Skip to main content
NCBI home page
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2014 Oct;34(19):3630–3641. doi: 10.1128/MCB.00243-14

Methylation by NSun2 Represses the Levels and Function of MicroRNA 125b

Shuai Yuan a, Hao Tang a, Junyue Xing a, Xiuqin Fan a, Xiaoyu Cai a, Qiu Li a, Pei Han a, Yuhong Luo b, Zhuojun Zhang a, Bin Jiang a, Yali Dou c, Myriam Gorospe d, Wengong Wang a,✉
PMCID: PMC4187725  PMID: 25047833

Abstract

Methylation is a prevalent posttranscriptional modification of RNAs. However, whether mammalian microRNAs are methylated is unknown. Here, we show that the tRNA methyltransferase NSun2 methylates primary (pri-miR-125b), precursor (pre-miR-125b), and mature microRNA 125b (miR-125b) in vitro and in vivo. Methylation by NSun2 inhibits the processing of pri-miR-125b2 into pre-miR-125b2, decreases the cleavage of pre-miR-125b2 into miR-125, and attenuates the recruitment of RISC by miR-125, thereby repressing the function of miR-125b in silencing gene expression. Our results highlight the impact of miR-125b function via methylation by NSun2.

INTRODUCTION

Methylation is a prevalent modification of almost all species of RNAs. The methylation of tRNA, rRNA, and the mRNA 5′ cap has been intensively studied (1, 2, 3). In recent years, studies have demonstrated that small RNAs such as piwi RNAs, Drosophila small interfering RNAs (siRNAs), and plant microRNAs (miRNAs) are also methylated (4–8). Methylation of RNAs regulates faithful ribosomal decoding (9), ribosome assembly (10), ribosomal recycling and accuracy of translation initiation (11, 12), stability of small RNAs and tRNAs (2, 7), and biogenesis or processing of small RNAs (7, 9).

NSun2 (NOP2/Sun domain family, member 2; Myc-induced SUN domain-containing protein, Misu) is a nucleolar RNA methyltransferase implicated in cell proliferation (13, 14), stem cell differentiation (15), testis differentiation (16), and human cancers (13, 17). Although tRNA is a typical methylation substrate for NSun2 (13, 18), observations that NSun2 was expressed highly in cancers as well as in the S phase of the cell cycle (13, 14) suggested that NSun2 may methylate targets other than tRNA. Indeed, NSun2 was found to methylate the 3′ untranslated region (UTR) of p16 mRNA. The methylation of the p16 3′ UTR prevented the mobilization of p16 mRNA into processing bodies, was linked to the stabilization of p16 mRNA, and impacted the elevation of p16 under oxidative stress (19). Recent studies indicate that methylation of the vault noncoding RNA by NSun2 was crucial for the faithful processing of vault RNAs into Argonaute-associated small RNA fragments (20). However, whether NSun2 methylates mammalian microRNAs is unknown.

Here, we show that NSun2 methylates microRNA 125b (miR-125b) at primary (pri-miR-125b), precursor (pre-miR-125b), and mature levels in vitro and in vivo. Methylation by NSun2 represses the processing of miR-125b and the recruitment of RISC (RNA-induced silencing complex) by miR-125b, in turn affecting the expression of miR-125b-regulated mRNAs. We present evidence that this regulatory mechanism impacts the processing and gene silencing function of miR-125b in response to oxidative stress conditions.

MATERIALS AND METHODS

Cell culture, transfection, and treatment.

HeLa cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum, 100 units/ml of penicillin, and 100 μg/ml of streptomycin at 37°C in 5% CO2. Human IDH4 fibroblasts were generously provided by J. W. Shay and were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 units/ml of penicillin, 100 μg/ml of streptomycin, and dexamethasone (1 μg/ml) for constitutive expression of simian virus 40 (SV40) large T antigen to suppress senescence and stimulate proliferation. All plasmid transfections (2 μg/ml) were performed using Lipofectamine 2000 (Invitrogen) by following the manufacturer's instructions. Unless otherwise indicated, cells were collected for analysis 48 h after transfection. For treatment of cells with H2O2, 50% to 60% confluent cells were exposed to 50 μM H2O2 (AMRESCO, OH) for 24 h and collected for further experiments.

Antibodies and Western blot analysis.

Whole-cell and cytoplasmic extracts were prepared as described previously (19). Western blot analysis was performed using standard procedures. Polyclonal anti-ErbB2 and polyclonal anti-Bak1 were from Bioworld Technologies (Beijing, China); polyclonal anti-E2F3 was from Bioss Biotechnologies (Beijing China); monoclonal anti-CDC25C, polyclonal anti-ppp1ca, monoclonal anti-p53, monoclonal anti-Drosha, and monoclonal anti-Dicer were from Santa Cruz Biotechnologies; and polyclonal anti-NSun2 and monoclonal anti-glyceraldehyde-3-phosphate dehydrogenase (anti-GAPDH) were from Abcam. Monoclonal anti-Ago2 was from Medical and Biological Laboratories (MBL). The polyclonal anti-N6-methyladenosine (anti-m6A) antibody was from Synaptic Systems (Goettingen, Germany).

Constructs and reporter gene assays.

For the construction of pcDNA 3.1 vectors expressing pre-miR-125b1, pre-miR-125b2, and pre-miR-125b2Δ2, pri-miR-125b1 (552-nucleotide [nt]) and pri-miR-125b2 (591-nt) fragments were amplified by PCR using the following primer pairs: CGCGGATCCCGTATGTGTATGTGCGTGATT and CCGCTCGAGACCAGGCAGATGAGTTCCA for pri-miR-125b1 and CGCGGATCCGGTCGTCGTGATTACTCAGC and CCGCTCGAGTTGCTTCTTACACAGGTTTCTTAT for pri-miR-125b2. pri-miR-125b2 inserts containing mutated methylation sites were generated by overlapping PCR. These PCR fragments then were inserted between the BamHI and XhoI sites of pcDNA 3.1 vector (Clontech). The pcDNA 3.1 vector expressing NSun2 was described previously (19).

