Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2014 Oct;196(20):3556–3561. doi: 10.1128/JB.01981-14

Spermidine Biosynthesis and Transport Modulate Pneumococcal Autolysis

Adam J Potter 1, James C Paton 1,✉
PMCID: PMC4187697  PMID: 25092031

Abstract

Polyamines are small cationic molecules that have far-reaching roles in biology. In the case of pathogenic bacteria, these functions include those central to their pathogenesis. Streptococcus pneumoniae is a major bacterial pathogen, causing a diverse range of diseases that account for significant morbidity and mortality worldwide. In this work, we characterize the polyamine biosynthetic pathway of S. pneumoniae, demonstrating that this organism produces spermidine from arginine. The synthesis of spermidine was found to be nonessential for growth in a polyamine-free chemically defined medium. However, mutant strains lacking the ability to synthesize or transport spermidine displayed a significant delay in the onset of autolysis. We provide evidence for a model in which spermidine modulates the activity of the major autolysin LytA in the pneumococcal cell wall compartment via interactions with negatively charged molecules, such as teichoic acids.

INTRODUCTION

Polyamines are flexible hydrocarbon chains with multiple amine groups that are positively charged at neutral pH. These molecules are used by almost all cell types (prokaryotic and eukaryotic) and, due to their cationic properties, interact with negatively charged cellular constituents, including RNA, DNA, and proteins, to modulate various cell processes (1). Intracellular polyamines often exist as complexes with nucleic acids, stabilizing or causing structural changes in DNA and RNA that may influence protein synthesis or the activity of DNA binding proteins (2). An important role for polyamines in protecting cells from physiological stress also has been established. They are known to protect certain cells (including Escherichia coli) from oxidative stress by interacting directly with free radicals (3) and also are involved in the cellular response to acid stress (4). The roles of polyamines are not confined to the intracellular environment; they are also known to interact with cell envelopes. This may involve simple ionic interactions with anionic polysaccharides, proteins on the cell surface, or covalent interactions with peptidoglycan (5). While the specific function of many of these interactions is not completely understood, an important role for polyamines in modulating the activity of porins, transmembrane channels that allow the diffusion of hydrophilic compounds across the outer membrane of Gram-negative cells, has been established (6).

Putrescine, spermidine, spermine, and cadaverine are the most widely distributed cellular polyamines, and they are essential for normal multiplication of many prokaryotic and eukaryotic cells. The different lengths of the hydrocarbon backbone and number of amine groups result in differing physicochemical properties between these molecules. However, the relationship between structure and function of polyamines is not completely understood. Bacteria satisfy their need for polyamines through biosynthesis as well as uptake from the surrounding environment. Biosynthesis typically involves an initial decarboxylation of an amino acid, usually ornithine, arginine, or lysine. Different bacterial species utilize different pathways to synthesize polyamines, and the occurrence of the specific type of polyamine utilized varies considerably between species. Polyamine transport in bacteria typically involves the action of ABC (ATP-binding cassette) transporters or antiporters that are selective for specific molecules. Despite the fact that polyamines have been studied for many years, their far-reaching roles in biology have only recently been appreciated. For instance, an increasing number of studies demonstrate their importance in bacterial pathogenesis (reviewed in reference 7). The importance of polyamines in modulating bacterial biofilm formation also has become increasingly clear; they have been shown to influence biofilm formation in Neisseria gonorrhoeae (8), Bacillus subtilis (9), E. coli (10), Yersinia pestis (11), and Vibrio cholerae (12). The specific mechanisms by which polyamines influence these processes appear to be diverse, and in many cases they have yet to be elucidated.

Streptococcus pneumoniae (the pneumococcus) is a Gram-positive, human-adapted bacterial species that is frequently carried asymptomatically in the nasopharynx, but it also causes significant morbidity and mortality. Invasive diseases caused by the pneumococcus include meningitis, sepsis, and pneumonia, while noninvasive diseases include conjunctivitis, sinusitis, and otitis media. Despite the existence of relatively effective vaccines and antibiotic treatment options, this organism is a leading cause of death in children and in elderly and immunocompromised individuals worldwide (13). In spite of its known importance in many aspects of cell biology, as well as in biofilm formation and the pathogenesis of a number of bacterial species, relatively little is known about polyamine utilization or function in pneumococci. Although putative polyamine biosynthetic and transport systems have been identified in the pneumococcus and their importance in pathogenesis in the mouse model of infection has been established (14–16), the biosynthetic pathway for polyamine synthesis and the molecular function of these molecules in the pneumococcus has not been established. In the present work, we characterize the spermidine biosynthesis pathway of S. pneumoniae and show that this polyamine is involved in modulating pneumococcal autolysis.

