not known whether IL-17A has similar effects on prostatic epithelial cells. Therefore, we examined the expression of chemokines and cytokines in human and mouse prostatic epithelial cells treated with IL-17A. We found that expression of CXCL1, CXCL2, CCL2, CCL5, and IL-6 is induced by IL-17A. Moreover, when IL-17RC is over-expressed in PIN-RC and LNCaP-RC cells, expression of CXCL1, CXCL2, and CCL5 is significantly enhanced, compared to the control cell lines PIN-C and LNCaP-C. Therefore, it is possible that an increased IL-17RC expression in the prostatic epithelial cells may confer an enhanced response upon IL-17 stimulation. It has been shown that CXCL1 plays important roles in inflammation, angiogenesis, tumorigenesis, and tumor invasion in several cancer types [39,54,55]. CXCL2 promotes colorectal tumor cell proliferation [56]. CCL2 enhances prostate cancer cell migration and metastasis [57,58]. CCL5 is correlated with cancer formation and progression in breast and prostate cancers [59–61]. The function of these chemokines in the prostatic epithelial-stromal interaction is yet to be determined.

CONCLUSION

This study demonstrates that IL-17RC expression is increased in human and rodent PIN lesions. Over-expression of IL-17RC enhances IL-17A-induced signalling activity and expression of chemokines.

ACKNOWLEDGMENTS

The authors thank Dr. Prescott L. Deininger (Director of Tulane Cancer Center) and Tulane Cancer Center Core Facilities for research support; Dr. Johng S. Rhim who was the original source of RWPE-1 and pRNS-1-1 cell lines; Dr. Mark Stearns who was the original source of the PIN cell line and Dr. Alice C. Levine who provided the PIN cell line. Grant sponsors: National Institutes of Health’s Centers of Biomedical Research Excellence (COBRE) grant (2P20RR020152-06), Department of Defense grants (W81XWH-05-1-0567 and W81XWH-10-1-0937), the developmental funds of the Tulane Cancer Center, Louisiana Cancer Research Consortium, and Tulane Framework for Global Health Seed Grant.

Abbreviations

Anti-ICD

anti-IL-17RC intracellular domain antibodies

CCL

C-C ligand

CXCL

CXC ligand

ERK

Extracellular signal-Regulated Kinase

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

IL

interleukin

IL-17RC

interleukin-17 receptor C

NF-κB

Nuclear Factor-κB

PhIP

2-amino-1-methyl-6-phenylimidazo (4,5-b) pyridine

PIN

prostatic intraepithelial neoplasia

TH17

T helper cells subtype 17

TNF

tumor necrosis factor.

Footnotes

Conflicts of Interest

The authors have no conflicts of interest in publication of this chapter.