For construction of pGL3-derived reporter vectors bearing the long or short 3′ UTR fragments of p53, E2F3, Bak1, ErbB2, CDC25C, and ppp1ca, the original pmirGLO vector (Promega) was modified by digestion with XhoI and XbaI and insertion of a double-stranded DNA fragment (TCGAGGGATTTCCATATGGCCGGAATTCCGGATCGATCGAT and CTAGATCGATCGATCCGGAATTCCGGCCATATGGAAATCCC) which introduced an EcoRI site. The long 3′ UTR of p53, E2F3, Bak1, ErbB2, CDC25C, and ppp1ca fragments were amplified by using the following primer pairs: GGGATGTTTGGGAGATGTAAG and GCTCTAGAGCAAAGATGTTGACCCTTCCAG for p53, CCGCTCGAGCGGTTGGAAAGGAGAACCAGG and CGGAATTCCGGAAATGCCACTCACACAATG for E2F3, CCGCTCGAGCGGGAAGATCAGCACCCTAAG and CGGAATTCCGCTTGGAGGCTTCTGACAC for Bak1, GCTCTAGAGCACCAGAAGGC CAAG and GCTCTAGAGCTCATCTTTAAAAAAAC for ErbB2, CCGCTCGAGTAACATTCCACCACTGGCTGCT and CGGAATTCGAAGGTAGACAACGCTCTTGCAT for CDC25C, and CCGCTCGAGCCCCCGCACCACCCTGTGCC and CGGAATTCCAAGAGACCAGATGGGTTGC for ppp1ca. To generate the long 3′ UTR fragments, mutation of the miR-125b recognition elements by overlapping PCR was carried out using these primer pairs: CACCAAGACTTGTTTTATGCAGTGGGTCAATTT and ACTGCATAAAACAAGTCTTGGTGGATCCAGATC for p53, CCTTTGCAGTTGGACTCTCACCCATTCTGGGCT and GGGTGAGAGTCCAACTGCAAAGGCAGTATGGCC for Bak1, GCTCTCTTACACCGCACTCACCCAGACCACTTC and GGGTGAGTGCGGTGTAAGAGAGCCCTTTCCCCT for E2F3, GAAGCCCTGATGTGTCCTCACCCAGCAGGGAAG and GGGTGAGGACACATCAGGGCTTCTGCGGACTTG for ErbB2, TAGAGATTTGTATTGGTTCACCCAACTCTGGCA and GGGTGAACCAATACAAATCTCTATGCAACTCAA for CDC25C, and GGGGCCGAGGCTGCAGCTCACCCCAACGGCAGG and GGGTGAGCTGCAGCCTCGGCCCCAGGATCCTGC for ppp1ca. To generate the short 3′ UTR fragments of p53, E2F3, Bak1, ErbB2, CDC25C, and ppp1ca, we used the following DNA fragment pairs: TCGAGTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCTCAGGGTCAATG and AATTCATTGACCCTGAGCATAAAACAAGTCTTGGTGGATCCAGATCATCATATACAAGAC for p53, TCGAGTGTGACAGGGGAAAGGGCTCTCTTACACCGCACTCAGGGAGACCACTTCTCAGGG and AATTCCCTGAGAAGTGGTCTCCCTGAGTGCGGTGTAAGAGAGCCCTTTCCCCTGTCACAC for E2F3, TCGAGTCCCTCCGGCCATACTGCCTTTGCAGTTGGACTCTCAGGGATTCTGGGCTTGGGG and AATTCCCCAAGCCCAGAATCCCTGAGAGTCCAACTGCAAAGGCAGTATGGCCGGAGGGAC for Bak1, TCGAGGCCAAGTCCGCAGAAGCCCTGATGTGTCCTCAGGGAGCAGGGAAGGCCTGACTTG and AATTCAAGTCAGGCCTTCCCTGATCCCTGAGGACACATCAGGGCTTCTGCGGACTTGGCC for ErbB2, TCGAGCAGCCTTGAGTTGCATAAGAGATTTGTATTGGTTCAGGGAACTCTGGCATTCCTG and AATTCAGGAATGCCAGAGTTCCCTGAACCAATACAAATCTCTATGCAACTCAAGGCTGCC for CDC25C, and TCGAGTGTGAGCAGGATCCTGGGGCCGAGGCTGCAGCTCAGGGCG and AATTCACCTGGCCTGCCGTTGCCCTGAGCTGCAGCCTCGGCCCCAGGATCCTGCTCACAC for ppp1ca. To generate the short 3′ UTR fragments of p53, E2F3, Bak1, ErbB2, CDC25C, and ppp1ca mutating the miR-125b recognition elements, we synthesized the following DNA fragment pairs: TCGAGTCTTGTATATGATGATCTGGATCCACCAAGACTTGTTTTATGCCCGTAGTCAATG and AATTCATTGACTACGGGCATAAAACAAGTCTTGGTGGATCCAGATCATCATATACAAGAC for p53, TCGAGTGTGACAGGGGAAAGGGCTCTCTTACACCGCACCCGTAGAGACCACTTCTCAGGG and AATTCCCTGAGAAGTGGTCTCTACGGGTGCGGTGTAAGAGAGCCCTTTCCCCTGTCACAC for E2F3, TCGAGTCCCTCCGGCCATACTGCCTTTGCAGTTGGACTCCCGTAGATTCTGGGCTTGGGG and AATTCCCCAAGCCCAGAATCTACGGGAGTCCAACTGCAAAGGCAGTATGGCCGGAGGGAC for Bak1, TCGAGGCCAAGTCCGCAGAAGCCCTGATGTGTCCCCGTAGAGCAGGGAAGGCCTGACTTG and AATTCAAGTCAGGCCTTCCCTGATCTACGGGGACACATCAGGGCTTCTGCGGACTTGGCC for ErbB2, TCGAGGCAGCCTTGAGTTGCATAGAGATTTGTATTGGTCCGTAGAACTCTGGCATTCCTG and AATTCAGGAATGCCAGAGTTCTACGGACCAATACAAATCTCTATGCAACTCAAGGCTGCC for CDC25C, and TCGAGTGTGAGCAGGATCCTGGGGCCGAGGCTGCAGCCCGTAGCAACGGCAGGCCAGGTG and AATTCACCTGGCCTGCCGTTGCTACGGGCTGCAGCCTCGGCCCCAGGATCCTGCTCACAC for ppp1ca. The PCR products or the synthesized DNA was inserted between the XhoI (CTCGAG) and EcoR (GAATTC) sites of the modified pmirGLO vector.

For reporter gene assays, the reporter vectors were transfected using Lipofectamine 2000 (Invitrogen) by following the manufacturer's instructions. Cell lysates were collected, and the luciferase activities against renilla luciferase activities were measured with a double-luciferase assay system (Promega) by following the manufacturer's instructions.

RNA isolation, RT-PCR, and RT-qPCR.

Total cellular RNA was prepared using the RNeasy minikit (Qiagen) by following the manufacturer's protocol. RNAs for analyzing pre-microRNAs and mature microRNAs were isolated using the miRcute miRNA isolation kit by following the manufacturer's instructions (Tiangen, Beijing, China). The cDNAs for pre-miR-125b1 and pre-miR-125b2 were obtained by incubating the RNA samples with poly(A) polymerase following reverse transcription (RT) using an oligo(dT) universal tag primer (Kangwei, Beijing, China). The cDNAs for pri-miR-125b1 and pri-miR-125b2 were obtained by reverse transcription using a poly(dT) random primer. For semiquantitative reverse transcription-PCR analysis of pre-miR-125b1 and pre-miR-125b2 levels, the following primer pairs were used: CCAAGCTTCTAATACGACTCACTATAGGGAGATGGGAGCTGCGAGTCGTGT and a reverse primer from Kangwei (Beijing, China) for pre-miR-125b1, CCAAGCTTCTAATACGACTCACTATAGGGAGAGCTCTTGGGACCTAGGCGGA and a reverse primer from Kangwei for pre-miR-125b2, and CCAAGCTTCTAATACGACTCACTATAGGGAGATACCAGACTTTTCCTA and TCCCCTCCGCCTAGGTCCCA for pri-miR-125b2. The unspecific sequence CCAAGCTTCTAATACGACTCACTATAGGGAGA used in the RT-PCR primers for pre-miR-125b1 and pre-miR-125b2 was added just to produce a fragment longer and therefore easier to isolate in agarose gels; 20 to 25 PCR cycles were used. Reverse transcription-quantitative PCR (RT-qPCR) analysis could not be used for the analysis of pre-miR-125b1 and pre-miR-125b2 but could be used for the analysis of pri-miR-125bs from HeLa cell RNA and for the analysis of IDH4 cell RNA (data not shown). The primers for RT-qPCR detection of miR-125b were from Ribo Biology (Beijing, China). For RT-qPCR analysis of pri-miR-125b2 in IDH4 cells, we used the same primer pairs as used for semiquantitative RT-PCR. For RT-qPCR analysis of luc-3′ UTR chimeric transcripts (luc-p53S, luc-Bak1S, luc-ErbB2S, luc-CDC25CS, and luc-ppp1caS), we used the following primer pairs: CGAGGTGCCTAAAGGACTGA and TCATTGACCCTGAGCATAAA for luc-p53S, CGAGGTGCCTAAAGGACTGA and AGCCCAGAATCCCTGAGAGT for luc-Bak1S, CGAGGTGCCTAAAGGACTGA and AGGGCTTCTGCGGACTT for luc-ErbB2S, CGAGGTGCCTAAAGGACTGA and ATGCCAGAGTTCCCTGAA for luc-CDC25CS, and CGAGGTGCCTAAAGGACTGA and TGCCGTTGCCCTGAGCTGCA for luc-ppp1caS.