MATERIALS AND METHODS

Strains and growth conditions.

S. pneumoniae virulent serotype 2 strain D39 was routinely cultured on Columbia blood agar base supplemented with 5% horse blood at 37°C and 5% CO2. Blood agar plates were supplemented with 0.2 μg/ml erythromycin or 100 μg/ml spectinomycin for the selection of mutant strains. Growth experiments of pneumococci in liquid culture were performed using a chemically defined medium (CDM) (17) supplemented with catalase (10 U/ml; Sigma) at 37°C.

Construction of mutant strains.

Genes were deleted from S. pneumoniae D39 and replaced with an erythromycin or spectinomycin resistance cassette by transformation with a linear DNA fragment constructed by overlap extension PCR (18) using the primers listed in Table 1. Generation of competent S. pneumoniae cells and subsequent transformation was performed as previously described (19).

TABLE 1.

Primers used in this study

Primer name Nucleotide sequence (5′–3′)
ery-F GAAGGAGTGATTACATGAACAA
ery-R CTCATAGAATTATTTCCTCCCG
spec-F GAGGAGGATATATATGAATACATA
spec-R TTATACCTTCTTCAATCTGTTATTT
casdh-F TCCTGAACTGGAACAAATCG
casdh-R CCAAACTGTTCTTCTACTGC
casdh-ery-F CGGGAGGAAATAATTCTATGAGTGGTTTGCCATGGGTTGTGG
casdh-ery-R TTGTTCATGTAATCACTCCTTCCTTTGAAATAGCAACTTGGGC
adc-F GAACAAATCGATCAGGACAG
adc-R AACCAAGACTGTCTCATCGC
adc-ery-F CGGGAGGAAATAATTCTATGAGAGAGGTCAATCATATCAACG
adc-ery-R TTGTTCATGTAATCACTCCTTCCTTGCGTAACTTCACCAAGG
spds-F ATGAGCGTCTTTCTTATCCG
spds-R TAGTGTTTGAGGGCATAAGC
spds-spec-F AAATAACAGATTGAAGAAGGTATAATGCCCAAGTATGTTGAGGAC
spds-spec-R TATGTATTCATATATATCCTCCTCGCTTGGCTGTTCTCAGAGAC
potD-F TCCTATCAGCCTTGATAGCG
potD-R CGTCAACTGGAAATGATCTCCG
potD-ery-F CGGGAGGAAATAATTCTATGAGATAGCGACCTCTTCCTACAG
potD-ery-R TTGTTCATGTAATCACTCCTTCGGATAATCGCTGCAATTCCTGC

Growth and autolysis assays.

Analysis of pneumococcal growth and autolysis was performed by growing cells in 96-well microtiter plates (200-μl culture volume) at 37°C and measuring the optical density (A600) at 30-min intervals over a 24-h time period using a Spectromax spectrophotomer (Molecular Devices). Reduction in A600 of cultures at the end of the logarithmic phase of growth was considered evidence of cellular autolysis.

HPLC analysis of cellular polyamines.

Cellular polyamines were identified using high-performance liquid chromatography (HPLC), essentially as described by Lee et al. (20). Cells (50 ml of late-exponential-phase culture) were harvested by centrifugation (6,000 × g, 20 min), washed three times in phosphate-buffered saline (PBS), resuspended in morpholinepropanesulfonic acid (MOPS) lysis buffer (100 mM MOPS, 50 mM NaCl, 20 mM MgCl2, pH 8.0), and subjected to three cycles of freeze-thawing. Trichloroacetic acid then was added to a final concentration of 10%, and the cells were incubated on ice for 5 min. The cell lysate was cleared by centrifugation (13,000 × g, 3 min), and the supernatant was stored at −20°C until analysis. Polyamines (5 μl of supernatant) were fluorescently labeled with an AccQ-fluor reagent kit (Waters) according to the manufacturer's instructions. For normalization, 1,8-diaminooctane was included as an internal standard. Labeled polyamines were separated on a Zorbax Eclipse Plus C18 column (5-μm volume; 100 Å; 250 by 4.6 mm; Agilent) using an Agilent 1100 series HPLC system with fluorescence detection (excitation, 248 nm; emission, 398 nm). The following gradient was run at a flow rate of 1 ml/min using solvent A (450 mM sodium acetate, 17 mM triethylamine, pH 4.75) and solvent B (60% acetonitrile, 0.01% acetone): 1 to 5 min, 0 to 20% B; 5 to 50 min, 20 to 50% B; 50 to 65 min, 50 to 100% B; 65 to 67 min, 100% B. Cadaverine, putrescine, spermidine, spermine, and the internal standard were clearly separated using this method, as confirmed using standards purchased from Sigma.