REFERENCES

  • 1.Nickel JC, Downey J, Young I, Boag S. Asymptomatic inflammation and/or infection in benign prostatic hyperplasia. BJU Int. 1999;84(9):976–981. doi: 10.1046/j.1464-410x.1999.00352.x. [DOI] [PubMed] [Google Scholar]
  • 2.Gerstenbluth RE, Seftel AD, MacLennan GT, Rao RN, Corty EW, Ferguson K, Resnick MI. Distribution of chronic prostatitis in radical prostatectomy specimens with up-regulation of bcl-2 in areas of inflammation. J Urol. 2002;167(5):2267–2270. [PubMed] [Google Scholar]
  • 3.Schatteman PH, Hoekx L, Wyndaele JJ, Jeuris W, Van Marck E. Inflammation in prostate biopsies of men without prostatic malignancy or clinical prostatitis: correlation with total serum PSA and PSA density. Eur Urol. 2000;37(4):404–412. doi: 10.1159/000020161. [DOI] [PubMed] [Google Scholar]
  • 4.De Marzo AM, Marchi VL, Epstein JI, Nelson WG. Proliferative inflammatory atrophy of the prostate: implications for prostatic carcinogenesis. Am J Pathol. 1999;155(6):1985–1992. doi: 10.1016/S0002-9440(10)65517-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wang W, Bergh A, Damber JE. Morphological transition of proliferative inflammatory atrophy to high-grade intraepithelial neoplasia and cancer in human prostate. Prostate. 2009;69(13):1378–1386. doi: 10.1002/pros.20992. [DOI] [PubMed] [Google Scholar]
  • 6.De Marzo AM, Platz EA, Sutcliffe S, Xu J, Gronberg H, Drake CG, Nakai Y, Isaacs WB, Nelson WG. Inflammation in prostate carcinogenesis. Nat Rev Cancer. 2007;7(4):256–269. doi: 10.1038/nrc2090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Sutcliffe S, Platz EA. Inflammation in the etiology of prostate cancer: an epidemiologic perspective. Urol Oncol. 2007;25(3):242–249. doi: 10.1016/j.urolonc.2006.09.014. [DOI] [PubMed] [Google Scholar]
  • 8.Bierhoff E, Walljasper U, Hofmann D, Vogel J, Wernert N, Pfeifer U. Morphological analogies of fetal prostate stroma and stromal nodules in BPH. Prostate. 1997;31(4):234–240. doi: 10.1002/(sici)1097-0045(19970601)31:4<234::aid-pros4>3.0.co;2-k. [DOI] [PubMed] [Google Scholar]
  • 9.Song Z, Wu X, Powell WC, Cardiff RD, Cohen MB, Tin RT, Matusik RJ, Miller GJ, Roy- Burman P. Fibroblast growth factor 8 isoform B overexpression in prostate epithelium: a new mouse model for prostatic intraepithelial neoplasia. Cancer Res. 2002;62(17):5096–5105. [PubMed] [Google Scholar]
  • 10.Gupta S, Adhami VM, Subbarayan M, MacLennan GT, Lewin JS, Hafeli UO, Fu P, Mukhtar H. Suppression of prostate carcinogenesis by dietary supplementation of celecoxib in transgenic adenocarcinoma of the mouse prostate model. Cancer Res. 2004;64(9):3334–3343. doi: 10.1158/0008-5472.can-03-2422. [DOI] [PubMed] [Google Scholar]
  • 11.Wang S, Gao J, Lei Q, Rozengurt N, Pritchard C, Jiao J, Thomas GV, Li G, Roy-Burman P, Nelson PS, Liu X, Wu H. Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell. 2003;4(3):209–221. doi: 10.1016/s1535-6108(03)00215-0. [DOI] [PubMed] [Google Scholar]
  • 12.Borowsky AD, Dingley KH, Ubick E, Turteltaub KW, Cardiff RD, Devere-White R. Inflammation and atrophy precede prostatic neoplasia in a PhIP-induced rat model. Neoplasia. 2006;8(9):708–715. doi: 10.1593/neo.06373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Steiner GE, Djavan B, Kramer G, Handisurya A, Newman M, Lee C, Marberger M. The picture of the prostatic lymphokine network is becoming increasingly complex. Rev Urol. 2002;4(4):171–177. [PMC free article] [PubMed] [Google Scholar]
  • 14.Steiner GE, Newman ME, Paikl D, Stix U, Memaran-Dagda N, Lee C, Marberger MJ. Expression and function of pro-inflammatory interleukin IL-17 and IL-17 receptor in normal, benign hyperplastic, and malignant prostate. Prostate. 2003;56(3):171–182. doi: 10.1002/pros.10238. [DOI] [PubMed] [Google Scholar]
  • 15.Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, Weaver CT. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol. 2005;6(11):1123–1132. doi: 10.1038/ni1254. [DOI] [PubMed] [Google Scholar]
  • 16.Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, Wang Y, Hood L, Zhu Z, Tian Q, Dong C. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol. 2005;6(11):1133–1141. doi: 10.1038/ni1261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Steiner GE, Stix U, Handisurya A, Willheim M, Haitel A, Reithmayr F, Paikl D, Ecker RC, Hrachowitz K, Kramer G, Lee C, Marberger M. Cytokine expression pattern in benign prostatic hyperplasia infiltrating T cells and impact of lymphocytic infiltration on cytokine mRNA profile in prostatic tissue. Lab Invest. 2003;83(8):1131–1146. doi: 10.1097/01.lab.0000081388.40145.65. [DOI] [PubMed] [Google Scholar]
  • 18.Sun J, Turner A, Xu J, Gronberg H, Isaacs W. Genetic variability in inflammation pathways and prostate cancer risk. Urol Oncol. 2007;25(3):250–259. doi: 10.1016/j.urolonc.2006.10.001. [DOI] [PubMed] [Google Scholar]
  • 19.Kolls JK, Linden A. Interleukin-17 family members and inflammation. Immunity. 2004;21(4):467–476. doi: 10.1016/j.immuni.2004.08.018. [DOI] [PubMed] [Google Scholar]
  • 20.Moseley TA, Haudenschild DR, Rose L, Reddi AH. Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 2003;14(2):155–174. doi: 10.1016/s1359-6101(03)00002-9. [DOI] [PubMed] [Google Scholar]
  • 21.Qian Y, Liu C, Hartupee J, Altuntas CZ, Gulen MF, Jane-Wit D, Xiao J, Lu Y, Giltiay N, Liu J, Kordula T, Zhang QW, Vallance B, Swaidani S, Aronica M, Tuohy VK, Hamilton T, Li X. The adaptor Act1 is required for interleukin 17-dependent signaling associated with autoimmune and inflammatory disease. Nature immunology. 2007;8(3):247–256. doi: 10.1038/ni1439. [DOI] [PubMed] [Google Scholar]
  • 22.Li X. Act1 modulates autoimmunity through its dual functions in CD40L/BAFF and IL-17 signaling. Cytokine. 2008;41(2):105–113. doi: 10.1016/j.cyto.2007.09.015. [DOI] [PubMed] [Google Scholar]
  • 23.Sfanos KS, Bruno TC, Maris CH, Xu L, Thoburn CJ, DeMarzo AM, Meeker AK, Isaacs WB, Drake CG. Phenotypic analysis of prostate-infiltrating lymphocytes reveals TH17 and Treg skewing. Clin Cancer Res. 2008;14(11):3254–3261. doi: 10.1158/1078-0432.CCR-07-5164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yao Z, Fanslow WC, Seldin MF, Rousseau AM, Painter SL, Comeau MR, Cohen JI, Spriggs MK. Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity. 1995;3(6):811–821. doi: 10.1016/1074-7613(95)90070-5. [DOI] [PubMed] [Google Scholar]
  • 25.Yao Z, Painter SL, Fanslow WC, Ulrich D, Macduff BM, Spriggs MK, Armitage RJ. Human IL-17: a novel cytokine derived from T cells. J Immunol. 1995;155(12):5483–5486. [PubMed] [Google Scholar]
  • 26.Kuestner RE, Taft DW, Haran A, Brandt CS, Brender T, Lum K, Harder B, Okada S, Ostrander CD, Kreindler JL, Aujla SJ, Reardon B, Moore M, Shea P, Schreckhise R, Bukowski TR, Presnell S, Guerra-Lewis P, Parrish-Novak J, Ellsworth JL, Jaspers S, Lewis KE, Appleby M, Kolls JK, Rixon M, West JW, Gao Z, Levin SD. Identification of the IL-17 receptor related molecule IL-17RC as the receptor for IL-17F. J Immunol. 2007;179(8):5462–5473. doi: 10.4049/jimmunol.179.8.5462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wright JF, Bennett F, Li B, Brooks J, Luxenberg DP, Whitters MJ, Tomkinson KN, Fitz LJ, Wolfman NM, Collins M, Dunussi-Joannopoulos K, Chatterjee-Kishore M, Carreno BM. The human IL-17F/IL-17A heterodimeric cytokine signals through the IL-17RA/IL-17RC receptor complex. J Immunol. 2008;181(4):2799–2805. doi: 10.4049/jimmunol.181.4.2799. [DOI] [PubMed] [Google Scholar]
  • 28.Haudenschild D, Moseley T, Rose L, Reddi AH. Soluble and transmembrane isoforms of novel interleukin-17 receptor-like protein by RNA splicing and expression in prostate cancer. J Biol Chem. 2002;277(6):4309–4316. doi: 10.1074/jbc.M109372200. [DOI] [PubMed] [Google Scholar]
  • 29.Haudenschild DR, Curtiss SB, Moseley TA, Reddi AH. Generation of interleukin-17 receptor-like protein (IL-17RL) in prostate by alternative splicing of RNA. Prostate. 2006;66(12):1268–1274. doi: 10.1002/pros.20422. [DOI] [PubMed] [Google Scholar]
  • 30.You Z, Shi XB, DuRaine G, Haudenschild D, Tepper CG, Lo SH, Gandour-Edwards R, de Vere White RW, Reddi AH. Interleukin-17 receptor-like gene is a novel antiapoptotic gene highly expressed in androgen-independent prostate cancer. Cancer Res. 2006;66(1):175–183. doi: 10.1158/0008-5472.CAN-05-1130. [DOI] [PubMed] [Google Scholar]
  • 31.You Z, Dong Y, Kong X, Zhang Y, Vessella RL, Melamed J. Differential expression of IL-17RC isoforms in androgen-dependent and androgen-independent prostate cancers. Neoplasia. 2007;9(6):464–470. doi: 10.1593/neo.07109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ge D, You Z. Expression of interleukin-17RC protein in normal human tissues. Int Arch Med. 2008;1(1):19. doi: 10.1186/1755-7682-1-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Bello D, Webber MM, Kleinman HK, Wartinger DD, Rhim JS. Androgen responsive adult human prostatic epithelial cell lines immortalized by human papillomavirus 18. Carcinogenesis. 1997;18(6):1215–1223. doi: 10.1093/carcin/18.6.1215. [DOI] [PubMed] [Google Scholar]
  • 34.Lee MS, Garkovenko E, Yun JS, Weijerman PC, Peehl DM, Chen LS, Rhim JS. Characterization of adult human prostatic epithelial cells immortalized by polybrene-induced DNA transfection with a plasmid containing an origin-defective SV40 genome. Int J Oncol. 1994;4:821–830. doi: 10.3892/ijo.4.4.821. 4. [DOI] [PubMed] [Google Scholar]
  • 35.Wang M, Liu A, Garcia FU, Rhim JS, Stearns ME. Growth of HPV-18 immortalized human prostatic intraepithelial neoplasia cell lines. Influence of IL-10, follistatin, activin-A, and DHT. Int J Oncol. 1999;14(6):1185–1195. doi: 10.3892/ijo.14.6.1185. [DOI] [PubMed] [Google Scholar]
  • 36.Liu XH, Kirschenbaum A, Lu M, Yao S, Klausner A, Preston C, Holland JF, Levine AC. Prostaglandin E(2) stimulates prostatic intraepithelial neoplasia cell growth through activation of the interleukin-6/GP130/STAT-3 signaling pathway. Biochem Biophys Res Commun. 2002;290(1):249–255. doi: 10.1006/bbrc.2001.6188. [DOI] [PubMed] [Google Scholar]
  • 37.Greenberg NM, DeMayo F, Finegold MJ, Medina D, Tilley WD, Aspinall JO, Cunha GR, Donjacour AA, Matusik RJ, Rosen JM. Prostate cancer in a transgenic mouse. Proc Natl Acad Sci U S A. 1995;92(8):3439–3443. doi: 10.1073/pnas.92.8.3439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wu X, Wu J, Huang J, Powell WC, Zhang J, Matusik RJ, Sangiorgi FO, Maxson RE, Sucov HM, Roy-Burman P. Generation of a prostate epithelial cell-specific Cre transgenic mouse model for tissue-specific gene ablation. Mech Dev. 2001;101(1–2):61–69. doi: 10.1016/s0925-4773(00)00551-7. [DOI] [PubMed] [Google Scholar]
  • 39.Wang D, Wang H, Brown J, Daikoku T, Ning W, Shi Q, Richmond A, Strieter R, Dey SK, DuBois RN. CXCL1 induced by prostaglandin E2 promotes angiogenesis in colorectal cancer. J Exp Med. 2006;203(4):941–951. doi: 10.1084/jem.20052124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Knight BC, Kissane S, Falciani F, Salmon M, Stanford MR, Wallace GR. Expression analysis of immune response genes of Muller cells infected with Toxoplasma gondii. J Neuroimmunol. 2006;179(1–2):126–131. doi: 10.1016/j.jneuroim.2006.06.002. [DOI] [PubMed] [Google Scholar]
  • 41.Sawa Y, Tsuruga E. The expression of E-selectin and chemokines in the cultured human lymphatic endothelium with lipopolysaccharides. J Anat. 2008;212(5):654–663. doi: 10.1111/j.1469-7580.2008.00892.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Keller C, Keller P, Marshal S, Pedersen BK. IL-6 gene expression in human adipose tissue in response to exercise--effect of carbohydrate ingestion. J Physiol. 2003;550(Pt 3):927–931. doi: 10.1113/jphysiol.2003.044883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Shen F, Ruddy MJ, Plamondon P, Gaffen SL. Cytokines link osteoblasts and inflammation: microarray analysis of interleukin-17- and TNF-alpha-induced genes in bone cells. J Leukoc Biol. 2005;77(3):388–399. doi: 10.1189/jlb.0904490. [DOI] [PubMed] [Google Scholar]
  • 44.Shappell SB, Thomas GV, Roberts RL, Herbert R, Ittmann MM, Rubin MA, Humphrey PA, Sundberg JP, Rozengurt N, Barrios R, Ward JM, Cardiff RD. Prostate pathology of genetically engineered mice: definitions and classification. The consensus report from the Bar Harbor meeting of the Mouse Models of Human Cancer Consortium Prostate Pathology Committee. Cancer Res. 2004;64(6):2270–2305. doi: 10.1158/0008-5472.can-03-0946. [DOI] [PubMed] [Google Scholar]
  • 45.Johnson L, Mercer K, Greenbaum D, Bronson RT, Crowley D, Tuveson DA, Jacks T. Somatic activation of the K-ras oncogene causes early onset lung cancer in mice. Nature. 2001;410(6832):1111–1116. doi: 10.1038/35074129. [DOI] [PubMed] [Google Scholar]
  • 46.Ely LK, Fischer S, Garcia KC. Structural basis of receptor sharing by interleukin 17 cytokines. Nat Immunol. 2009;10(12):1245–1251. doi: 10.1038/ni.1813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gaffen SL. Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 2009;9(8):556–567. doi: 10.1038/nri2586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Vykhovanets EV, Maclennan GT, Vykhovanets OV, Gupta S. IL-17 Expression by macrophages is associated with proliferative inflammatory atrophy lesions in prostate cancer patients. Int J Clin Exp Pathol. 2011;4(6):552–565. [PMC free article] [PubMed] [Google Scholar]
  • 49.Tartour E, Fossiez F, Joyeux I, Galinha A, Gey A, Claret E, Sastre-Garau X, Couturier J, Mosseri V, Vives V, Banchereau J, Fridman WH, Wijdenes J, Lebecque S, Sautees-Fridman C. Interleukin 17, a T-cell-derived Cytokine, Promotes Tumorigenicity of Human Cervical Tumors in Nude Mice. Cancer Res. 1999;59(15):3698–3704. [PubMed] [Google Scholar]
  • 50.Numasaki M, Fukushi J-i, Ono M, Narula SK, Zavodny PJ, Kudo T, Robbins PD, Tahara H, Lotze MT. Interleukin-17 promotes angiogenesis and tumor growth. Blood. 2003;101(7):2620–2627. doi: 10.1182/blood-2002-05-1461. [DOI] [PubMed] [Google Scholar]
  • 51.Benchetrit F, Ciree A, Vives V, Warnier G, Gey A, Sautes-Fridman C, Fossiez F, Haicheur N, Fridman WH, Tartour E. Interleukin-17 inhibits tumor cell growth by means of a T-celldependent mechanism. Blood. 2002;99(6):2114–2121. doi: 10.1182/blood.v99.6.2114. [DOI] [PubMed] [Google Scholar]
  • 52.Hirahara N, Nio Y, Sasaki S, Minari Y, Takamura M, Iguchi C, Dong M, Yamasawa K, Tamura K. Inoculation of human interleukin-17 gene-transfected Meth-A fibrosarcoma cells induces T cell-dependent tumor-specific immunity in mice. Oncology. 2001;61(1):79–89. doi: 10.1159/000055357. [DOI] [PubMed] [Google Scholar]
  • 53.Lai T, Wang K, Hou Q, Zhang J, Yuan J, Yuan L, You Z, Xi M. Interleukin 17 Induces Up-Regulation of Chemokine and Cytokine Expression Via Activation of the Nuclear Factor kappaB and Extracellular Signal-Regulated Kinase 1/2 Pathways in Gynecologic Cancer Cell Lines. Int J Gynecol Cancer. 2011 doi: 10.1097/IGC.0b013e31822d2abd. [DOI] [PubMed] [Google Scholar]
  • 54.Dhawan P, Richmond A. Role of CXCL1 in tumorigenesis of melanoma. J Leukoc Biol. 2002;72(1):9–18. [PMC free article] [PubMed] [Google Scholar]
  • 55.Kawanishi H, Matsui Y, Ito M, Watanabe J, Takahashi T, Nishizawa K, Nishiyama H, Kamoto T, Mikami Y, Tanaka Y, Jung G, Akiyama H, Nobumasa H, Guilford P, Reeve A, Okuno Y, Tsujimoto G, Nakamura E, Ogawa O. Secreted CXCL1 is a potential mediator and marker of the tumor invasion of bladder cancer. Clin Cancer Res. 2008;14(9):2579–2587. doi: 10.1158/1078-0432.CCR-07-1922. [DOI] [PubMed] [Google Scholar]
  • 56.Kollmar O, Junker B, Rupertus K, Menger MD, Schilling MK. Studies on MIP-2 and CXCR2 expression in a mouse model of extrahepatic colorectal metastasis. Eur J Surg Oncol. 2007;33(6):803–811. doi: 10.1016/j.ejso.2007.01.012. [DOI] [PubMed] [Google Scholar]
  • 57.Li X, Loberg R, Liao J, Ying C, Snyder LA, Pienta KJ, McCauley LK. A destructive cascade mediated by CCL2 facilitates prostate cancer growth in bone. Cancer Res. 2009;69(4):1685–1692. doi: 10.1158/0008-5472.CAN-08-2164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Loberg RD, Day LL, Harwood J, Ying C, St John LN, Giles R, Neeley CK, Pienta KJ. CCL2 is a potent regulator of prostate cancer cell migration and proliferation. Neoplasia. 2006;8(7):578–586. doi: 10.1593/neo.06280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Colombatti M, Grasso S, Porzia A, Fracasso G, Scupoli MT, Cingarlini S, Poffe O, Naim HY, Heine M, Tridente G, Mainiero F, Ramarli D. The prostate specific membrane antigen regulates the expression of IL-6 and CCL5 in prostate tumour cells by activating the MAPK pathways. PLoS ONE. 2009;4(2):e4608. doi: 10.1371/journal.pone.0004608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Soria G, Ben-Baruch A. The inflammatory chemokines CCL2 and CCL5 in breast cancer. Cancer Lett. 2008;267(2):271–285. doi: 10.1016/j.canlet.2008.03.018. [DOI] [PubMed] [Google Scholar]
  • 61.Vaday GG, Peehl DM, Kadam PA, Lawrence DM. Expression of CCL5 (RANTES) and CCR5 in prostate cancer. Prostate. 2006;66(2):124–134. doi: 10.1002/pros.20306. [DOI] [PubMed] [Google Scholar]

RESOURCES