Preparation of the transcripts.

cDNA was used as a template for PCR amplification of 3′ UTR fragments of p53, ErbB1, Bak1, E2F3, CDC25C, and ppp1ca. All 5′ primers contained the T7 promoter sequence (CCAAGCTTCTAATACGACTCACTATAGGGAGA). To prepare templates for the long 3′ UTR fragments of p53, ErbB1, Bak1, E2F3, CDC25C, and ppp1ca, we used the following primer pairs: (T7)CCCTGTTGGTCGGTG and TGGACGTGGTGGCTC for p53, (T7)ACCAGAAGGCCAAG and TCATCTTTAAAAAAAC for ErbB2, (T7)AGATCAGCACCCTAAG and CTTGGAGGCTTCTGACAC for Bak1, (T7)TTGGAAAGGAGAACCAGG and GAAATGCCACTCACACAATG for E2F3, (T7)TAACATTCCAGCCACTGGCTGCT and GAAGGTAGACAACGCTCTTGCAT for CDC25C, and (T7)CCCCCGCACACCACCCTGTGCC and CAAGAGACCAGATGGGTTGC for ppp1ca. To prepare templates for the 5′ UTR and CR fragments of CDC25C and ppp1ca, we used the following primer pairs: (T7)GGTCAACGCCTGCGGCTGTTGAT and GGTCTTCGAATTCTCACCAGAG for the CDC25C 5′ UTR, (T7)ATGTCTACGGAACTCTTCTCATC and TCATGGGCTCATGTCCTTCACCA for CDC25C CR, (T7)GCGGGCCGCGGGCCGGGG and GGCGGCGCCGCCGCTCCAGCCCA for the ppp1ca 5′ UTR, and (T7)ATGTCCGACAGCGAGAAGCTCA and CTATTTCTTGGCCTTTGGCGGAAT for ppp1ca CR. To prepare templates for the short 3′ UTR fragments of p53, ErbB1, Bak1, and E2F3, we used the following primer pairs: (T7)GGAGGATTTCATCTCTTGT and ATTGACCCTGAGCATAAAACAAGTC for p53, (T7)GCCAAGTCCGCAGAAGC and GATGCCAGCAGAAGTCAGG for ErbB2, (T7)TGCTCCCATTCCTCCCTCT and CCCAAGCCCAGAATCCCT for Bak1, and (T7)TGTGACAGGGGAAAGGG and CATCTGACCCCATCCTG for E2F3. To amplify the templates of pre-miR-125b1, pre-miR-125b2, pre-miR-125a, and pre-miR-30a for in vitro transcription, we used the following primer pairs: (T7)TGCGCTCCTCTCAGTCCCT and AGCACGACTCGCAGCTCCCA for pre-miR-125b1, (T7)TACCAGACTTTTCCTA and TCCCCTCCGCCTAGGTCCCA for pre-miR-125b2, (T7)TGCCAGTCTCTAGGTC and GGCCAGACGCCAGGCTCCC for pre-miR-125a, and (T7)GCGACTGTAAACATCCT and GCAGCTGCAAACATC for pre-miR-30a. The mutants of pre-miR-125b1 and pre-miR-125b2 were generated by overlapping PCR. To amplify the templates of pri-miR-125b1 and pri-miR-125b2, we used the following primer pairs: (T7)GTATGTGTATGTGCGTGATT and ACCAGGCAGATGAGTTCCA for pri-miR-125b1 and (T7)GGTCGTCGTGATTACTCAGC and TTGCTTCTTACACAGGTTTCTTAT for pri-miR-125b2. The mutants of pri-miR-125b1 and pri-miR-125b2 were generated by overlapping PCR. To amplify the fragment for pri-miR-125a, primer pairs (T7)CACACCATGTTGCCAGTCTC and GTCATGCTCTGAGGAAGGG were used. These PCR products were in vitro transcribed by following the manufacturer's instructions (Promega). The microRNAs and mutants of miR-125b were synthesized by Ribo (Beijing, China). The fragments of the p16 3′ UTR and CR were described previously (19).

In vitro methylation assays.

For in vitro methylation assay, His-tagged NSun2 was expressed in Escherichia coli and purified using nickel-nitrilotriacetic acid (Ni-NTA)–agarose (Qiagen) by following the manufacturer's instructions, as described previously (19). Reaction mixtures (50 μl) containing 0.2 nM His-NSun2, 0.01 nM RNA (miRNAs, pre-miRNAs, or mRNA fragments), and 1 μCi of 3H-labeled S-adenosyl-l-methionine (SAM; Amersham Bioscience) in reaction buffer (5 mM Tris HCl[pH 7.5], 5 mM EDTA, 10% glycerol, 1.5 mM dithiothreitol [DTT], 5 mM MgCl2) supplemented with inhibitors (leupeptin [1 μg/ml], aprotinin [1 μg/ml], 0.5 mM phenylmethylsulfonyl fluoride, and RNasin [5 U/μl]) were incubated for 45 min at 37°C, as described previously (19). E. coli tRNA (0.01 nM; Sigma) and the p16 3′ UTR (0.01 nM) served as positive controls, while a 22-nt DNA (0.01 nM) or p53 CR DNA (0.01 nM) served as the negative control. Unincorporated [3H]S-adenosyl-l-methionine was removed by using QIAquick spin columns (Qiagen), and incorporated radioactivity was measured by liquid scintillation counting. The nonisotopic methylated miR-125b was prepared using cold SAM (Sigma) and synthesized miR-125b under similar conditions, but 1 nM His-NSun2 and 1 nM SAM were used to methylate 0.01 nM synthesized miR-125b.

Measurement of in vivo methylation.

For measurement of in vivo methylation of miRNAs, 1 μg of anti-m6A antibody, 20 μg of cellular RNA, and 20 μl (in 50% slurry) of protein G-Sepharose were incubated in IPP buffer (150 nM NaCl, 0.1% NP-40, 10 mM Tris HCl [pH 7.4]) plus 1 U/μl of RNasin in 200 μl at 4°C for 2 h. The immunoprecipitated (IP) beads then were washed with the IPP buffer 5 times. RNA isolated from the IP beads was subjected to reverse transcription followed by real-time, quantitative PCR analysis.

Knockdown of NSun2, Dicer, and Drosha.

To silence NSun2, Dicer, or Drosha transiently, cells were transfected with siRNA (20 nM) targeting NSun2 (GAGATCCTCTTCTATGATC), Dicer (AAGGCTTACCTTCTCCAGGCT), or Drosha (AACGAGTAGGCTTCGTGACTT) or with a control siRNA (UUGUUCGAACGUGUCACGUTT) by using Oligofectamine (Invitrogen). Unless otherwise indicated, cells were collected for analysis 48 h after transfection. All knockdown interventions caused less than 1% cell death (as determined by fluorescence-activated cell sorter [FACS] analysis [data not shown]).

Dot blot analysis.

RNA samples (1 μg methylated in vitro) were denatured and spotted to a nitrocellulose membrane under vacuum. After UV cross-linking, the membranes were blocked for 1 h in 5% nonfat dry milk in 0.1% PBST (0.1% Tween 20 in 1× phosphate-buffered saline [PBS], pH 7.4). Rabbit anti-m6A antibody was diluted 1:500 in 0.1% PBST and incubated with the membranes overnight (4°C). Following extensive washing with 0.1% PBST, the blot was incubated with Dylight 800 AffiniPure goat anti-rabbit IgG (H+L) for 1 h at 25°C. The membranes were washed again with 0.1% PBST and scanned with an Odyssey infrared imaging system (LI-COR Biotechnologies).

RNA pulldown assays and radioimmunoprecipitation (RIP) assays.

For biotin pulldown assays, PCR-amplified DNAs were used as the templates to transcribe biotinylated RNAs by using T7 RNA polymerase in the presence of biotin-UTP. One microgram of purified biotinylated transcripts was incubated with 200 μg of whole-cell lysates for 30 min at room temperature. Complexes were isolated using paramagnetic streptavidin-conjugated Dynabeads (Dynal, Oslo, Norway), and the pulldown material was analyzed by Western blotting or real-time qPCR.

For IP of ribonucleoprotein (RNP) complexes, whole-cell lysates were prepared and incubated with 1 μg of monoclonal anti-Ago2 antibody, as described previously (19). The miR-125b or luc-3′ UTR chimeric transcripts present in the RNP complexes were measured by RT-qPCR analysis.

In vitro microRNA processing assays.

In vitro microRNA processing assays were performed using the in vitro-methylated pri- and pre-miR-125bs as well as the cytoplasmic and nuclear extracts from Drosophila Schneider-2 (S2) cells. Briefly, in vitro-transcribed primary or precursor microRNAs (0.15 μg) were methylated by NSun2 in the presence of nonisotopic SAM and then incubated with 20 μg of the S2 cytoplasmic extracts (for the processing of pre-miR-125b1 and pre-miR-125b2) or nuclear extracts (for the processing of pri-miR-125b1 and pri-miR-125b2) containing 30 mM HEPES-KOH (pH 7.4), 100 mM potassium acetate (KOAc), 2 mM magnesium acetate (MgOAc), and 5 mM DTT at room temperature for 60 min. RNA was isolated from the reaction mixture and subjected to Northern blotting.

RESULTS

NSun2 methylates miR-125b in vitro.

N6-Methyladenosine (m6A) is an important modification of coding and noncoding RNAs (21, 22). In our previous study, we described the m6A methylation of p16 mRNA by NSun2 (19). The sequences RRACH (R = G or A and H = A, C, or U) and AAC have been described as motifs for m6A methylation (19, 21, 23). To test whether NSun2 methylates mammalian microRNAs, a collection of single-stranded microRNAs containing motifs for m6A methylation was subjected to in vitro methylation assays by using 3H-labeled S-adenosyl-l-methionine and purified His-NSun2. As shown in Fig. 1A (left), among the substrates screened, 3H incorporation into miR-125b and tRNA was robust, while 3H incorporation into miR-125a, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, and miR-22 was comparable to what was seen with a negative-control substrate (DNA). Because screening for 5-methylcytosine (m5C) microRNA methylation by NSun2 did not yield any candidates (20), we asked if NSun2 methylates miR-125b as m6A at RRACH, GAC, or AAC motifs. miR-125b contains two motifs for RNA m6A methylation, one at RRACH (positions 7 to 11) and one at AAC (positions 14 to 16) (see Fig. S1A in the supplemental material, schematic). Mutants of miR-125b at A9 (miR-125bΔ1), A15 (miR-125bΔ2), or both A9 and A15 (miR-125bΔ3) (see Fig. S1A, schematic) could not be methylated (Fig. 1A, left). These results suggested that NSun2 may methylate miR-125b at A9 and A15 and that methylation at A9 was interdependent with methylation at A15. Notably, miR-125b bearing mutations at G8 (miR-125bΔ4), C10 (miR-125bΔ5), A14 (miR-125bΔ6), or C16 (miR-125bΔ7) (see Fig. S1A, schematic) could not be methylated (Fig. 1A, middle), supporting the notion that the context of the methylation site in an RNA molecule is important (23). To rule out the possibility that residual bacterial protein from the purified His-NSun2 methylates miR-125b, the Ni-NTA–agarose incubated with bacterial lysates (expressing PET-28a [vector] or PET-28a–His–NSun2 [HisNSun2]) was used for in vitro methylation assays. Only Ni-NTA beads from cells transfected with PET-28a–His–NSun2 cells, and not those from cells transfected with the empty vector, were capable of effectively methylating miR-125b (Fig. 1A, right). The m6A methylation of miR-125b was further confirmed by immunoblotting assays using anti-m6A antibody. As shown in Fig. 1B, m6A signal was detected from in vitro-methylated miR-125b but not from miR-125bΔ3. The in vitro-methylated tRNA could not be detected by the anti-m6A antibody, since NSun2 methylates tRNA at m5C (13, 18).

FIG 1.

FIG 1

Open in a new tab

NSun2 methylates miR-125b in vitro. (A) (Left) Incorporation of 3H-labeled S-adenosyl-l-methionine into miR-125, miR-125bΔ1, miR-125bΔ2, miR-125bΔ3 (see Fig. S1A in the supplemental material, schematic), miR-125a, miR-30s (a, b, c, d, and e), and miR-22. (Middle) 3H incorporation to miR-125bΔ4-7 (see Fig. S1A, schematic). (Right) In vitro methylation of miR-125b by using Ni-NTA beads incubated with bacterial lysates (50 μg) expressing PET-28a or PET-28a–His–NSun2 as well as with purified His-NSun2. (B) Dot blot analysis detected the m6A methylation of miR-125b and tRNA by NSun2. The m6A nucleotide served as a positive control. (C) (Left) 3H incorporation into pre-miR-125a, pre-miR-125b1, pre-miR-125b2, pre-miR-30a, pre-miR-125b1Δ1, and pre-miR-125b2Δ1 (see Fig. S1B, schematic). (Right) 3H incorporation into pre-miR-125b2Δ1-4 (see Fig. S1B, schematic). The p16 3′ UTR and tRNA served as positive controls, while p16 CR and DNA served as negative controls. (D) Dot blot analysis was performed to detect m6A methylation of pre-miR-125b2 by NSun2. The m6A nucleotide served as a positive control. (E) (Left) 3H incorporation to pri-miR-125b1 and pri-miR-125b2 fragments as well as their mutants (see Fig. S1C). (Right) 3H incorporation into pri-miR-125a. Pre-miR-125b2 and pre-miR-125a served as positive and negative controls, respectively. All of the data for in vitro methylation represent the means ± SDs from 3 independent experiments.

We next tested if NSun2 methylates pre-miR-125b1, pre-miR-125b2, pri-miR-125b1, and pri-miR-125b2, the two precursors and primary transcripts of miR-125b (24). Pre-miR-125b1 and pre-miR-125b2 were methylated, but pre-miR-125a, pre-miR-30a, and pre-miR-125b1 bearing mutations at both A23 and A29 (corresponding to A9 and A15 of miR-125b [pre-miR-125b1Δ]) (see Fig. S1B in the supplemental material, schematic) were not methylated (Fig. 1C, left). 3H incorporation into pre-miR-125b2Δ1, bearing mutated A25 and A31 (corresponding to A9 and A15 of miR-125b) (see Fig. S1B in the supplemental material, schematic), decreased but was not lost, suggesting that pre-miR-125b2 contains methylation sites other than A25 and A31. Since pre-miR-125b2 contains RRACH or AAC motifs at positions 4 to 8, 49 to 53, and 73 to 75, we further tested if NSun2 methylates the mutants of pre-miR-125b2 depicted in Fig. S1B in the supplemental material. As shown in Fig. 1C (right), pre-miR-125b2Δ1 and pre-miR-125b2Δ3, but not pre-miR-125b2Δ2 or pre-miR-125b2Δ4, were methylated, suggesting that NSun2 methylates pre-miR-125b2 at A6, A25, and A31. The m6A signal was detected from the in vitro-methylated pre-miR-125b2 but not from pre-miR-125b2Δ4, suggesting that NSun2 methylates pre-miR-125b2 at m6A (Fig. 1D). NSun2 was also able to methylate pri-miR-125b1 and pri-miR-125b2 (Fig. 1E, left) but not pri-miR-125a (Fig. 1E, right). However, 3H incorporation into pri-miR-125b1Δ and pri-miR-125b2Δ, bearing mutated sites of pre-miR-125b1Δ1 and pre-miR-125b2Δ2 (see Fig. S1C in the supplemental material, schematic), decreased but was not lost (Fig. 1E, left), suggesting that pri-miR-125b1 and pri-miR-125b2 contain more methylation sites than pre-miR-125b1 and pre-miR-125b2. In addition, the methylation sites of pre-miR-125b1, pre-miR-125b2, and miR-125b are conserved in rats and mice (see Fig. S1D).

NSun2 methylates miR-125b in vivo.

To study if NSun2 methylates the primary, precursor, and mature miR-125b in vivo, RNA isolated from HeLa cells in which NSun2 was either overexpressed or silenced (Fig. 2A) was immunoprecipitated using an anti-m6A antibody. The presence of miR-125b and its precursors or primary transcripts in the IP materials was analyzed by reverse transcription followed by real-time, quantitative PCR analysis (for miR-125b) or by semiquantitative RT-PCR (for primary or pre-miR-125bs). As shown in Fig. 2B, the m6A antibody could effectively immunoprecipitate miR-125b but not miR-30a, which is not a substrate for NSun2-mediated methylation (Fig. 1A). As a negative control, IP using preimmune IgG failed to immunoprecipitate miR-125b or miR-30a. The levels of methylated miR-125b increased in cells with overexpressed NSun2 (∼2.4-fold) (Fig. 2C, left) but decreased in cells with silenced NSun2 (∼52%) (Fig. 2C, middle). However, neither NSun2 overexpression nor NSun2 knockdown markedly altered miR-125b steady-state levels (Fig. 2C, right). Similarly, the levels of methylated pre-miR-125b1, pre-miR-125b2, pri-miR-125b1, and pri-miR-125b2 were reduced in cells with silenced NSun2 (Fig. 2D to G). These results suggest that NSun2 may methylate miR-125b at the levels of the primary, precursor, and mature forms in vivo.

FIG 2.

FIG 2

Open in a new tab

NSun2 methylates miR-125b in vivo. (A) Forty-eight hours after transfection of HeLa cells with a vector expressing NSun2 (pNSun2) or with an empty vector (V) or after transfection with an siRNA targeting NSun2 (siNSun2) or a control siRNA (Ctrl), NSun2 and GAPDH protein levels were assessed by Western blot analyses. (B) RNA was isolated from HeLa cells and subjected to IP assays by using anti-m6A antibody. Real-time qPCR was performed to analyze the effect of anti-m6A antibody in immunoprecipitating in vivo-methylated miR-125b. IP with IgG antibody and the presence of miR-30a in the IP materials were included as controls. (C) RNA was isolated from cells described for panel A and subjected to IP analysis using anti-m6A or IgG antibody. The presence of miR-125b in the IP materials was analyzed by RT-qPCR (left and middle); miR-125b levels are shown (right). (D to G) The levels of pre-miR-125b1 and pre-miR-125b2 and of pri-miR-125b1 and pri-miR-125b2 (input) and their presence in the IP materials as described for panel B (m6A IP) were analyzed by semiquantitative RT-PCR. IP using a preimmune IgG antibody was included as a negative control. The in vivo methylation of pre-miR-125b2 (D and E) and pri-miR-125b2 (F and G) was analyzed by the density (percentage of control [Ctrl]) from the IP materials against that (percentage of Ctrl) from the input. All the data for in vivo methylation represent the means ± SDs from 3 independent experiments and were analyzed for statistical significance by Student's t test (***, P < 0.005).

Methylation by NSun2 attenuates the gene-silencing function of miR-125b.

miR-125b silences the expression of p53, E2F3, ErbB2, Bak1, CDC25C, and ppp1ca (25, 26, 27), raising the question of whether NSun2 modulates the expression of these genes by methylating miR-125b. Indeed, overexpression of NSun2 elevated the levels of p53, E2F3, ErbB2, Bak1, CDC25C, and ppp1ca (∼1.6- to 5.1-fold), as assessed by Western blotting, while knockdown of NSun2 reduced the levels of these proteins (∼40% to 80%) (Fig. 3A). Because NSun2 has been reported to methylate the 3′ UTR of p16 mRNA (19), we tested whether NSun2 regulates the expression of p53, E2F3, ErbB2, Bak1, CDC25C, and ppp1ca by methylating mRNA encoding these genes. Interestingly, NSun2 methylated the long 3′ UTR fragments of p53, E2F3, Bak1, and ErbB2 (p53-3′UTRL, E2F3-3′UTRL, Bak1-3′UTRL, and ErbB2-3′UTRL [Fig. 3B, schematic]) but not the 5′ UTR, CR, or 3′ UTR fragments of CDC25C or ppp1ca (Fig. 3C). When the 3′ UTR fragments were shortened but maintained the miR-125b recognition elements (REs) (p53-3′UTRS, E2F3-3′UTRS, Bak1-3′UTRS, and ErbB2-3′UTRS [Fig. 3D, schematic]), only E2F3-3′UTRS was methylated (Fig. 3E).

FIG 3.

FIG 3

Open in a new tab

Methylation by NSun2 enhances the expression of the targets of miR-125b. (A) HeLa cells were transfected with a vector expressing NSun2 (pNSun2) or an empty vector (V) or with an siRNA targeting NSun2 (siNSun2) or a control siRNA (Ctrl). Forty-eight hours later, cell lysates were prepared and subjected to Western blot analysis to assess the protein levels of of p53, E2F3, Bak1, ErbB2, CDC25C, and ppp1ca. (B) Schematic representation of the long 3′ UTR fragments studied. (C) 3H incorporation to the long 3′ UTR fragments of p53, E2F3, Bak1, and ErbB2 (p53-3′UTRL, E2F3-3′UTRL, Bak1-3′UTRL, and ErbB2-3′UTRL) (left) as well as CDC25C-5′UTR, CDC25C-CR, CDC25C-3′UTRL, ppp1ca-5′UTR, ppp1ca-CR, and ppp1ca-3′UTRL (right). (D) Schematic representation of the short 3′ UTR fragments studied. (E) 3H incorporation to p53-3′UTRS, E2F3-3′UTRS, Bak1-3′UTRS, and ErbB2-3′UTRS. The p16 3′ UTR and the p16 CR or a DNA fragment served as positive and negative controls, respectively. All of the data for in vitro methylation represent the means ± SDs from 3 independent experiments.

Next, we analyzed the activity of pGL3-derived reporters bearing long or short 3′ UTR fragments or variants with mutated miR-125b REs (Fig. 4A to D; see also Fig. S2 in the supplemental material, schematic). Knockdown of NSun2 reduced the activities of pGL3-p53L, pGL3-E2F3L, pGL3-Bak1L, and pGL3-ErbB2L as well as pGL3-p53LΔ, pGL3-E2F3LΔ, pGL3-Bak1LΔ, and pGL3-ErbB2LΔ (Fig. 4E), suggesting that NSun2 may regulate the expression of p53, E2F3, Bak1, and ErbB2 by methylating these 3′ UTRs. Furthermore, knockdown of NSun2 reduced the activities of pGL3-CDC25CL, pGL3-ppp1caL, pGL3-p53S, pGL3-Bak1S, and pGL3-ErbB2S but not those of pGL3, pGL3-CDC25CLΔ, pGL3-ppp1caLΔ, pGL3-p53SΔ, pGL3-Bak1SΔ, and pGL3-ErbB2SΔ (Fig. 4E and F), supporting the view that methylation by NSun2 attenuates the gene-silencing function of miR-125b.

FIG 4.

FIG 4

Open in a new tab

Methylation by NSun2 represses the gene-silencing function of miR-125b. (A to D) Schematic representation of the pGL3-derived reporters bearing the long (A) or short (B) 3′ UTR fragments and the corresponding fragments with mutated miR-125b sites (Δ) (C and D) (see Fig. S2 in the supplemental material, schematic). The unchanged and mutated miR-125b sites are indicated. (E and F) HeLa cells were transfected with the pGL3-derived reporters bearing the long (E) or short (F) 3′ UTR fragments or with miR-125b site mutants. Twenty-four hours later, cells were further transfected with an siRNA targeting NSun2 or a control siRNA, and then cells were cultured for an additional 48 h. Firefly luciferase activity against renilla luciferase activity was analyzed. Data represent the means ± SEMs from 3 independent experiments; significance was determined by Student's t test (***, P < 0.005).

Methylation by NSun2 represses the processing of miR-125b.

Based on the observation that the levels of pre-miR-125b2 and pri-miR-125b2 were reduced in cells with silenced NSun2 (Fig. 2D to G), we further tested if NSun2 regulates the processing of ectopically expressed primary miR-125b1 or primary miR-125b2 fragments by Northern blotting analysis. This system used digoxin-labeled probes and could not detect the endogenous miR-125 or its precursors (data not shown). NSun2 inhibited the processing of miR-125b from pre-miR-125b2 but not from pre-miR-125b1 (see Fig. S3A to D in the supplemental material). Interestingly, pre-miR-125b1 was more abundant than pre-miR-125b2 in HeLa cells, while pre-miR-125b2 was more abundant than pre-miR-125b1 in IDH4 cells (see Fig. S3E and F). The predominant presence of pre-miR-125b1 in HeLa cells may explain why overexpression or knockdown of NSun2 could not markedly influence the levels of miR-125b in HeLa cells (Fig. 2C, right). In agreement with the findings shown in Fig. S3A to S3D, silencing NSun2 in IDH4 cells increased miR-125b (∼2.2-fold) and reduced pri-miR-125b2 (∼62%) and pre-miR-125b2 (∼73%) (Fig. 5A and B), while the levels of pre-miR-125b1 remained unchanged (Fig. 5B). To further confirm the role of NSun2-mediated methylation in the processing of pre-miR-125b2 and pri-miR-125b2, the levels of pre-miR-125b2 and pri-miR-125b2 in IDH4 cells jointly silenced with NSun2 and Dicer or with NSun2 and Drosha were assessed by semiquantitative RT-PCR and RT-qPCR, respectively. Knockdown of NSun2 reduced the levels of pre-miR-125b2 (Fig. 5C and D), in keeping with the results shown in Fig. 5B. However, knockdown of Dicer diminished the effect of NSun2 on reducing pre-miR-125b2 (Fig. 5D). Similarly, knockdown of Drosha diminished the effect of NSun2 on reducing pri-miR-125b2 (Fig. 5E). Furthermore, the effect of NSun2-mediated methylation in the processing of pri- and pre-miR-125b2 was tested by in vitro processing assays using the in vitro-methylated pri- and pre-miR-125b2 as well as the cytoplasmic and nuclear extracts of Drosophila Schneider-2 cells. In the processing reactions using cytoplasmic extracts and methylated pre-miR-125b2, the level of pre-miR-125b2 increased ∼1.9-fold, while the level of the product (miR-125b) decreased ∼58% (Fig. 6A). In the processing reactions using nuclear extracts and methylated pri-miR-125b2, methylation by NSun2 elevated pri-miR-125b2 ∼5.8-fold but reduced the product (pre-miR-125b2) by ∼57% (Fig. 6B). As anticipated, methylation by NSun2 could not remarkably alter the relative levels of pre-miR-125b1 versus miR-125b1 or pri-miR-125b1 versus pre-miR-125b1 in the processing reactions (Fig. 6). In sum, methylation by NSun2 represses the processing of miR-125b from pre-miR-125b2 or pri-miR-125b2.

FIG 5.

FIG 5

Open in a new tab

Methylation by NSun2 represses the processing of miR-125b. (A) Forty-eight hours after transfection of IDH4 cells with an siRNA targeting NSun2, the protein levels of NSun2 and GAPDH were assessed by Western blotting (left). The levels of miR-125b (middle) and pri-miR-125b2 (right) were analyzed by RT-qPCR, and results are represented as the means ± SEM from 3 to 5 independent experiments; significance was determined by Student's t test (*, P < 0.05; **, P < 0.01). (B) (Left) The levels of pre-miR-125b1, pre-miR-125b2, and U6 in cells described for panel A were analyzed by semiquantitative RT-PCR. (Middle and right) The RT-PCR data are represented as the means ± SDs from 3 to 5 independent experiments; significance was determined by Student's t test (***, P < 0.005). (C) Forty-eight hours after NSun2, Dicer, or both proteins were silenced in IDH4 cells, the protein levels of NSun2, Dicer, and GAPDH were analyzed by Western blotting. (D) (Left) The levels of pre-miR-125b2 in cells described for panel C were determined by semiquantitative RT-PCR. (Right) RT-PCR data are represented as the means ± SDs from 3 to 5 independent experiments; significance was determined by Student's t test (***, P < 0.005). (E) (Left) Forty-eight hours after NSun2, Drosha, or both proteins were silenced in IDH4 cells, the protein levels of NSun2, Drosha, and GAPDH were analyzed by Western blotting. (Right) the levels of pri-miR-125b2 were analyzed by RT-qPCR and are represented as the means ± SEMs from 3 to 5 independent experiments; significance was determined by Student's t test (***, P < 0.005).

FIG 6.

FIG 6

Open in a new tab

Methylation by NSun2 represses the processing of in vitro-methylated pri-miR-125b2 and pre-miR-125b2. (A) In vitro-methylated or unmethylated pre-miR-125b1 and pre-miR-125b2 (0.15 μg) were subjected to processing assays using cytoplasmic extracts from Drosophila Schneider-2 (S2) cells. Northern blotting was performed to determine the levels of pre-miR-125b1 versus miR-125b and pre-miR-125b2 versus miR-125b. The untreated pre-miR-125b1 and pre-miR-125b2 (0.05 μg) were included as loading controls. (B) In vitro-methylated or unmethylated pri-miR-125b1 and pri-miR-125b2 were subjected to processing assays using the nuclear extracts from Drosophila Schneider-2 (S2) cells. Northern blot analysis was performed to determine the levels of pri-miR-125b1 versus pre-miR-125b1 and pri-miR-125b2 versus pre-miR-125b2. The untreated pri-miR-125b1 or pri-miR-125b2 (0.05 μg) was included as a loading control. The Northern blotting signals of the processing samples (+S2-Nuc.) were quantified by densitometric analysis and are represented as the means ± SDs from 3 independent experiments; they were analyzed for significance by Student's t test (***, P < 0.005).

The anticipated half-life of miR-125 is ∼5 days (28). However, methylation of miR-125 did not appear to influence the turnover of miR-125, since neither the endogenous nor the ectopically expressed miR-125b was markedly altered in HeLa cells even after 6 days of silencing NSun2 (see Fig. S3G and H in the supplemental material).

NSun2 represses the recruitment of RISC by miR-125b.

Because NSun2 attenuates the gene-silencing effect of miR-125b without influencing the levels of miR-125b in HeLa cells (Fig. 2C and 4E), methylation may influence the function of miR-125. However, methylation by NSun2 did not seem to influence the affinity of miR-125 for its target mRNAs (see Fig. S4A and B in the supplemental material). Instead, knockdown of NSun2 elevated Ago2 levels in the materials pulled down by the short 3′ UTR fragments of p53, Bak1, ErbB2, E2F3, ppp1ca, and CDC25C (∼1.6- to 3-fold) (Fig. 7A). As controls, the short 3′ UTR fragments of CDC25C and ppp1ca mutating the miR-125b recognition motifs (CDC25CSΔ and ppp1caSΔ) failed to pull down Ago2 protein (Fig. 7A). NSun2 silencing also elevated the Ago2-associated miR-125b (∼2.5-fold) (Fig. 7B) but not the Ago2-associated miR-30a (Fig. 7C). In addition, NSun2 knockdown elevated the Ago2-associated luc-p53S, luc-Bak1S, luc-ErbB2S, luc-CDC25CS, and luc-ppp1caS chimeric transcripts (∼2.4- to 3.9-fold) (Fig. 7D). Given that microRNAs can exist in miRNA-mRNA duplexes not bound by Ago proteins (29), these results suggest that methylation by NSun2 may attenuate the recruitment of RISC by miR-125b without influencing the interaction of miR-125b with its target mRNAs.

FIG 7.

FIG 7

Open in a new tab

Methylation by NSun2 attenuates the recruitment of RISC by miR-125b. (A) Forty-eight hours after transfection of HeLa cells with an siRNA targeting NSun2 (+) or a control siRNA (−), cell lysates were prepared and subjected to RNA pulldown assays using the biotinylated short 3′ UTR fragments indicated in Fig. 3D. Pulldown assays using the short 3′ UTR fragments of CDC25C and ppp1ca mutating the miR-125b recognition motifs were used as controls. The presence of Ago2 in the pulldown materials was analyzed by Western blotting. A 10-μg aliquot of whole-cell lysates (input) and binding to GAPDH protein were also tested. (B and C) Cell lysates described for panel A were subjected to RIP assays using anti-Ago2 or IgG antibody. The enrichment of miR-125b (B) and miR-30a (C) in the IP materials was analyzed by real-time qPCR. The levels of miR-125b and miR-30a were included. Data represent the means ± SEMs from 3 independent experiments; significance was determined by Student's t test (***, P < 0.005). (D) Twenty-four hours after transfection with the reporters indicated, HeLa cells were further transfected with an siRNA targeting NSun2 or a control siRNA and cultured for additional 48 h. RIP assays were performed using anti-Ago2 antibody, and the presence of the luc-3′ UTR chimeric transcripts in the IP materials was assessed by RT-qPCR (left); the levels of the luc-3′ UTR chimeric transcripts are shown (right). Data represent the means ± SEMs from 3 to 5 independent experiments; significance was determined by Student's t test (*, P < 0.05; ***, P < 0.005).

The NSun2-miR-125b axis impacts oxidative stress.

Oxidative stress elevates NSun2 levels but reduces miR-125b levels (19, 30). Exposure of HeLa cells to oxidative stress (50 μM H2O2) increased the protein levels of NSun2, p53, Bak1, ErbB2, E2F3, and ppp1ca (∼2.8- to 4.0-fold) but not that of CDC25C (Fig. 8A). Oxidative stress decreased the levels of miR-125b and increased the methylation levels of miR-125b (Fig. 8B). Accordingly, oxidative stress induced the activities of pGL3-p53S, pGL3-Bak1S, pGl3-ErbB2S, pGL3-E2F3L, pGL3-ppp1caL, and pGL3-CDC25CL but not those of pGL3-p53SΔ, pGL3-Bak1SΔ, pGL3-ErbB2SΔ, pGL3-CDC25CLΔ, and pGL3-ppp1caLΔ (Fig. 8C). In IDH4 cells, reduction of miR-125b by oxidative stress was diminished by silencing cells with NSun2 (Fig. 8D). In sum, the reduced biogenesis and function of miR-125b under oxidative stress are achieved, at least in part, by NSun2-mediated methylation.

FIG 8.

FIG 8

Open in a new tab

NSun2 regulates miR-125b levels and function in response to oxidative stress. (A) Twenty-four hours after HeLa cells were exposed to H2O2 (50 μM), the levels of proteins NSun2, p53, Bak1, CDC25C, and ppp1ca were analyzed by Western blotting. (B) (Left) RNA was isolated from cells described for panel A was subjected to RT-qPCR to measure the levels of miR-125b. (Right) In vivo-methylated miR-125b was analyzed as described for Fig. 2B. (C) HeLa cells were transfected with pGL3-p53S, pGL3-Bak1S, and pGL3-ppp1caS as well as with pGL3-p53SΔ, pGL3-Bak1SΔ, and pGL3-ppp1caSΔ. Twenty-four hours later, cells were further treated with H2O2 (50 μM), and cells were then cultured for an additional 24 h. Firefly activity was quantified and normalized to renilla luciferase activity. Data represent the means ± SEMs from 3 independent experiments and were analyzed for statistical significance by Student's t test (***, P < 0.005). (D) IDH4 cells were transfected with an siRNA targeting NSun2 or with a control siRNA. Forty-eight hours later, cells were treated with H2O2 (50 μM) for an additional 24 h. The protein levels of NSun2 and GAPDH were monitored by Western blotting (left). The levels of miR-125b were analyzed by RT-qPCR (right). The RT-qPCR data are represented as the means ± SEMs from 3 independent experiments and were analyzed for statistical significance by Student's t test (***, P < 0.005).

DISCUSSION

In this report, we present evidence that by methylating miR-125b, pre-miR-125b1, pre-miR-125b2, pri-miR-125b1, and pri-miR-125b2, NSun2 repressed the processing of miR-125b or attenuated the function of miR-125b in recruiting RISC (Fig. 1, 2, 5, 6, and 7), thereby abolishing the gene-silencing function of miR-125b under oxidative stress (Fig. 3, 4, and 8). Although NSun2 has been described as an m5C methyltransferase in tRNA and vault noncoding RNA (13, 18), the present study provides evidence that NSun2 methylates m6A in mammalian miRNAs (Fig. 1 and 2). Methylation at adenosine (m6A) is a predominant modification of mRNAs (22, 31, 32, 33). In this regard, m6A methylation by NSun2 has been identified at the 3′ UTR of p16 mRNA (19). The m6A methylation occurs also at noncoding RNAs (20, 21). Therefore, whether NSun2-mediated methylation occurs at cytidine or adenosine may depend on the target RNA sequence. Because the RNA sequences methylated by NSun2 (e.g., RRACH and AAC) are widely present in mammalian microRNAs, NSun2 may target multiple miRNAs.

Given that pri-miR-125b1 and pri-miR-125b2 are methylated by NSun2 both in vivo and in vitro (Fig. 1E and 2F and G), the in vivo-methylated pre-miR-125b1, pre-miR-125b2, and miR-125b may arise from the processing of in vivo-methylated pri-miR125b1 and pri-miR-125b2. However, evidence that NSun2 is capable of methylating miR-125b, pre-miR-125b1, and pre-miR-125b2 in vitro (Fig. 1A to D) supports the notion that NSun2 directly methylates miR-125b, pre-miR-125b1, and pre-miR-125b2 in vivo. Unlike pri-miR-125b2 and pre-miR-125b2, methylation of pri-miR-125b1 and pre-miR-125b1 does not seem to influence the processing of pri-miR-125b1 and pre-miR-125b1 (Fig. 5 and 6; see also Fig. S3 in the supplemental material). Therefore, the functional impact of NSun2-mediated methylation of pri-miR-125b1 and pre-miR-125b1 remains to be further addressed.

Posttranscriptional gene regulation by microRNAs occurs largely via the interaction with target mRNAs (predominantly at their 3′ UTRs). Interestingly, NSun2 regulates the expression of p53, E2F3, Bak1, and ErbB2 by methylating both miR-125b and the 3′ UTRs of p53, E2F3, Bak1, and ErbB2 mRNAs (Fig. 3 and 4). Therefore, it is not possible to evaluate with precise accuracy the relative contributions of NSun2-mediated methylation of miR-125b and methylation of the 3′ UTRs to the regulation of the above-mentioned genes. However, the evidence presented in Fig. 4E and F and Fig. 7 supported the idea that methylation by NSun2 acts as a regulatory factor for the function of miR-125b.

A previous study implicated NSun2-mediated methylation in the regulation of p16 under oxidative stress (19). The present work shows that methylation by NSun2 regulates the processing and function of miR-125b under oxidative stress (Fig. 8), thereby elevating the levels of p53, Bak1, ErbB2, E2F3, and ppp1ca. Oxidative stress was somewhat more effective than overexpression of NSun2 in lowering miR-125b (with reductions in miR-125b of ∼10% for NSun2 overexpression [Fig. 2C] versus reductions of ∼22% for H2O2 treatment [Fig. 8B]), likely because other transcriptional and posttranscriptional factors are involved in the response of HeLa cells to oxidative stress. Notably, we did not observe a remarkable elevation of CDC25C in response to oxidative stress (Fig. 8A), likely reflecting the fact that CDC25C is regulated at multiple levels following exposure to oxidative damage. For example, the oxidative-stress-triggered degradation of CDC25C and the elevation of p53 in response to oxidative stress could also suppress CDC25C abundance (34, 35). Based on the fact that NSun2 and miR-125b are implicated in human cancers (13, 17, 36), the NSun2-miR-125b regulatory axis may impact human carcinogenesis. Given that the distribution of pre-miR-125b1 and pre-miR-125b2 in HeLa cells is largely different from that in IDH4 cells (see Fig. S3E and F in the supplemental material), whether NSun2-mediated methylation is involved in the tissue-specific expression of miR-125b warrants future investigation.

Supplementary Material

Supplemental material
supp_34_19_3630__index.html (936B, html)

ACKNOWLEDGMENTS

This work was supported by grants 81230008 and 91339114 from the National Science Foundation of China and grant B07001 (111 project) from the Ministry of Education of People's Republic of China. M.G. was supported by the National Institute on Aging-IRP, National Institutes of Health.

We thank J. Shay for generously providing us the IDH4 cells and L. Liu for providing us the Drosophila Schneider-2 cells.

We declare that we have no conflicts of interest.

Footnotes

Published ahead of print 21 July 2014

Supplemental material for this article may be found at http://dx.doi.org/10.1128/MCB.00243-14.

REFERENCES

  • 1.Motorin Y, Helm M. 2011. RNA nucleotide methylation. Wiley Interdiscip. Rev. RNA 2:611–631. 10.1002/wrna.79 [DOI] [PubMed] [Google Scholar]
  • 2.Schaefer M, Pollex T, Hanna K, Tuorto F, Meusburger M, Helm M, Lyko F. 2010. RNA methylation by Dnmt2 protects transfer RNAs against stress-induced cleavage. Genes Dev. 24:1590–1595. 10.1101/gad.586710 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cowling VH. 2010. Regulation of mRNA cap methylation. Biochem. J. 425:295–302. 10.1042/BJ20091352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Horwich MD, Li C, Matranga C, Vagin V, Farley G, Wang P, Zamore PD. 2007. The Drosophila RNA methyltransferase, DmHen1, modifies germline piRNAs and single-stranded siRNAs in RISC. Curr. Biol. 17:1265–1272. 10.1016/j.cub.2007.06.030 [DOI] [PubMed] [Google Scholar]
  • 5.Kirino Y, Mourelatos Z. 2007. Mouse Piwi-interacting RNAs are 2′-O-methylated at their 3′ termini. Nat. Struct. Mol. Biol. 14:347–348. 10.1038/nsmb1218 [DOI] [PubMed] [Google Scholar]
  • 6.Saito K, Sakaguchi Y, Suzuki T, Suzuki T, Siomi H, Siomi MC. 2007. Pimet, the Drosophila homolog of HEN1, mediates 2′-O-methylation of Piwi-interacting RNAs at their 3′ ends. Genes Dev. 21:1603–1608. 10.1101/gad.1563607 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ji L, Chen X. 2012. Regulation of small RNA stability: methylation and beyond. Cell Res. 22:624–636. 10.1038/cr.2012.36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yu B, Yang Z, Li J, Minakhina S, Yang M, Padgett RW, Steward R, Chen X. 2005. Methylation as a crucial step in plant microRNA biogenesis. Science 307:932–935. 10.1126/science.1107130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kimura S, Suzuki T. 2010. Fine-tuning of the ribosomal decoding center by conserved methyl-modifications in the Escherichia coli 16S rRNA. Nucleic Acids Res. 38:1341–1352. 10.1093/nar/gkp1073 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Meyer B, Wurm JP, Kötter P, Leisegang MS, Schilling V, Buchhaupt M, Held M, Bahr U, Karas M, Heckel A, Bohnsack MT, Wöhnert J, Entian KD. 2011. The Bowen-Conradi syndrome protein Nep1 (Emg1) has a dual role in eukaryotic ribosome biogenesis, as an essential assembly factor and in the methylation of Ψ1191 in yeast 18S rRNA. Nucleic Acids Res. 39:1526–1537. 10.1093/nar/gkq931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Das G, Thotala DK, Kapoor S, Karunanithi S, Thakur SS, Singh NS, Varshney U. 2008. Role of 16S ribosomal RNA methylations in translation initiation in Escherichia coli. EMBO J. 27:840–851. 10.1038/emboj.2008.20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Seshadri A, Dubey B, Weber MH, Varshney U. 2009. Impact of rRNA methylations on ribosome recycling and fidelity of initiation in Escherichia coli. Mol. Microbiol. 72:795–808. 10.1111/j.1365-2958.2009.06685.x [DOI] [PubMed] [Google Scholar]
  • 13.Frye M, Watt FM. 2006. The RNA methyltransferase Misu (NSun2) mediates Myc-induced proliferation and is upregulated in tumors. Curr. Biol. 16:971–981. 10.1016/j.cub.2006.04.027 [DOI] [PubMed] [Google Scholar]
  • 14.Hussain S, Benavente SB, Nascimento E, Dragoni I, Kurowski A, Gillich A, Humphreys P, Frye M. 2009. The nucleolar RNA methyltransferase Misu (NSun2) is required for mitotic spindle stability. J. Cell Biol. 186:27–40. 10.1083/jcb.200810180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Blanco S, Kurowski A, Nichols J, Watt FM, Benitah SA, Frye M. 2011. The RNA-methyltransferase Misu (NSun2) poises epidermal stem cells to differentiate. PLoS Genet. 7:e1002403. 10.1371/journal.pgen.1002403 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hussain S, Tuorto F, Menon S, Blanco S, Cox C, Flores JV, Watt S, Kudo NR, Lyko F, Frye M. 2013. The mouse cytosine-5 RNA methyltransferase NSun2 is a component of the chromatoid body and required for testis differentiation. Mol. Cell. Biol. 33:1561–1570. 10.1128/MCB.01523-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Okamoto M, Hirata S, Sato S, Koga S, Fujii M, Qi G, Ogawa I, Takata T, Shimamoto F, Tatsuka M. 2012. Frequent increased gene copy number and high protein expression of tRNA (cytosine-5-)-methyltransferase (NSUN2) in human cancers. DNA Cell Biol. 31:660–671. 10.1089/dna.2011.1446 [DOI] [PubMed] [Google Scholar]
  • 18.Tuorto F, Liebers R, Musch T, Schaefer M, Hofmann S, Kellner S, Frye M, Helm M, Stoecklin G, Lyko F. 2012. RNA cytosine methylation by Dnmt2 and NSun2 promotes tRNA stability and protein synthesis. Nat. Struct. Mol. Biol. 19:900–905. 10.1038/nsmb.2357 [DOI] [PubMed] [Google Scholar]
  • 19.Zhang X, Liu Z, Yi J, Tang H, Xing J, Yu M, Tong T, Shang Y, Gorospe M, Wang W. 2012. NSun2 stabilizes p16INK4 mRNA by methylating the p16 3′UTR. Nat. Commun. 3:712. 10.1038/ncomms1692 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hussain S, Sajini AA, Blanco S, Dietmann S, Lombard P, Sugimoto Y, Paramor M, Gleeson JG, Odom DT, Ule J, Frye M. 2013. NSun2-mediated cytosine-5 methylation of vault noncoding RNA determines its processing into regulatory small RNAs. Cell Rep. 4:255–261. 10.1016/j.celrep.2013.06.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Liu N, Parisien M, Dai Q, Zheng G, He C, Pan T. 2013. Probing N6-methyladenosine RNA modification status at single nucleotide resolution in mRNA and long noncoding RNA. RNA 19:1848–1856. 10.1261/rna.041178.113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Meyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE, Jaffrey SR. 2012. Comprehensive analysis of mRNA methylation reveals enrichment in 3′ UTRs and near stop codons. Cell 149:1635–1646. 10.1016/j.cell.2012.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Narayan P, Ludwiczak RL, Goodwin GC, Rottman FM. 1994. Context effects on N6-adenosine methylation sites in prolactin mRNA. Nucleic Acids Res. 22:419–426. 10.1093/nar/22.3.419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhou R, Hu G, Gong AY, Chen XM. 2010. Binding of NF-kappaB p65 subunit to the promoter elements is involved in LPS-induced transactivation of miRNA genes in human biliary epithelial cells. Nucleic Acids Res. 38:3222–3232. 10.1093/nar/gkq056 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Le MT, Shyh-Chang N, Khaw SL, Chin L, Teh C, Tay J, O'Day E, Korzh V, Yang H, Lal A, Lieberman J, Lodish HF, Lim B. 2011. Conserved regulation of p53 network dosage by microRNA-125b occurs through evolving miRNA-target gene pairs. PLoS Genet. 7:e1002242. 10.1371/journal.pgen.1002242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hannafon BN, Sebastiani P, de las Morenas A, Lu I, Rosenberg CL. 2011. Expression of microRNA and their gene targets are dysregulated in preinvasive breast cancer. Breast Cancer Res. 13:R24. 10.1186/bcr2839 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Huang L, Luo J, Cai Q, Pan Q, Zeng H, Guo Z, Dong W, Huang J, Lin T. 2011. MicroRNA-125b suppresses the development of bladder cancer by targeting E2F3. Int. J. Cancer 128:1758–1769. 10.1002/ijc.25509 [DOI] [PubMed] [Google Scholar]
  • 28.Gantier MP, McCoy CE, Rusinova I, Saulep D, Wang D, Xu D, Irving AT, Behlke MA, Hertzog PJ, Mackay F, Williams BR. 2011. Analysis of microRNA turnover in mammalian cells following Dicer1 ablation. Nucleic Acids Res. 39:5692–5703. 10.1093/nar/gkr148 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Janas MM, Wang B, Harris AS, Aguiar M, Shaffer JM, Subrahmanyam YV, Behlke MA, Wucherpfennig KW, Gygi SP, Gagnon E, Novina CD. 2012. Alternative RISC assembly: binding and repression of microRNA-mRNA duplexes by human Ago proteins. RNA 18:2041–2055. 10.1261/rna.035675.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.He J, Xu Q, Jing Y, Agani F, Qian X, Carpenter R, Li Q, Wang XR, Peiper SS, Lu Z, Liu LZ, Jiang BH. 2012. Reactive oxygen species regulate ERBB2 and ERBB3 expression via miR-199a/125b and DNA methylation. EMBO Rep. 12:1116–1122. 10.1038/embor.2012.162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Carroll SM, Narayan P, Rottman FM. 1990. N6-methyladenosine residues in an intron-specific region of prolactin pre-mRNA. Mol. Cell. Biol. 10:4456–4465 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Narayan P, Rottman FM. 1988. An in vitro system for accurate methylation of internal adenosine residues in messenger RNA. Science 242:1159–1162. 10.1126/science.3187541 [DOI] [PubMed] [Google Scholar]
  • 33.Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, Sorek R, Rechavi G. 2012. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485:201–206. 10.1038/nature11112 [DOI] [PubMed] [Google Scholar]
  • 34.Savitsky PA, Finkel T. 2002. Redox regulation of Cdc25C. J. Biol. Chem. 277:20535–20540. 10.1074/jbc.M201589200 [DOI] [PubMed] [Google Scholar]
  • 35.St Clair S, Manfredi JJ. 2006. The dual specificity phosphatase Cdc25C is a direct target for transcriptional repression by the tumor suppressor p53. Cell Cycle 5:709–713. 10.4161/cc.5.7.2628 [DOI] [PubMed] [Google Scholar]
  • 36.Sun YM, Lin KY, Chen YQ. 2013. Diverse functions of miR-125 family in different cell contexts. J. Hematol. Oncol. 6:6. 10.1186/1756-8722-6-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material
supp_34_19_3630__index.html (936B, html)
MCB.00243-14_zmb999100591so1.pdf (515.1KB, pdf)

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES