Abstract
Tembusu virus (TMUV) is an important emerging arthropod-borne virus that may cause encephalitis in humans and has been isolated in regions of southeast Asia, including Malaysia, Thailand, and China. Currently, detection and identification of TMUV are limited to research laboratories, because quantitative rapid diagnostic assays for the virus do not exist. We describe the development of sensitive and specific conventional and real-time quantitative reverse transcription polymerase chain reaction assays for detecting TMUV RNA in infected cell culture supernatant and Culex tarsalis mosquitoes. We used this assay to document the replication of TMUV in Cx. tarsalis, where titers increased 1,000-fold 5 days after inoculation. These assays resulted in the detection of virus-specific RNA in the presence of copurified mosquito nucleic acids. The use of these rapid diagnostic assays may have future applications for field pathogen surveillance and may assist in early detection, diagnosis, and control of the associated arthropod-borne pathogens.
Introduction
Throughout history, arthropod-transmitted pathogens have been an important cause of human disease. Members of the genus Flavivirus (family Flaviviridae), including Japanese encephalitis virus (JEV), West Nile (WNV), yellow fever (YFV), and dengue (DENV) viruses, are responsible for millions of clinical cases and tens of thousands of human deaths annually.1,2 Tembusu virus (TMUV; genus Flavivirus, family Flaviviridae), a member of the Ntaya serocomplex, was first isolated in 1955 from Culex tritaeniorhynchus mosquitoes in Kuala Lumpur, Malaysia,3 and it is responsible for severe disease in ducks in China.4 To date, little is known about TMUV; however, several recent reports indicate that TMUV and TMUV-like viruses have also been isolated in other regions of southeast Asia, including Thailand and China.5–13 Like other flaviviruses, TMUV is a linear, positive-sense, single-stranded RNA virus with a genome size of approximately 11 kb. Its RNA encodes 10 proteins, including three structural proteins—the capsid (C) protein, the membrane (M) protein, and the envelope (E) glycoprotein—and seven non-structural (NS) proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5).14
Current methods of detection and identification of TMUV include cell culture, enzyme immunoassay (EIA), reverse transcription polymerase chain reaction (RT-PCR), and nucleotide sequencing-based assays.15–18 To protect individuals in any given region of the world from the threat of vector-borne pathogens, we need to be able to rapidly and accurately identify arthropod-borne pathogens, and therefore, appropriate preventive measures can be taken to prevent morbidity and mortality associated with infection with these pathogens. Development of field-based real-time quantitative RT-PCR (qRT-PCR) assays for rapid detection of virus-infected mosquitoes would be a great assistance to preventive medicine and healthcare providers.
A major challenge in analyzing field-collected mosquitoes is that virus infection rates are often very low and require testing hundreds, if not thousands, of mosquito pools, each containing 25–50 mosquitoes. Therefore, qRT-PCR assays for the detection of viral RNA require specific primers and probes that can detect small amounts of viral RNA in the presence of significantly greater amounts of mosquito nucleic acids. In this study, we developed and evaluated specific conventional and qRT-PCR assays for detecting TMUV in infected cell culture supernatant and laboratory-infected mosquitoes.
Materials and Methods
Mosquito processing, RNA extraction, and cDNA synthesis.
Mosquitoes collected during a field study in two west central Thailand provinces (Lopburi and Kamphaeng Phet) from March 6 to March 18, 2011 were processed for virus detection as previously described.19 Briefly, pools containing 1–25 mosquitoes were placed in 1.5-mL microcentrifuge tubes containing one 4.5-mm copper bead and 0.75 mL cell culture media (Eagle's Minimum Essential Medium containing 10% heat-inactivated fetal bovine serum, 0.075% NaHCO3, 50 μg gentamicin, 100 units penicillin, and 100 μg streptomycin/mL). Tubes were vortexed for 5 minutes and then clarified by centrifugation (12,000 × g for 10 minutes at 4°C). We added 250 μL supernatant to a 1.5-mL microcentrifuge tube containing 750 μL TRIzol LS (Invitrogen, Carlsbad, CA) for RNA extraction, and the remainder of the supernatant was stored on dry ice or frozen at −70°C.
RNA extraction.
RNA was extracted as previously described,19 except that 1 μL GlycoBlue (Ambion Applied Biosystems, Austin, TX) was used during the RNA precipitation step. The RNA pellet was resuspended in 12 μL nuclease-free water and used immediately or stored at −70°C. First-strand cDNA synthesis was performed as previously described,19 except that 200 units Superscript III reverse transcriptase (Invitrogen) were used with 10 μL template RNA and 2 μL 50 ng/μL random hexamer.
RT-PCR amplification and gel electrophoresis.
Preliminary screening for flavivirus or TMUV nucleic acid, which was adapted from the work by O'Guinn and others,19 was performed by using puRe TaqReady-To-Go PCR beads (Amersham Biosciences, Piscataway, NJ) in a final volume of 25 μL containing 1–2 μL cDNA and 10 pmol each MA (forward) and cFD2 (reverse) primers20 or TMUVE1 forward/E1 reverse primers Table 1. Conventional PCR amplification was performed as follows: 95°C for 2 minutes, 35 cycles at 95°C for 30 seconds, 50°C (56°C for TMUV studies) for 30 seconds, and 72°C for 45 seconds followed by 72°C for 7 minutes. Agarose gel electrophoresis of the PCR products and DNA molecular weight marker was performed using 2% E-gel gels (Invitrogen) containing ethidium bromide. After electrophoresis, the PCR product bands were visualized using a transilluminator and recorded using a Polaroid camera (Polaroid, Waltham, MA) and 667 film or a BioRad Gel Doc (BioRad Life Sciences, Hercules, CA).
Table 1.
Conventional and real-time qRT-PCR primers and probe for detecting TMUV
| Primer name | Sequence (5′ → 3′) | Genomic position* |
|---|---|---|
| Conventional PCR primers (product = 439 bp) | ||
| TMUVE1Fwd | CGTGGCAAAACAGAGAGTCA | E (1556-1575) |
| TMUVE1Rev | GGAGGTTCCACCTCTACCATAATC | E (1971-1994) |
| qRT-PCR primers and probe (product = 82 bp) | ||
| TMUV-NS5F | GAGGCGTTGAAGGACTTGGA | NS5 (9080-9099) |
| TMUV-NS5R | GCGTACATGAGTCCTCCTTCTTT | NS5 (9139-9161) |
| TMUV-NS5P | 6FAM-ACGCAGCACATACCC-MGBNFQ | NS5 (9112-9126) |
Position based on Tembusu (MM1775) GenBank accession number JX477685.
Viruses.
Virus specimens were propagated in primary duck embryo, C6/36 (Aedes albopictus), or Vero (African green monkey kidney) cells to produce stock viruses for these studies. Cell culture supernatants were harvested, aliquoted, and stored at −70°C. For those viruses that produced plaques, viral titer was determined by standard plaque assay on Vero cells.
Development of Tembusu-specific conventional PCR primers.
Virus sequences, representing laboratory and field isolates, were aligned using the MegaAlign program (Lasergene analysis software; DNASTAR, Madison, WI) and compared with TMUV GenBank sequences (accession nos. AB110493, AB110495, and AF013409). After alignment of genomic sequences, the consensus sequence was imported into the LaserGene PrimerSelect program (Lasergene analysis software; DNASTAR), and selection of primers was determined based on the most ideal characteristics. The sequences of the TMUVE1 forward or TMUVE1 reverse primers and the base pair products of primer combinations are shown in Table 1 and Figure 1.
Figure 1.
Alignment of sequences comparing the primers and probe binding locations for (A) qRT-PCR and (B) conventional PCR. Field isolates were aligned to GenBank sequences to determine percent identities. The primer and probe nucleotide positions are based on TMUV strain MM1775 (JX477685).
Development of Tembusu-specific real-time primers and probes.
The TMUV NS5 gene was submitted to ABI Custom Assay Services (Foster City, CA) for primer and probe determination. The sequences of the TMUV-NS5 primers and probe determined by this approach are shown in Table 1 and Figure 1. A basic local alignment search tool (BLAST) search was used to conduct a preliminary assessment of oligonucleotide specificity.
One-step qRT-PCRs.
One-step qRT-PCRs were performed using the SuperScript III one-step RT-PCR system with platinum taq (Invitrogen) in a final volume of 20 μL containing 5 μL RNA, 10 μL 2× reaction buffer, additional 3 mM MgSO4, 5 μg bovine serum albumin (Roche, Pleasanton, CA), 1 μL each 18 μM forward and reverse primers, and 1 μL 5 μM probe. The above concentration of MgSO4 was determined to be optimal for this assay. The qRT-PCR assays were carried out using the Ruggedized Advanced Pathogen Identification Device (RAPID; Idaho Technology, Salt Lake City, UT) and the following cycling conditions: reverse transcription at 50°C for 15 minutes, denaturation at 95°C for 2 minutes, 40 cycles at 95°C for 15 seconds, and 60°C for 1 minute. The gain was set at four or eight for the TMUV-NS5 primer/probe set.
Mosquito infection.
Cx. tarsalis mosquitoes were reared in an insectary at 27°C and exposed to a light:dark cycle of 16:8 hours. Adult female mosquitoes were inoculated intrathoracically21 6–8 days after emergence with 0.3 μL 1:10 TMUV strain Thai-MLO305 viral suspension containing 0.9 log10 plaque-forming units (PFUs) per mosquito (4.4 log10 PFUs/mL) and incubated at 27°C with apple slices provided as a carbohydrate source. Five mosquitoes were collected and homogenized individually at 0, 12, 24, 36, 48, and 60 hours as well as 3, 4, 5, 7, 11, 14, 21, and 28 days after inoculation. Mosquito samples were triturated in 2 mL diluent, split into two 1-mL aliquots, and then stored at −70°C. The qRT-PCR assays using the TMUV-NS5 primers and probe were performed with the mosquito homogenates and used to determine the amount of virus present. Non-template control water and Cx. tarsalis RNA were included in all assays as negative controls (Ct values ≥ 36).
Results
Specificity of the conventional TMUV primer pair.
To determine the specificity of the TMUVE1 forward and TMUVE1 reverse primer set, we tested the primers against a variety of flaviviruses, including four DENV (serotypes 1, 2, 3, and 4), WNV, and JEV as well as several viruses isolated from field-collected mosquitoes (a Kamiti River-like virus and another insect flavivirus-like virus) and two additional strains of TMUV. A single band was visualized for TMUV strains Thai-JSL385 and Thai1986, whereas no PCR product was visualized for samples from any of the other flaviviruses (Figure 2 ). These results indicate that TMUVE1 forward and TMUVE1 reverse primers specifically detected TMUV but did not recognize related flaviviruses.
Figure 2.
Conventional PCR and specificity testing of TMUV TMUVE1 forward and TMUVE1 reverse primers against dengue-1 (D1; lane 2), dengue-2 (D2; lane 3), dengue-3 (D3; lane 4), dengue-4 (D4; lane 5), West Nile virus (WN; lane 6), JEV Thai2003-286 (lane 7), TMUV Thai-JSL385 (lane 8), Kamiti River-like Thai2003-215 (lane 9), JEV AFRIMS-D081-035/164 (lane 10), Chaoyang ROK144 (lane 11), and TMUV Thai1986 (lane 12). Agarose gel electrophoresis of the PCR products and DNA molecular weight marker (lane 1) was performed using 2% E-gel gels. Expected TMUVE1 forward and TMUVE1 reverse primer PCR product is 439 bps.
Sensitivity and specificity testing of qRT-PCR assay.
As indicated by the standard curve (Figure 3 ), there was a linear relationship between the Ct values determined by the qRT-PCR assay and serial 10-fold dilutions of TMUV RNA. In the evaluation of various dilutions of stock TMUV Table 2, the qRT-PCR was highly sensitive and able to detect < 1 PFU equivalent of TMUV. To test the specificity of the designed TMUV-NS5 qRT-PCR primer and probe, combinations of different templates, including two Thailand TMUV isolates and other known flaviviral RNAs, were tested using the qRT-PCR assay. Although the primers and probe readily detected the four strains of TMUV, including dilutions of up to 1:1,000,000 (< 1 PFU equivalent/mL), the TMUV-NS5 qRT-PCR primers and probe did not detect any of a variety of other flaviviruses, alphaviruses, or bunyaviruses (Table 3). TMUV strains Thai-MLO305 and Thai-JSL385 contained identical sequences in the NS5 primer and probe-binding regions and were used interchangeably during testing. This finding showed that TMUV-NS5 primers and probe could specifically detect TMUV, while not cross-reacting with other closely related flaviviruses.
Figure 3.
TMUV standard curve. Viral titer was determined by a standard plaque assay using Vero cells. The average Ct value (tested in duplicate) of 10-fold serial dilutions of TMUV RNA as determined by the NS5 qRT-PCR assay using the Thai-JSL385 strain of TMUV was plotted against the number of PFUs of virus present in the sample.
Table 2.
Sensitivity of RNA viral detection using qRT-PCR and TMUV-NS5 primers and probe for selected strains of TMUV
| Strain | PFU/mL | Dilution | |||
|---|---|---|---|---|---|
| Undiluted | 10-2 | 10-4 | 10-6 | ||
| Thai-MLO305 | 5.3 | 13.0* | 19.5 | 26.3 | 32.8 |
| Thai-MLO305 cDNA | Undiluted† | 13.7 | 21.6 | 28.4 | NT |
| AFRIMS-D099-014/161 | Undiluted | 14.0 | 21.2 | NT | NT |
NT, not tested.
Mean Ct value of duplicate tests of each sample.
These viruses did not plaque in cell culture but were tested as undiluted cell culture suspensions unless otherwise indicated.
Table 3.
Detection of viral RNA using qRT-PCR and TMUV-NS5 primers and probe
| Virus | Titer | ||
|---|---|---|---|
| Strain | PFU/mL* | Ct value | |
| Tembusu | Thai-MLO305 | 5.3 | 13.0 |
| Tembusu | AFRIMS-D099-014/161 | Undiluted† | 14.0 |
| Tembusu | Thai-93 | 3.6 | 26.7 |
| Tembusu | Thai-385 | Not tested | 20.9 |
| Tembusu | Thai-MLO305 cDNA | Undiluted† | 13.7 |
| Other members of the genus Flavivirus | |||
| Dengue-1 | HAW | 7.6 | > 36 |
| Dengue-2 | S16803 | 8.9 | > 36 |
| Dengue-3 | H87 | 5.1 | > 36 |
| Dengue-4 | H-421 | 5.6 | > 36 |
| Insect flavivirus‡ | IF568 | Undiluted† | > 36 |
| Japanese encephalitis | ROK-2.0221 | 5.6 | > 36 |
| Kamiti River-like‡ | Thai2003-215 | Undiluted† | > 36 |
| St. Louis encephalitis | Fort Washington | 5.6 | > 36 |
| West Nile | NY397-99 | 8.9 | > 36 |
| Yellow fever | Asibe | 3.6 | > 36 |
| Members of the genus Alphavirus | |||
| Chikungunya | Indo 23574 | 6.6 | > 36 |
| Getah | ROK-2.0017 | 6.2 | > 36 |
| Mucambo | PE-4.0904 | 6.0 | > 36 |
| O'nyong'nyong | Gulu | 6.1 | > 36 |
| Ross River | R-495 | 6.4 | > 36 |
| Sindbis | AR 339 | 5.6 | > 36 |
| Trocara | PE-7.0009 | 3.8 | > 36 |
| Venezuelan equine encephalitis | TC-83 | 6.1 | > 36 |
| Members of the family Bunyaviridae | |||
| Caraparu | PE-18.0572 | 3.9 | > 36 |
| Crimean Congo hemorrhagic fever | 10200 | 5.0 | > 36 |
| Itaqui | PE-0.0036 | 3.9 | > 36 |
| La Crosse | 97-WV-131 | 4.4 | > 36 |
| Murutucu | PE-1.0735 | 4.4 | > 36 |
| Rift Valley fever | ZH601 | 5.6 | > 36 |
Viral titers were determined in six-well plates of Vero cells.
These viruses do not plaque in cell culture but were tested as undiluted cell culture suspensions unless otherwise indicated.
IF568 was isolated from Cx. nigropunctatus from Thailand in April of 2008, and Thai2003-215 was isolated from Cx. gelidus from Thailand in February of 2003.
To examine intra-assay variability, we tested 37 specimens in duplicate. For each of these pairs, the Ct values were similar and differed by a mean of 0.14 (median = 0. 09) and an SD of 0.20 Ct units. To examine interassay variability, we tested the same specimen in duplicate on 5 separate days. Again, the assay was consistent with a mean Ct reading of 24.6, an SD of 0.12, and a total range of 24.44–24.75 Ct values for 10 specimens tested on 5 separate days. This finding indicates that the assay was consistent, with little intra- or interassay variability.
Replication of TMUV in mosquitoes.
We used the TMUV-NS5 primers and probe in a qRT-PCR assay to test each of the five Cx. tarsalis mosquitoes collected at each time point. These data were used to generate a viral replication curve for TMUV in Cx. tarsalis (Figure 4). Because Ct values are inversely related to the amount of RNA present, we plotted the mean observed Ct value subtracted from 36 (value for a negative specimen) as a measure of the amount of viral RNA present. After an initial eclipse phase, RNA titers rapidly rose, peaking at about 4 days after inoculation, and remained high until the conclusion of the experiment on day 28 after inoculation (Figure 4). Because the viral titers shown in Figure 3 were based on virus grown in Vero cells and the growth curve is for virus grown in a mosquito, the number of genomic copies per PFU is only an estimate.
Figure 4.
Replication of TMUV in Cx. tarsalis mosquitoes after intrathoracic inoculation. At each time point, five mosquitoes that had been inoculated with the Thai-MLO305 strain of TMUV were collected, homogenized individually, and tested using qRT-PCR for the TMUV-NS5 primers and probe. Viral titers were estimated based on the standard curve (Figure 3).
Discussion
We developed conventional and qRT-PCR assays for detecting TMUV in cell culture supernatant and laboratory-infected mosquitoes that were both specific and sensitive. Although TMUV was first isolated in 1955 in Malaysia3 and more recently, in regions of southeast Asia, including Thailand and China,5–13 relatively little is known about this virus. We developed conventional PCR primers specific for the TMUV envelope gene and tested the primer pair to determine the most ideal conditions for detection of TMUV RNA. Our results showed that the TMUVE1 forward and reverse primer set detected TMUV RNA in a virus-specific manner, while not detecting a variety of other flaviviruses.
The TMUV-NS5 primer and probe set was highly sensitive, in that it was able to detect TMUV RNA from several different isolates, including from dilutions containing < 1 PFU equivalents. It was also highly specific in that it did not react when tested with a variety of other flaviviruses, including four DENVs, WNV, JEV, YFV, and two insect flaviviruses. These results indicated the TMUV-NS5 primer and probe set is ideal for use as a rapid and specific assay for the detection of TMUV in both the laboratory and field settings.
TMUV has been isolated from a variety of Culex spp.,11,22 and Cx. vishnui are able to transmit this virus in the laboratory.13 The qRT-PCR developed here readily indicated that, after intrathoracic inoculation, there was a definite eclipse phase followed by rapid replication of TMUV in Cx. tarsalis. These data showed that the TMUV-NS5 qRT-PCR assay is quantitative, and it is an ideal assay for observing viral replication in laboratory-infected and field-collected mosquitoes. Additionally, the TMUV-NS5 qRT-PCR assay was tested in a field setting in Thailand in 2011. Although there were no positive isolates identified, the assay did not produce any false-positive results for 15 Culex spp. mosquito pools that were tested. Because TMUV is an emerging flavivirus that is currently circulating in several southeast Asian countries and may pose a potential future disease risk, the rapid and specific detection of TMUV RNA in mosquitoes will enable healthcare providers to improve methods for determining potential human health hazards, especially in field environment settings. We described the development of sensitive and specific conventional and qRT-PCR assays for detection of TMUV in field-collected mosquitoes that can be used to enhance surveillance efforts. Additionally, testing of these assays in regions with active TMUV circulation will better determine the effectiveness of these assays.
ACKNOWLEDGMENTS
The authors thank D. Nash (US Army Medical Research Institute of Infectious Diseases) for rearing mosquitoes for the laboratory studies, J. Adens, PhD (US Army Institute of Surgical Research) and Lorraine Farinick (US Army Medical Research Institute of Infectious Diseases) for statistics and graphing assistance, and K. Kenyon (US Army Medical Research Institute of Infectious Diseases) for her editorial suggestions.
Disclaimer: The mention of trade names or commercial products does not constitute endorsement or recommendation for use by the Department of the Army or the Department of Defense. The views of the authors do not necessarily reflect the position of the Department of Defense or the Department of the Army.
Footnotes
Financial support: This work was funded, in part, by Military Infectious Disease Research Program Project U0176_09_RD.
Authors' addresses: Lawrence N. Petz, Battlefield Pain Management Research Program, US Army Institute of Surgical Research, Fort Sam Houston, TX, E-mail: lawrence.n.petz.mil@mail.mil. Michael J. Turell and Susana Padilla, Virology Division, US Army Medical Research Institute of Infectious Diseases, Fort Detrick, MD, E-mails: michael.j.turell@us.army.mil and susana.padilla1@us.army.mil. Lewis S. Long and Vanessa R. Melanson, Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, MD, E-mails: lewis.s.long@us.army.mil and vanessa.melanson@us.army.mil. Drew D. Reinbold-Wasson, US Army Public Health Command, Aberdeen Proving Ground, MD, E-mail: Drew.reinbold@us.army.mil. Darci R. Smith, Department of Microbiology, Immunology and Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, CO, E-mail: darci.smith@colostate.edu. Monica L. O'Guinn, Military Infectious Diseases Research Program, US Army Medical Research and Materiel Command, Fort Detrick, MD, E-mail: monica.oguinn@us.army.mil. John S. Lee, Division of Entomology, Walter Reed Army Institute of Research, Silver Spring, MD, E-mail: john.s.lee13@gmail.com.
Reprint requests: Michael J. Turell, Virology Division, US Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, Frederick, MD 21702, E-mail: michael.j.turell@us.army.mil.
References
- 1.Schweitzer BK, Chapman NM, Iwen PC. Overview of the Flaviviridae with an emphasis on Japanese encephalitis group viruses. Lab Med. 2009;40:493–499. [Google Scholar]
- 2.Mackenzie JS, Gubler DJ, Petersen LR. Emerging flaviviruses: the spread and resurgence of Japanese encephalitis, West Nile and dengue viruses. Nat Med. 2004;10((12 Suppl)):S89–S109. doi: 10.1038/nm1144. [DOI] [PubMed] [Google Scholar]
- 3.US Army Medical Research Unit (Malaya) Institute for Medical Research, Federation of Malaya, Annual Report. Kuala Lampur, Malaya: 1957. pp. 100–103. [Google Scholar]
- 4.Cao Z, Zhang C, Liu Y, Liu Y, Ye W, Han J, Ma G, Zhang D, Xu F, Gao X, Tang Y, Shi S, Wan C, Zhang C, He B, Yang M, Lu X, Huang Y, Diao Y, Ma X, Zhang D. Tembusu virus in ducks, China. Emerg Infect Dis. 2011;17:1873–1875. doi: 10.3201/eid1710.101890. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Liu P, Lu H, Li S, Moureau G, Deng YQ, Wang Y, Zhang L, Jiang T, de Lamballerie X, Qin CF, Gould EA, Su J, Gao GF. Genomic and antigenic characterization of the newly emerging Chinese duck egg-drop syndrome flavivirus: genomic comparison with Tembusu and Sitiawan viruses. J Gen Virol. 2012;93:2158–2170. doi: 10.1099/vir.0.043554-0. [DOI] [PubMed] [Google Scholar]
- 6.Liu M, Chen S, Chen Y, Liu C, Chen S, Yin X, Li G, Zhanga Y. Adapted Tembusu-like virus in chickens and geese in China. J Clin Microbiol. 2012;50:2807–2809. doi: 10.1128/JCM.00655-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Yun T, Ye W, Ni Z, Zhang D, Zhang C. Identification and molecular characterization of a novel flavivirus isolated from Pekin ducklings in China. Vet Microbiol. 2012;157:311–319. doi: 10.1016/j.vetmic.2012.01.013. [DOI] [PubMed] [Google Scholar]
- 8.Yan P, Zhao Y, Zhang X, Xu D, Dai X, Teng Q, Yan L, Zhou J, Ji X, Zhang S, Liu G, Zhou Y, Kawaoka Y, Tong G, Li Z. An infectious disease of ducks caused by a newly emerged Tembusu virus strain in mainland China. Vir. 2011;417:1–8. doi: 10.1016/j.virol.2011.06.003. [DOI] [PubMed] [Google Scholar]
- 9.Su J, Li S, Hu X, Yu X, Wang Y, Liu P, Lu X, Zhang G, Hu X, Liu D, Li X, Su W, Lu H, Mok NS, Wang P, Wang M, Tian K, Gao GF. Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS One. 2011;6:e18106. doi: 10.1371/journal.pone.0018106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kono Y, Tsukamoto K, Abd Hamid M, Darus A, Lian TC, Sam LS, Yok CN, Di KB, Lim KT, Yamaguchi S, Narita M. Encephalitis and retarded growth of chicks caused by Sitiawan virus, a new isolate belonging to the genus flavivirus. Am J Trop Med Hyg. 2000;63:94–101. doi: 10.4269/ajtmh.2000.63.94. [DOI] [PubMed] [Google Scholar]
- 11.Pandey BD, Karabatsos N, Cropp B, Tagaki M, Tsuda Y, Ichinose A, Igarashi A. Identification of a flavivirus isolated from mosquitos in Chiang Mai Thailand. Southeast Asian J Trop Med Public Health. 1999;30:161–165. [PubMed] [Google Scholar]
- 12.Leake CJ, Ussery MA, Nisalak A, Hoke CH, Andre RG, Burke DS. Virus isolations from mosquitoes collected during the 1982 Japanese encephalitis epidemic in northern Thailand. Trans R Soc Trop Med Hyg. 1986;80:831–837. doi: 10.1016/0035-9203(86)90397-4. [DOI] [PubMed] [Google Scholar]
- 13.O'Guinn ML, Turell MJ, Kengluecha A, Jaichapor B, Jones J, Kankaew P, Miller RS, Coleman RE, Endy TP, Lee JS. Field detection of Tembusu virus in western Thailand by RT-PCR and vector competence determination of select Culex mosquitoes for transmission of the virus. Am J Trop Med Hyg. 2013;89:1023–1028. doi: 10.4269/ajtmh.13-0160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chambers TJ, Hahn CS, Galler R, Rice CM. Flavivirus genome organization, expression, and replication. Annu Rev Microbiol. 1990;44:649–688. doi: 10.1146/annurev.mi.44.100190.003245. [DOI] [PubMed] [Google Scholar]
- 15.Yun T, Nia Z, Hua J, Yea W, Chen L, Zhang S, Zhang Y, Zhang C. Development of a one-step real-time RT-PCR assay using a minor-groove-binding probe for the detection of duck Tembusu virus. J Virol Methods. 2012;181:148–154. doi: 10.1016/j.jviromet.2012.01.019. [DOI] [PubMed] [Google Scholar]
- 16.Yan L, Peng S, Yan P, Zhou J, Teng Q, Li G, Li X, Li Z. Comparison of real-time reverse transcription loop-mediated isothermal amplification and real-time reverse transcription polymerase chain reaction for duck Tembusu virus. J Virol Methods. 2012;182:50–55. doi: 10.1016/j.jviromet.2012.03.007. [DOI] [PubMed] [Google Scholar]
- 17.Wang Y, Yuan X, Li Y, Yu K, Yang J, Xu H, Zhang Y, Yu K, Liao M, Qin Z. Rapid detection of newly isolated Tembusu related flavivirus by reverse-transcription loop mediated isothermal amplification assay. Virol J. 2011;8:553–559. doi: 10.1186/1743-422X-8-553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yan L, Yan P, Zhou J, Teng Q, Li Z. Establishing a TaqMan-Based real-time PCR assay for the rapid detection and quantification of the newly emerged duck Tembusu virus. Virol J. 2011;8:464–470. doi: 10.1186/1743-422X-8-464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.O'Guinn ML, Lee JS, Kondig JP, Fernandez R, Carbajal F. Field detection of eastern equine encephalitis virus in the Amazon basin region of Peru using reverse transcription-polymerase chain reaction adapted for field identification of arthropod-borne pathogens. Am J Trop Med Hyg. 2004;70:164–171. [PubMed] [Google Scholar]
- 20.Kuno G. Universal diagnostic RT-PCR protocol for arboviruses. J Virol Methods. 1998;72:27–41. doi: 10.1016/s0166-0934(98)00003-2. [DOI] [PubMed] [Google Scholar]
- 21.Rosen L, Gubler D. The use of mosquitoes to detect and propagate dengue viruses. Am J Trop Med Hyg. 1974;23:1153–1160. doi: 10.4269/ajtmh.1974.23.1153. [DOI] [PubMed] [Google Scholar]
- 22.Platt GS, Way HJ, Bowen ET, Simpson DI, Hill MN, Kamath S, Bendell PJ, Heathcote OH. Arbovirus infections in Sarawak, October 1968–February 1970 Tembusu and Sindbis virus isolations from mosquitoes. Ann Trop Med Parasitol. 1975;69:65–71. doi: 10.1080/00034983.1975.11686984. [DOI] [PubMed] [Google Scholar]