RESULTS

Characterization of the pneumococcal polyamine biosynthetic pathway.

Analysis of S. pneumoniae genome sequences reveals that this organism possesses a conserved operon of 6 genes with significant homology to known polyamine biosynthetic genes (Fig. 1A). The first gene of this operon (SPD0809 in strain D39 [21]) is annotated as encoding either lysine decarboxylase or arginine decarboxylase (ADC) in different pneumococcal serotypes. It has been suggested that the primary role of this gene product in pneumococci is the decarboxylation of lysine to cadaverine (14). However, given the location of this gene on the pneumococcal chromosome, we hypothesized that it plays an important role in spermidine biosynthesis via arginine decarboxylation. Pneumococci possess 4 genes (SPD0812-0815 in strain D39 [21]) (Fig. 1A) that constitute an alternate spermidine biosynthetic pathway recently characterized in Campylobacter jejuni (22). These gene products, agmatine deiminase (ADI), N-carbamoylputrescine amidohydrolase (NCPAH), carboxyspermidine dehydrogenase (CASDH), and carboxyspermidine decarboxylase (CASDC), represent a pathway for spermidine synthesis, as illustrated in Fig. 1B. CASDH and CASDC are thought to operate as an alternative pathway in spermidine synthesis from putrescine in organisms that lack the classical enzymes S-adenosylmethionine decarboxylase (AdoMetDC) and spermidine synthase (SPDS). Interestingly, pneumococci encode SPDS (SPD0811 in strain D39 [21]) (Fig. 1A) but not AdoMetDC, a situation shared by a number of other firmicutes (22).

FIG 1.

FIG 1

Polyamine biosynthesis in pneumococci. (A) Genetic organization of polyamine biosynthesis genes in strain D39. (B) Pathway for biosynthesis of spermidine from arginine. ADC, arginine decarboxylase; ADI, agmatine deiminase; NCPAH, N-carbamoylputrescine amidohydrolase; CASDH, carboxyspermidine dehydrogenase; CASDC, carboxyspermidine decarboxylase.

To experimentally confirm the putative pneumococcal polyamine biosynthetic pathway, illustrated in Fig. 1B, three mutant strains lacking the key enzymes ADC, CASDH, and SPDS were constructed. These mutants were designated D39adc, D39casdh, and D39spds, respectively. The effect of these mutations on the pneumococcal polyamine profile, when cultured in polyamine-free CDM, then was determined using HPLC. Spermidine was the only polyamine that could be detected in pneumococci under these conditions (Fig. 2A), and it could not be detected in mutant strains lacking ADC or CASDH (Fig. 2B and D). While spermidine could be detected in the mutant strain lacking SPDS, a marked reduction was evident compared to the level in wild-type pneumococci (Fig. 1C). Together, these results confirm the role of the SPD0809-0815 operon in spermidine biosynthesis in pneumococci.

FIG 2.

FIG 2

HPLC analysis of polyamines in pneumococci. Total cell extracts of S. pneumoniae D39 (A) and D39adc (B), D39spds (C), and D39casdh (D) mutants were analyzed for polyamine content by HPLC, as described in Materials and Methods. Spd, spermidine; IS, internal standard; R, fluorescent label.

Spermidine synthesis influences pneumococcal autolysis in vitro.

Polyamine biosynthesis is essential for the normal proliferation of many cell types, including E. coli (23). The successful culture of mutant strains lacking ADC, CASDH, or SPDS in polyamine-free CDM for HPLC analyses suggested that polyamines are not essential for pneumococcal growth. This was confirmed by measuring the growth kinetics of these strains, which was found to be identical to that of the wild-type parent (Fig. 3A). However, a significant delay in the onset of autolysis was observed in all three mutant strains (Fig. 3A). Pneumococcal autolysis is initiated primarily through the action of the murein hydrolase LytA (N-acetylmuramoyl l-alanine amidase) that specifically cleaves structural components of cell wall-associated peptidoglycan (24). Western blot analysis using polyclonal mouse anti-LytA revealed that there was no significant difference in the amount of LytA expressed by any of the three mutant strains compared to that of wild-type pneumococci (data not shown). The specific mechanism by which LytA is activated during the stationary phase of the growth cycle is not completely understood, but our results indicate that spermidine utilization plays a key role in modulating LytA activity.

FIG 3.

FIG 3

Growth and autolysis profiles of pneumococci. Wild-type D39 and the various polyamine biosynthetic mutant strains were cultured in CDM (A) or CDM supplemented with 20 mM MgCl2 (B) or 20 mM NaCl (C). Growth and autolysis was monitored by A600 measurement over 24 h. Points represent means from triplicate cultures, and Y error bars represent the standard deviations from the means.

Manipulating the ionic conditions of the growth medium mimic the effect of polyamines on pneumococcal autolysis.

We hypothesize that interactions between the cationic spermidine molecules and negatively charged compounds within the cell wall of pneumococci, such as teichoic acids and peptidoglycan, modulate the activity of LytA. The polyamine putrescine has been shown to be able to substitute for choline in the cell wall of pneumococci (25). Furthermore, the activity of murein hydrolases is thought to be modulated by a complex process involving interactions with teichoic acids and is dependent on the ionic conditions within the cell wall microenvironment (reviewed in reference 26). The polyanionic matrix of the Gram-positive cell wall has a high capacity for binding cations, particularly Mg2+ and Ca2+, and it has been shown that disturbing Mg2+ homeostasis through deletion of the gene encoding its transport promotes lysis of S. pneumoniae (27). In view of this, the effect of Mg2+ on the autolysis profiles of wild-type and mutant pneumococci was examined. Supplementing the growth media with an excess of MgCl2 (20 mM) did not affect the growth rate of any of the strains examined. However, autolysis was completely inhibited in all strains over the time period examined, such that no difference in phenotype between the three mutant strains and wild-type pneumococci was evident (Fig. 3B).

The incorporation of d-alanine residues into teichoic acids is important for modulating the properties of the cell wall in many Gram-positive species by reducing the negative charge of the cell envelope. Inhibition of d-alanylation in S. pneumoniae has been shown to result in increased susceptibility to cationic antimicrobial peptides (28), while in other species, such as Lactococcus lactis (29), it has been shown to result in increased autolysis. To investigate the impact of d-alanylation of teichoic acids on the autolysis phenotypes of wild-type and mutant pneumococci, cells were grown under physiological conditions known to inhibit d-alanine incorporation. High salt concentrations alter the structure of teichoic acids and prohibit d-alanylation (26). The supplementation of CDM with 20 mM NaCl was found to significantly increase the rate of autolysis of all strains, although the mutant strains still exhibited delayed autolysis compared with the wild-type parent (Fig. 3C). Together, these results illustrate that manipulating the ionic conditions of the growth environment can mimic the effect of spermidine on pneumococcal autolysis.

Spermidine transport influences pneumococcal autolysis.

Pneumococci also are known to encode an ABC-type polyamine transport system, potABCD, homologues of which have been shown to transport spermidine preferentially (30). Given that our results indicate a role for spermidine in the cell wall compartment of pneumococci, we were interested in determining if this transporter also was involved in modulating pneumococcal autolysis. A mutant strain lacking the substrate binding component (PotD) of this transporter was constructed. HPLC analysis revealed that this strain was able to synthesize spermidine at a level similar to that of the wild type (Fig. 4A). However, the onset of autolysis in this strain was delayed compared to that of wild-type pneumococci, although not to the same extent as one of the spermidine biosynthesis mutant strains (Fig. 4B). The effect of supplementing growth media with excess spermidine on the autolysis profiles of the three biosynthesis mutants and transport mutant strain also was determined. The addition of subinhibitory concentrations of spermidine (up to 2 mM) did not influence the rate of autolysis of any of the pneumococcal strains examined (data not shown). These data indicate that both synthesis and transport of spermidine across the membrane is essential for modulation of autolysis in pneumococci.

FIG 4.

FIG 4

Determination of polyamine content and growth/autolysis profile of a pneumococcal polyamine transport mutant strain. (A) The total cell extract of the D39potD mutant was analyzed for polyamine content by HPLC as described in Materials and Methods. (B) Wild-type D39 and the D39potD and D39spdS mutants were cultured in CDM. Growth and autolysis was monitored by A600 measurement over 24 h. Points represent the means from triplicate cultures, and Y error bars represent the standard deviations from the means.

DISCUSSION

Although the importance of polyamine biosynthesis and transport in pneumococcal pathogenesis has been known for a number of years (15, 16, 31), the precise molecular role of these molecules in this important bacterial pathogen has remained elusive. We have demonstrated that pneumococci encode enzymes for the synthesis of spermidine from arginine. This includes enzymes of the alternate spermidine biosynthesis pathway characterized in C. jejuni (22). Surprisingly, however, we found that the spermidine synthase enzyme (SPDS) also appears to be important for spermidine synthesis, despite the fact that pneumococci do not encode S-adenosylmethionine decarboxylase (AdoMetDC). It is accepted that decarboxylated S-adenosylmethionine is essential for the conversion of putrescine to spermidine by SPDS. Thus, the precise role of SPDS in pneumococcal spermidine biosynthesis is not clear, although it is interesting that a number of other firmicutes encode SPDS in the absence of AdoMetDC (22).

Numerous roles for polyamines in cell biology have been described. However, to our knowledge, this is the first report outlining a role for polyamines in the regulation of bacterial autolysis. Our data indicate that both the synthesis and transport of spermidine is required to potentiate autolysis, and we hypothesize that this occurs through modulation of LytA activity in the cell wall compartment. The PotABCD transport system typically has been considered to be involved in spermidine import in various bacterial species; however, our data indicate that it also is involved in its export. There is precedent for this assumption, with PotD of Synechocystis recently shown to be involved in both uptake and excretion of spermidine (32). While the pneumococcal potD mutant strain displayed a delay in the onset of autolysis, it was not as severe as the phenotype displayed by the spermidine biosynthesis mutant strains. This is suggestive of the presence of an alternate transporter with lower affinity for spermidine in pneumococci. Furthermore, the fact that exogenous spermidine cannot reverse the autolysis phenotype of the mutant strains is indicative of a complex process in which a transient flux of the polyamine out of the cell during a specific phase of growth is required to modulate autolysis.

We favor a model in which spermidine modulates autolysin activity in the pneumococcal cell wall in a manner analogous to that of the proton motive force first described in Bacillus subtilis (33) and later in Staphylococcus aureus (34). In this model, the respiring cell generates a proton gradient across the membrane that causes local acidification in the cell wall, reducing the activity of pH-sensitive autolysins. Collapse of the proton motive force from nutrient starvation or inhibition of respiration then leads to activation of autolysins during stationary phase. Since pneumococci do not possess a complete respiratory chain, the transport of cationic compounds such as spermidine across the membrane may be required to modulate autolysin activity. The fact that the spermidine-deficient pneumococcal mutants displayed delayed autolysis indicates that spermidine competes with other cations for anionic binding sites in the cell wall. The cell walls of mutant cells may contain a higher number of cations (or cations bound with a higher affinity) than wild-type cells, leading to enhanced suppression of autolysin activity. Indeed, our data illustrating the effect of high concentrations of Mg2+ in inhibiting pneumococcal autolysis tends to support this hypothesis. Additionally, protons have been shown to compete with metal cations for the anionic sites in the wall matrix of B. subtilis (35). It is also possible that spermidine utilization has an indirect effect in this respect by influencing the d-alanylation of teichoic acids. The degree of d-alanylation of Gram-positive cell walls is known to influence metal binding and affect autolysin activity. It seems clear, however, that modulation of autolysin activity is a complex process involving multiple layers of regulation. Thus, we suggest that spermidine-mediated regulation works in conjunction with d-alanylation to modulate autolysin activity in pneumococci.

Although our data, when viewed in conjunction with the established literature on the regulation of autolysin activity, supports the model described above, we cannot discount the possibility that spermidine utilization influences the targeting of autolysin to the cell wall. Choline-substituted teichoic acids are established as being essential for the targeting of LytA to the pneumococcal cell wall, so it is conceivable that spermidine influences this process through modulation of choline incorporation. This is particularly worthy of consideration given that the polyamine putrescine has been shown to be able to substitute for choline in the pneumococcal cell wall (25). It is clear that further work needs to be done to confirm the precise mechanism whereby spermidine utilization influences pneumococcal autolysis and if this phenomenon occurs in other bacterial species.

Autolysis is known to play an important role in pneumococcal pathogenesis (36), but specifically how this occurs is not clear. LytA may mediate lysis to release other virulence factors, such as pneumolysin (37), or release proteins involved in immune evasion or cell wall components that may modulate the host innate immune response (38). Another theory suggests that murein hydrolases are released to lyse neighboring noncompetent pneumococcal cells in a fratricidal manner, facilitating genetic exchange between naturally competent pneumococcal populations (39). The effect of spermidine utilization on autolysis demonstrated here may explain the previously characterized importance of polyamine biosynthetic and transport genes for pneumococcal colonization and pneumonia in the murine model of infection (14).

However, our results also suggest that there is a significant range of additional roles for spermidine in pneumococci. These might include modulating the trafficking of ions and nutrients between the extracellular environment and the cell membrane, influencing the activity of other choline binding proteins within the cell wall compartment, or resistance to host-derived cationic antimicrobial compounds. Investigating these potential roles represent an important aim for future research.

ACKNOWLEDGMENTS

This research was funded by program grant 565526 and project grant 627142 from the National Health and Medical Research Council (NHMRC) of Australia. J.C.P. is an NHMRC Senior Principal Research Fellow.

Footnotes

Published ahead of print 4 August 2014

REFERENCES

  • 1.Igarashi K, Kashiwagi K. 2000. Polyamines: mysterious modulators of cellular functions. Biochem. Biophys. Res. Commun. 271:559–564. 10.1006/bbrc.2000.2601 [DOI] [PubMed] [Google Scholar]
  • 2.Wortham BW, Patel CN, Oliveira MA. 2007. Polyamines in bacteria: pleiotropic effects yet specific mechanisms. Adv. Exp. Med. Biol. 603:106–115. 10.1007/978-0-387-72124-8_9 [DOI] [PubMed] [Google Scholar]
  • 3.Chattopadhyay MK, Tabor CW, Tabor H. 2003. Polyamines protect Escherichia coli cells from the toxic effect of oxygen. Proc. Natl. Acad. Sci. U. S. A. 100:2261–2265. 10.1073/pnas.2627990100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lee YH, Kim BH, Kim JH, Yoon WS, Bang SH, Park YK. 2007. CadC has a global translational effect during acid adaptation in Salmonella enterica serovar Typhimurium. J. Bacteriol. 189:2417–2425. 10.1128/JB.01277-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Koski P, Vaara M. 1991. Polyamines as constituents of the outer membranes of Escherichia coli and Salmonella typhimurium. J. Bacteriol. 173:3695–3699 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Iyer R, Wu Z, Woster PM, Delcour AH. 2000. Molecular basis for the polyamine-ompF porin interactions: inhibitor and mutant studies. J. Mol. Biol. 297:933–945. 10.1006/jmbi.2000.3599 [DOI] [PubMed] [Google Scholar]
  • 7.Shah P, Swiatlo E. 2008. A multifaceted role for polyamines in bacterial pathogens. Mol. Microbiol. 68:4–16. 10.1111/j.1365-2958.2008.06126.x [DOI] [PubMed] [Google Scholar]
  • 8.Goytia M, Dhulipala VL, Shafer WM. 2013. Spermine impairs biofilm formation by Neisseria gonorrhoeae. FEMS Microbiol. Lett. 343:64–69. 10.1111/1574-6968.12130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Burrell M, Hanfrey CC, Murray EJ, Stanley-Wall NR, Michael AJ. 2010. Evolution and multiplicity of arginine decarboxylases in polyamine biosynthesis and essential role in Bacillus subtilis biofilm formation. J. Biol. Chem. 285:39224–39238. 10.1074/jbc.M110.163154 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sakamoto A, Terui Y, Yamamoto T, Kasahara T, Nakamura M, Tomitori H, Yamamoto K, Ishihama A, Michael AJ, Igarashi K, Kashiwagi K. 2012. Enhanced biofilm formation and/or cell viability by polyamines through stimulation of response regulators UvrY and CpxR in the two-component signal transducing systems, and ribosome recycling factor. Int. J. Biochem. Cell Biol. 44:1877–1886. 10.1016/j.biocel.2012.07.010 [DOI] [PubMed] [Google Scholar]
  • 11.Patel CN, Wortham BW, Lines JL, Fetherston JD, Perry RD, Oliveira MA. 2006. Polyamines are essential for the formation of plague biofilm. J. Bacteriol. 188:2355–2363. 10.1128/JB.188.7.2355-2363.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Karatan E, Duncan TR, Watnick PI. 2005. NspS, a predicted polyamine sensor, mediates activation of Vibrio cholerae biofilm formation by norspermidine. J. Bacteriol. 187:7434–7443. 10.1128/JB.187.21.7434-7443.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Black RE, Cousens S, Johnson HL, Lawn JE, Rudan I, Bassani DG, Jha P, Campbell H, Walker CF, Cibulskis R, Eisele T, Liu L, Mathers C, Child Health Epidemiology Reference Group of UNICEF and WHO 2010. Global, regional, and national causes of child mortality in 2008: a systematic analysis. Lancet 375:1969–1987. 10.1016/S0140-6736(10)60549-1 [DOI] [PubMed] [Google Scholar]
  • 14.Shah P, Nanduri B, Swiatlo E, Ma Y, Pendarvis K. 2011. Polyamine biosynthesis and transport mechanisms are crucial for fitness and pathogenesis of Streptococcus pneumoniae. Microbiology 157:504–515. 10.1099/mic.0.042564-0 [DOI] [PubMed] [Google Scholar]
  • 15.Shah P, Romero DG, Swiatlo E. 2008. Role of polyamine transport in Streptococcus pneumoniae response to physiological stress and murine septicemia. Microb. Pathog. 45:167–172. 10.1016/j.micpath.2008.05.001 [DOI] [PubMed] [Google Scholar]
  • 16.Ware D, Jiang Y, Lin W, Swiatlo E. 2006. Involvement of potD in Streptococcus pneumoniae polyamine transport and pathogenesis. Infect. Immun. 74:352–361. 10.1128/IAI.74.1.352-361.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kloosterman TG, Bijlsma JJ, Kok J, Kuipers OP. 2006. To have neighbour's fare: extending the molecular toolbox for Streptococcus pneumoniae. Microbiology 152:351–359. 10.1099/mic.0.28521-0 [DOI] [PubMed] [Google Scholar]
  • 18.Horton RM, Ho SN, Pullen JK, Hunt HD, Cai ZL, Pease LR. 1993. Gene-splicing by overlap extension. Methods Enzymol. 217:270–279. 10.1016/0076-6879(93)17067-F [DOI] [PubMed] [Google Scholar]
  • 19.Pozzi G, Masala L, Iannelli F, Manganelli R, Havarstein LS, Piccoli L, Simon D, Morrison DA. 1996. Competence for genetic transformation in encapsulated strains of Streptococcus pneumoniae: two allelic variants of the peptide pheromone. J. Bacteriol. 178:6087–6090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lee J, Sperandio V, Frantz DE, Longgood J, Camilli A, Phillips MA, Michael AJ. 2009. An alternative polyamine biosynthetic pathway is widespread in bacteria and essential for biofilm formation in Vibrio cholerae. J. Biol. Chem. 284:9899–9907. 10.1074/jbc.M900110200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lanie JA, Ng WL, Kazmierczak KM, Andrzejewski TM, Davidsen TM, Wayne KJ, Tettelin H, Glass JI, Winkler ME. 2007. Genome sequence of Avery's virulent serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6. J. Bacteriol. 189:38–51. 10.1128/JB.01148-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hanfrey CC, Pearson BM, Hazeldine S, Lee J, Gaskin DJ, Woster PM, Phillips MA, Michael AJ. 2011. Alternative spermidine biosynthetic route is critical for growth of Campylobacter jejuni and is the dominant polyamine pathway in human gut microbiota. J. Biol. Chem. 286:43301–43312. 10.1074/jbc.M111.307835 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chattopadhyay MK, Tabor CW, Tabor H. 2009. Polyamines are not required for aerobic growth of Escherichia coli: preparation of a strain with deletions in all of the genes for polyamine biosynthesis. J. Bacteriol. 191:5549–5552. 10.1128/JB.00381-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mellroth P, Daniels R, Eberhardt A, Ronnlund D, Blom H, Widengren J, Normark S, Henriques-Normark B. 2012. LytA, major autolysin of Streptococcus pneumoniae, requires access to nascent peptidoglycan. J. Biol. Chem. 287:11018–11029. 10.1074/jbc.M111.318584 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ware D, Watt J, Swiatlo E. 2005. Utilization of putrescine by Streptococcus pneumoniae during growth in choline-limited medium. J. Microbiol. 43:398–405 [PubMed] [Google Scholar]
  • 26.Neuhaus FC, Baddiley J. 2003. A continuum of anionic charge: structures and functions of D-alanyl-teichoic acids in gram-positive bacteria. Microbiol. Mol. Biol. Rev. 67:686–723. 10.1128/MMBR.67.4.686-723.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Neef J, Andisi VF, Kim KS, Kuipers OP, Bijlsma JJ. 2011. Deletion of a cation transporter promotes lysis in Streptococcus pneumoniae. Infect. Immun. 79:2314–2323. 10.1128/IAI.00677-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kovacs M, Halfmann A, Fedtke I, Heintz M, Peschel A, Vollmer W, Hakenbeck R, Bruckner R. 2006. A functional dlt operon, encoding proteins required for incorporation of D-alanine in teichoic acids in Gram-positive bacteria, confers resistance to cationic antimicrobial peptides in Streptococcus pneumoniae. J. Bacteriol. 188:5797–5805. 10.1128/JB.00336-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Steen A, Palumbo E, Deghorain M, Cocconcelli PS, Delcour J, Kuipers OP, Kok J, Buist G, Hols P. 2005. Autolysis of Lactococcus lactis is increased upon D-alanine depletion of peptidoglycan and lipoteichoic acids. J. Bacteriol. 187:114–124. 10.1128/JB.187.1.114-124.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Igarashi K, Kashiwagi K. 2010. Characteristics of cellular polyamine transport in prokaryotes and eukaryotes. Plant Physiol. Biochem. 48:506–512. 10.1016/j.plaphy.2010.01.017 [DOI] [PubMed] [Google Scholar]
  • 31.Shah P, Swiatlo E. 2006. Immunization with polyamine transport protein PotD protects mice against systemic infection with Streptococcus pneumoniae. Infect. Immun. 74:5888–5892. 10.1128/IAI.00553-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yodsang P, Pothipongsa A, Maenpaa P, Incharoensakdi A. 16 May 2014. Involvement of polyamine binding protein D (PotD) of Synechocystis sp. PCC 6803 in spermidine uptake and excretion. Curr. Microbiol. 10.1007/s00284-014-0605-9 [DOI] [PubMed] [Google Scholar]
  • 33.Jolliffe LK, Doyle RJ, Streips UN. 1981. The energized membrane and cellular autolysis in Bacillus subtilis. Cell 25:753–763. 10.1016/0092-8674(81)90183-5 [DOI] [PubMed] [Google Scholar]
  • 34.Biswas R, Martinez RE, Gohring N, Schlag M, Josten M, Xia GQ, Hegler F, Gekeler C, Gleske AK, Gotz F, Sahl HG, Kappler A, Peschel A. 2012. Proton-binding capacity of Staphylococcus aureus wall teichoic acid and its role in controlling autolysin activity. PLoS One 7:e41415. 10.1371/journal.pone.0041415 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Urrutia Mera M, Kemper M, Doyle R, Beveridge TJ. 1992. The membrane-induced proton motive force influences the metal binding ability of Bacillus subtilis cell walls. Appl. Environ. Microbiol. 58:3837–3844 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Berry AM, Paton JC. 2000. Additive attenuation of virulence of Streptococcus pneumoniae by mutation of the genes encoding pneumolysin and other putative pneumococcal virulence proteins. Infect. Immun. 68:133–140. 10.1128/IAI.68.1.133-140.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Martner A, Dahlgren C, Paton JC, Wold AE. 2008. Pneumolysin released during Streptococcus pneumoniae autolysis is a potent activator of intracellular oxygen radical production in neutrophils. Infect. Immun. 76:4079–4087. 10.1128/IAI.01747-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Martner A, Skovbjerg S, Paton JC, Wold AE. 2009. Streptococcus pneumoniae autolysis prevents phagocytosis and production of phagocyte-activating cytokines. Infect. Immun. 77:3826–3837. 10.1128/IAI.00290-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Eldholm V, Johnsborg O, Haugen K, Ohnstad HS, Havarstein LS. 2009. Fratricide in Streptococcus pneumoniae: contributions and role of the cell wall hydrolases CbpD, LytA and LytC. Microbiology 155:2223–2234. 10.1099/mic.0.026328-0 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES