Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2014 Oct;52(10):3749–3754. doi: 10.1128/JCM.01010-14

Mupirocin-Induced Mutations in ileS in Various Genetic Backgrounds of Methicillin-Resistant Staphylococcus aureus

Andie S Lee a,b, Yann Gizard c, Joanna Empel d, Eve-Julie Bonetti c, Stephan Harbarth a, Patrice François c,✉
Editor: K C Carroll
PMCID: PMC4187773  PMID: 25122856

Abstract

Topical mupirocin is widely used for the decolonization of methicillin-resistant Staphylococcus aureus (MRSA) carriers. We evaluated the capacity of various MRSA clonotypes to develop mutations in the ileS gene associated with low-level mupirocin resistance. Twenty-four mupirocin-sensitive MRSA isolates from a variety of genotypes (determined by a multilocus variable-number tandem-repeat assay) were selected. Mupirocin MICs were determined by Etest. The isolates were then incubated in subinhibitory concentrations of mupirocin for 7 to 14 days. Repeat MIC determinations and sequencing of the ileS gene were then performed. Doubling times of isolates exposed to mupirocin and of unexposed isolates were compared. We found that exposure to mupirocin led to rapid induction of low-level resistance (MICs of 8 to 24 μg/ml) in 11 of 24 (46%) MRSA isolates. This phenomenon was observed in strains with diverse genetic backgrounds. Various mutations were detected in 18 of 24 (75%) MRSA isolates. Acquisition of mutations appeared to be a stepwise process during prolonged incubation with the drug. Among the five isolates exhibiting low-level resistance and the highest MICs, four tested sensitive after incubation in the absence of mupirocin but there was no reversion to the susceptible wild-type primary sequence. Resistance was not associated with significant fitness cost, suggesting that MRSA strains with low-level mupirocin resistance may have a selective advantage in facilities where mupirocin is commonly used. Our findings emphasize the importance of the judicious use of this topical agent and the need to closely monitor for the emergence of resistance.

INTRODUCTION

Nasal carriage of Staphylococcus aureus, including methicillin-resistant S. aureus (MRSA), has been identified as a risk factor for staphylococcal infection, with approximately 10% to 30% of MRSA carriers subsequently developing infection (1, 2). In addition, MRSA carriers act as reservoirs for the transmission of MRSA between hospitalized patients. Preoperative S. aureus screening and decolonization regimens for those undergoing selected surgeries have been advocated to decrease the infection risk in carriers (3, 4). Decolonization therapy can also be a successful infection control strategy to limit MRSA transmission within hospitals (5).

Decolonization protocols to eradicate S. aureus carriage commonly use intranasal mupirocin and chlorhexidine body washes (6). However, increasing resistance to these agents with associated reduction in the effectiveness of the decolonization strategy is being reported (7–9). In contrast to the high-level mupirocin resistance (MICs of ≥512 μg/ml) which results from the acquisition of a mobile genetic element carrying the mupA gene (also designated ileS-2), low-level resistance is due to acquisition of a point mutation(s) in tRNA synthetase for isoleucine (ileS) (10) and is defined by MICs between 8 and 256 μg/ml.

We recently described increasing mupirocin resistance in MRSA bloodstream isolates in our institution (11). After the introduction of routine decolonization of MRSA carriers with intranasal mupirocin and chlorhexidine body washes in 1994, mupirocin resistance increased from 0% in 1999 to 79% in 2008. In addition, the prevalence of resistance in a given year closely correlated with hospital-wide mupirocin consumption. The majority of mupirocin-resistant isolates exhibited low-level resistance, harbored the V588F point mutation, and belonged to the ST228 (clonal complex 5 [CC5]) clone which is the dominant MRSA clone in our region.

This study aimed to explore the genetic evolution underlying the emergence of low-level resistance in MRSA by investigating the development of mutations under selective pressure in vitro in MRSA isolates with diverse genetic backgrounds. These genetic changes could explain in vivo observations and predict reductions in the effectiveness of decolonization regimens with increasing mupirocin use.

MATERIALS AND METHODS

Strain selection and MIC determination.

A panel of 24 clinical MRSA isolates from various genotypes were selected from a collection of strains from the international Mastering Hospital Antimicrobial Resistance (MOSAR) research study (12) as follows: CC152 (n = 1), CC5 (n = 8), CC7 (n = 1), CC8 (n = 4), CC59 (n = 1), CC80 (n = 1), CC30 (n = 3), CC22 (n = 1), CC45 (n = 1), CC398 (n = 2), and CC1 (n = 1). The 24 isolates were maintained in Mueller-Hinton broth (MHB). All isolates were confirmed to be MRSA using a latex agglutination test, a tube coagulase test, and mecA PCR. Mupirocin MICs were determined by using Etests (AB bioMérieux, France).

Genotyping.

Strains were genotyped and characterized as previously described by using a multilocus variable-number tandem-repeat assay (13, 14) and multilocus sequence typing (15).

Induction of mutations.

Strains were incubated in Mueller-Hinton broth (MHB) (control condition) as well as MHB supplemented with 0.5 MIC of mupirocin according to the original MIC of the isolate (Sigma-Aldrich, Saint Louis, MO). After overnight incubation, the suspensions were calibrated to 0.5 McFarland standard and diluted 1:100 in fresh medium. This was repeated on a daily basis for 7 days to reflect the duration of in vivo exposure to mupirocin in decolonization protocols, which usually last for 5 to 14 days (16–18). After 7 days, strains underwent MIC determinations by Etest before being subjected to another 7-day antimicrobial exposure cycle, with the mupirocin concentration adjusted according to the new MIC. To assess the stability of mutations after withdrawal of the selection pressure with mupirocin, samples of resistant strains were reincubated for a further 2 weeks with daily subculturing in fresh medium without mupirocin, corresponding to a total of approximately 350 cellular generations.

DNA extraction and sequence analysis.

Genomic DNA from the MRSA strains isolated after incubation with and without mupirocin was obtained as previously described (13) by using a DNeasy kit (Qiagen, Basel, Germany). The ileS sequence was obtained by manually assembling the 8 sequencing results (LGC Genomics, Berlin, Germany) obtained from 8 distinct PCRs performed with primers (Table 1) designed using Primer 3 (http://biotools.umassmed.edu/bioapps/primer3_www.cgi). Sequences were compared by using blastX (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and alignments were displayed using ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/). All mutations were detected by visual inspection.

TABLE 1.

List of primers used to sequence the ileS genea

Primer name 5′→3′ sequence Length (nt)
IleS_56_F GTTAATAAGGGTGGTACCGCGAG 23
IleS_996_F AGATGACTATATTGTTGGTC 20
IleS_1700_F TCACAACTTCAGTTGCTACAAGAGGA 26
IleS_2504_F ATAAATTTAATGCATCTGAA 20
IleS_57_R GATTATGAAGAGAGCTTTAA 20
IleS_482_R AAAAATACGAATTTGTGCAG 20
IleS_1174_R TCTCCAGTCGTGTGGATAGCTATG 24
IleS_2254_R AGATTGGTGCTAACAACTTCGTCAT 25
a

Conditions for amplification were as follows: first step (t1), 2 min at 95°C; t2, 20 s at 95°C; t3, 10 s at 60°C; t4, 25 s at 72°C (t2 to t4, repeated 35 times); and t5, 10 min at 74°C. The total volume of each PCR mixture (KOD Hot Start; Novagen) was 20 μl and contained 0.8 U of KOD polymerase and primers at 0.3 μM.

Fitness cost.

To evaluate whether the emergence of a point mutation(s) in ileS affects the growth of the resulting mutants with low-level resistance, isolates that were exposed to mupirocin as well as their parent strains were grown in MHB overnight in a Tecan Infinite F200pro microtiter plate reader (Tecan, Männedorf, Switzerland). The optical density was assessed and doubling times of susceptible and mupirocin-exposed populations were evaluated during the exponential phase of growth using standard formulae. Ratios of the doubling times were calculated as the doubling time of the susceptible isolate divided by the doubling time of the resistant (or mupirocin-exposed) isolate. To assess whether there was a difference in growth rates, the Wilcoxon signed-rank test was used to determine whether the ratios of the doubling times were significantly different from 1 (19) and the Wilcoxon rank sum test was used to compare the mean ratios of the doubling times of isolates that remained sensitive to the doubling times of those that developed resistance after mupirocin exposure. A two-sided P value of <0.05 was considered statistically significant. The analysis was conducted with STATA V.11.0 (STATA Corp.).

RESULTS

Strain collection and genotyping.

Table 2 summarizes the collection of 24 MRSA strains included in the study. All isolates were susceptible to mupirocin at baseline, and none of the isolates harbored the mupA gene (11) encoding high-level resistance to mupirocin. This panel is representative of human clinical isolates containing common sequence types (STs) from various European countries (ST8, ST5, ST22, and ST228) and the Asia-Pacific region (ST59, ST30, and ST239) as well as community-associated MRSA strains (ST1 and ST152) and the emerging ST398 strain which was originally detected in veterinary isolates (20). This collection encompasses a large diversity of genetics backgrounds and contains the main clones endemic in Europe, the Americas, and Asia.

TABLE 2.

Characteristics of the isolates in the study

Isolate no. Isolate source Sequence type Clonal complex SCCmeca spa type Common name(s) for MRSA clone Epidemiological classificationb agrc pvld Arginine catabolic mobile element (ACME)
1 Geneva, Switzerland ST105 CC5 II t002 New York/Japan related HA 2
2 Geneva, Switzerland ST228 CC5 I t041 Southern German HA 2
3 Geneva, Switzerland ST8 CC8 IVc t008 UK EMRSA-2/UK EMRSA-6; USA500 HA 1
4 Aachen, Germany ST22 CC22 IVh t032 UK EMRSA-15 HA 1
5 Aachen, Germany ST225 CC5 II t045 Rhine-Hesse HA 2
6 Aachen, Germany ST45 CC45 IVd t161 Berlin HA 1
7 Dundee, Scotland ST7 CC7 III t091 No name HA 1
8 Dundee, Scotland ST59 CC59 V t316 Taiwan CA 1
9 Athens, Greece ST80 CC80 IVc t044 European CA 3 Yes
10 Athens, Greece ST30 CC30 IVc t018 Southwest Pacific related CA 3
11 Athens, Greece ST239 CC8 III t037 Brazilian/Hungarian HA 1
12 Athens, Greece ST398 CC398 Vc t011 LA-MRSA LA 1
13 Athens, Greece ST1 CC1 IVa t127 USA400 CA 3
14 Athens, Greece ST36 CC30 II t012 UK EMRSA-16; USA200 HA 3
15 Barcelona, Spain ST125 CC5 IVc t067 Pediatric classical related HA 2
16 Barcelona, Spain ST5 CC5 IVc t002 Pediatric classical; USA 800 HA 2
17 Cremona, Italy ST398 CC398 IVa t034 LA-MRSA LA 1
18 Cremona, Italy ST247 CC8 I t051 Iberian HA 1
19 Paris, France ST5 CC5 I t002 UK EMRSA-3 HA 2
20 Paris, France ST111 CC5 I t001 Southern German related HA 2
21 Belgrade, Serbia ST5 CC5 II t002 New York/Japan; USA100 HA 2
22 Petah Tikva, Israel ST30 CC30 IVa t318 Southwest Pacific related CA 3 Yes
23 Belgrade, Serbia ST152 CC152 V t355 No name CA 1 Yes ACME III (arcA+, lacking opp3)
24 Athens, Greece ST8 CC8 IVa t008 USA300 CA 1 Yes ACME I (arcA+, opp3+)
a

SCCmec, staphylococcal cassette chromosome mec.

b

HA, health care associated; CA, community associated; LA, livestock associated.

c

agr, accessory gene regulator.

d

pvl, Panton-Valentine leukocidin.

Emergence of mutations under selective pressure.

Following growth of strains in MHB containing 0.5 MIC of mupirocin, all isolates showed an increase in MIC after 2 weeks of exposure to the antimicrobial (Table 3). Thirteen isolates (54%) showed an increase in their MICs which remained in the susceptible range (≤4 μg/ml). These isolates were exposed to 0.5 MIC mupirocin for 2 additional weeks. None of these isolates showed an increase in MIC during this second period of exposure. In contrast, 11 isolates developed low-level resistance after the first period of selection pressure, displaying MICs ranging from 6 to 24 μg/ml. Among these isolates, the MIC increased from 0.064 μg/ml to 8 μg/ml in just over half of the isolates (6 strains). In the other 5 strains, a larger increase in the MIC, of up to 24 μg/ml, was seen.

TABLE 3.

Phenotypic and genotypic mupirocin resistance and growth rate comparisons of methicillin-resistant Staphylococcus aureus isolates at baseline and after mupirocin exposure

Isolate no. Result at baseline
Result after mupirocin exposure
Result after further incubation without mupirocin
Ratio of doubling timesa
Mupirocin Etest MIC (μg/ml) Mupirocin phenotype Mupirocin Etest MIC (μg/ml) Mupirocin phenotype Isoleucyl-tRNA synthetase mutation(s) Mupirocin Etest MIC (μg/ml) Isoleucyl-tRNA synthetase mutation(s)
1 0.25 Sensitive 8 Low-level resistant K215R 0.92
2 0.064 Sensitive 8 Low-level resistant S634F 1 S634F 0.88
3 0.25 Sensitive 12 Low-level resistant V588F 16 V588F/I390F 1.22
4 0.25 Sensitive 4 Sensitive G593V 1.34
5 0.38 Sensitive 24 Low-level resistant I390F/V588F 0.95
6 0.38 Sensitive 1.5 Sensitive ND
7 0.25 Sensitive 1.5 Sensitive I633F ND
8 0.25 Sensitive 1.5 Sensitive K433Q/H490Y/R632S/A811S 1.16
9 0.25 Sensitive 16 Low-level resistant K215R/N256G/R305T/V631F 4 N256G/V631F 0.99
10 0.25 Sensitive 3 Sensitive S634F ND
11 0.25 Sensitive 1 Sensitive S634F ND
12 0.19 Sensitive 8 Low-level resistant D313Y/Q421H/V588F 1.07
13 0.38 Sensitive 2 Sensitive A59T/E544K/P670T 0.87
14 0.38 Sensitive 1.5 Sensitive 0.82
15 0.38 Sensitive 6 Low-level resistant K215R/V631F 1.10
16 0.38 Sensitive 6 Low-level resistant V588F 0.82
17 0.38 Sensitive 4 Sensitive D313Y/Q421H/W431G ND
18 0.38 Sensitive 1.5 Sensitive 0.92
19 0.38 Sensitive 24 Low-level resistant S634F 2 S634F/L674Y/V677W 1.20
20 0.38 Sensitive 2 Sensitive ND
21 0.38 Sensitive 1 Sensitive ND
22 0.38 Sensitive 6 Low-level resistant V631F 1.10
23 0.25 Sensitive 16 Low-level resistant A223V/G593V 4 A223V/G593D 1.22
24 0.38 Sensitive 2 Sensitive 1.10
a

The ratio was calculated as the doubling time of the susceptible isolate not exposed to mupirocin divided by the doubling time of the resistant (or mupirocin-exposed) isolate. There was no significant difference in the doubling times of isolates before and after mupirocin exposure (P = 0.33). ND, not determined.

After sequencing and assembly of the whole ileS gene using the 8 sequencing primers (Table 1), all low-level-resistant isolates contained at least 1 point mutation in ileS. Most of the resistant strains showed 1 to 2 mutations, with 1 resistant strain showing 4 point mutations. No mutations in the ileS gene were observed in the isolates from cultures of the primary (susceptible) strain incubated in parallel without mupirocin. The most frequent mutations were V588F, S634F, and V631F, yielding increases from a MIC of 0.064 to MICs of 6 to 24 μg/ml. The strain which acquired four mutations had an MIC of 16 μg/ml but was not the strain with the highest MIC identified in our study. Seven of 13 isolates that remained sensitive after exposure to mupirocin developed mutations in their ileS gene. These mutations differed but did not include the frequently observed V588F mutation.

Stability of mutations in the absence of selection pressure.

In a sample of five isolates showing low-level mupirocin resistance that were selected to assess the stability of the mutations, all mutations detected after the first period of mupirocin exposure persisted even after a prolonged period of growth in the absence of mupirocin (Table 3). Four of 5 strains reverted to a sensitive phenotype with an MIC less than or equal to 4 μg/ml. However, the previously detected mutations were still present in these now phenotypically sensitive isolates. Interestingly, in two of these isolates, additional mutations were detected.

Fitness cost.

No significant fitness cost was demonstrated in the isolates that developed resistance after exposure to mupirocin (Table 3). Comparison of the growth rates of the original susceptible isolates, subsequent generations of isolates showing low-level mupirocin resistance, and susceptible revertants demonstrated only marginal (1% to 34%), nonsignificant differences in doubling times (P = 0.33). In addition, there was no significant difference in the mean ratios of the doubling times of isolates that remained mupirocin sensitive (mean, 1.04; standard deviation [SD], 0.20; range, 0.82 to 1.34) to the doubling times of those that developed mupirocin resistance (mean, 1.04; SD, 0.14; range, 0.82 to 1.22) after exposure to the antibiotic (P = 0.76).

DISCUSSION

Our study found that all MRSA strains exposed to mupirocin in vitro developed an increase in mupirocin MIC and that the development of resistance mutations was common, rapid, and stable. This is a concern, as recent evidence supporting the use of decolonization therapy as an intervention to reduce health care-associated infections (3, 18) will likely lead to an increase in mupirocin use. Mupirocin selection pressure was the driver of resistance mutations in our MRSA isolates. In contrast to a previous report of the emergence of the N213D mutation without exposure to mupirocin (21), no spontaneous mutations were detected in our study in the absence of the drug. In the nasal mucosa, where concentrations of the antibiotic are likely to be high (about 20,000 μg/ml with 2% mupirocin), the induction of resistance mutations may be uncommon. However, there have been reports of resistance developing in the pharynx in patients who have undergone nasal decolonization with mupirocin (22). Pharyngeal concentrations of the antibiotic are less predictable, and subinhibitory levels may promote resistance. Similar effects may be seen when mupirocin is used on the skin or at catheter exit sites. Indeed, widespread community use of mupirocin on the skin is thought to have contributed to the increase in mupirocin resistance in some regions (23).

Detection of mutations was common after exposure to mupirocin, seen in 75% (18 of 24 sequences) of our isolates, with the development of a phenotype of low-level resistance in 46% (11 of 24) of the isolates. The most frequent mutations observed in our study were V588F, which is well recognized for its association with low-level resistance (10), and V631F. We identified two hot spots, covering the protein sequences between amino acids 200 to 350 and amino acids 450 to 650, in which most mutations were located. The region of the IleS protein around amino acid 600 was particularly variable, as demonstrated by our ability to detect mutations at positions 588, 593, 631, 632, 633, and 634 among our 24 strains. This part of the protein is in the region of the Rossman fold which contains the active site responsible for the biological activity of the protein (10, 21). Many of the mutations affecting the Rossman fold have previously been well characterized, and a number of mutations that we detected have been associated with reduced mupirocin susceptibility in prior studies (10).

Reversion to the wild type is described when selection pressure is removed. Previous ecological studies have demonstrated a reduction in mupirocin resistance after restriction of its use at an institutional level (24). In our sample of five isolates that developed low-level resistance due to the acquisition of point mutations previously shown to alter susceptibility, four tested sensitive after incubation without mupirocin. However, it was concerning that the point mutations in these isolates persisted despite subsequent growth in the absence of the antibiotic, and there was accumulation of additional mutations in two isolates. The importance of these additional mutations is unclear as they did not lead to significant increases in mupirocin MIC. However, this observation may indicate that strains with low-level resistance are more prone to the development of spontaneous mutations. For strains that reverted to the sensitive phenotype despite the persistence of resistance mutations, the presence of mupirocin may be required to induce expression of the mutations. In these strains, phenotypic tests for mupirocin resistance may not predict resistance when exposure to the antibiotic occurs in vivo. Thus, in settings where mupirocin use is relatively common and accumulation of resistance mutations in circulating MRSA strains may be expected, genotypic tests for resistance may be more reliable than phenotypic tests.

We found no significant fitness cost associated with the resistance mutations. Previous studies have documented loss of fitness specific to certain mutations. In a recent paper, Mongkolrattanothai and colleagues recorded some alteration of growth rate in strains harboring the V588F mutation (25). Previous investigations have also shown that common mutations associated with low-level resistance, including V588F, may have a small effect on growth rate but that accumulation of further mutations that lead to higher levels of resistance can significantly decrease fitness (26). This suggests that there may be a selective advantage for MRSA strains with low-level resistance in facilities where mupirocin is commonly used.

We detected low-level resistance rather than high-level resistance. Although the clinical relevance of high-level resistance has been recognized for some time, there is recent evidence to suggest that low-level resistance is also associated with a reduction in effectiveness of this antibiotic with respect to eradicating MRSA carriage (9, 17, 27). Note that the mutations which resulted in low-level resistance emerged rapidly, within days of exposure to subinhibitory concentrations of the antibiotic. Although previous reports identified prolonged exposure to mupirocin as a risk factor for resistance (8), our data suggest that even a single short treatment course is sufficient to induce clinically relevant resistance mutations.

Not all mutations detected in ileS result in low-level mupirocin resistance. Certain mutations, including N213D, have been described in isolates and are thought to have no effect on the function of the enzyme (21). The ST59 isolate in our study exhibited an increase in its MIC from 0.25 μg/ml to 1.5 μg/ml but remained in the susceptible range despite the acquisition of four point mutations, demonstrating that the number of mutations did not correlate with the level of resistance. We found that the same mutations could correspond to phenotypes of sensitivity or low-level resistance in different isolates. The S634F mutation, for example, was detected in MRSA isolates with drug MICs ranging from 1 to 24 μg/ml. This again highlights that some isolates that have previously been exposed to sub-MICs of mupirocin may test susceptible despite harboring resistance mutations. However, it is possible that these MRSA strains may become phenotypically resistant after repeated exposure to the antibiotic.

We studied diverse strains of MRSA belonging to the most common clonal complexes in human isolates. We detected the V588F mutation in different genetic backgrounds, including CC398 and various STs from CC8, and noted that it was particularly frequent in CC5 isolates, including our dominant ST228 clone (11). Isolates from CC5 also developed a diverse range of other mutations, while those from CC398 were more homogeneous. Strains in these clonal complexes rapidly developed resistance after a single selection cycle. In contrast, we were not able to induce resistance in strains from all sequence types (e.g., ST247, ST45, and ST36). We noted that the USA300 isolate in our study did not develop mutations conferring low-level resistance after prolonged exposure to mupirocin. Although previous studies found that 20% of USA300 isolates were mupirocin resistant, the resistance was plasmid-mediated high-level resistance (28). It is possible that the USA300 strain has a higher barrier to the development of chromosomal mutations leading to low-level resistance. These strain differences may account for the predominance of high-level rather than low-level resistance in the United States (29) and predict variation in the longer-term effectiveness of topical mupirocin in different geographical settings. Our collection contained only one USA300 isolate (from Greece). Further studies, including a larger number of isolates of this strain type, particularly in the United States, where this strain is dominant, may be warranted. Our findings are consistent with the published literature, which reports that low-level mupirocin resistance occurs more frequently in MRSA strains belonging to certain clonal complexes (including various STs from CC5 and CC8) than in those belonging to other clonal complexes, suggesting that specific genome content may be associated with the stability of ileS in S. aureus exposed to mupirocin.

In conclusion, MRSA strains exposed to mupirocin in vitro develop rapid and persistent mutations associated with low-level resistance. Strains with these mutations do not exhibit significant fitness loss; therefore, there is potential for these strains to emerge as the dominant clone in institutions with ongoing and widespread use of mupirocin. Resistance mutations may be more common in certain clones but can be seen in MRSA strains with a variety of genetic backgrounds; thus, emergence of resistance associated with routine use of this antibiotic is likely to be a widespread problem. The clinical benefits of mupirocin need to be balanced with these data, which demonstrate the ease with which resistance occurs. In order to retain the clinical utility of mupirocin for staphylococcal eradication therapy, it is necessary to implement rational prescribing policies. These policies should be coupled with long-term surveillance for the emergence of genotypic and phenotypic resistance as well as ongoing monitoring of the clinical effectiveness of this antibiotic.

ACKNOWLEDGMENTS

A.S.L. was supported by the European Commission under the Life Science Health Priority of the 6th Framework Program (MOSAR network contract LSHP-CT-2007-037941). The cost of this work was supported by EuroStars project E!7916 (to P.F.).

S.H. has received a peer-reviewed research grant funded by Pfizer; he is also a member of the advisory board of Destiny Pharma, bioMérieux, and DaVolterra.

Footnotes

Published ahead of print 13 August 2014

REFERENCES

  • 1.Datta R, Huang SS. 2008. Risk of infection and death due to methicillin-resistant Staphylococcus aureus in long-term carriers. Clin. Infect. Dis. 47:176–181. 10.1086/589241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.von Eiff C, Becker K, Machka K, Stammer H, Peters G. 2001. Nasal carriage as a source of Staphylococcus aureus bacteremia. N. Engl. J. Med. 344:11–16. 10.1056/NEJM200101043440102 [DOI] [PubMed] [Google Scholar]
  • 3.Bode LG, Kluytmans JA, Wertheim HF, Bogaers D, Vandenbroucke-Grauls CM, Roosendaal R, Troelstra A, Box AT, Voss A, van der Tweel I, van Belkum A, Verbrugh HA, Vos MC. 2010. Preventing surgical-site infections in nasal carriers of Staphylococcus aureus. N. Engl. J. Med. 362:9–17. 10.1056/NEJMoa0808939 [DOI] [PubMed] [Google Scholar]
  • 4.Schweizer M, Perencevich E, McDanel J, Carson J, Formanek M, Hafner J, Braun B, Herwaldt L. 2013. Effectiveness of a bundled intervention of decolonization and prophylaxis to decrease Gram positive surgical site infections after cardiac or orthopedic surgery: systematic review and meta-analysis. BMJ 346:f2743. 10.1136/bmj.f2743 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Harbarth S. 2006. Control of endemic methicillin-resistant Staphylococcus aureus–recent advances and future challenges. Clin. Microbiol. Infect. 12:1154–1162. 10.1111/j.1469-0691.2006.01572.x [DOI] [PubMed] [Google Scholar]
  • 6.Simor AE. 2011. Staphylococcal decolonisation: an effective strategy for prevention of infection? Lancet Infect. Dis. 11:952–962. 10.1016/S1473-3099(11)70281-X [DOI] [PubMed] [Google Scholar]
  • 7.Hurdle JG, O'Neill AJ, Mody L, Chopra I, Bradley SF. 2005. In vivo transfer of high-level mupirocin resistance from Staphylococcus epidermidis to methicillin-resistant Staphylococcus aureus associated with failure of mupirocin prophylaxis. J. Antimicrob. Chemother. 56:1166–1168. 10.1093/jac/dki387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Patel JB, Gorwitz RJ, Jernigan JA. 2009. Mupirocin resistance. Clin. Infect. Dis. 49:935–941. 10.1086/605495 [DOI] [PubMed] [Google Scholar]
  • 9.Lee AS, Macedo-Vinas M, Francois P, Renzi G, Schrenzel J, Vernaz N, Pittet D, Harbarth S. 2011. Impact of combined low-level mupirocin and genotypic chlorhexidine resistance on persistent methicillin-resistant Staphylococcus aureus carriage after decolonization therapy: a case-control study. Clin. Infect. Dis. 52:1422–1430. 10.1093/cid/cir233 [DOI] [PubMed] [Google Scholar]
  • 10.Thomas CM, Hothersall J, Willis CL, Simpson TJ. 2010. Resistance to and synthesis of the antibiotic mupirocin. Nat. Rev. Microbiol. 8:281–289. 10.1038/nrmicro2278 [DOI] [PubMed] [Google Scholar]
  • 11.Lee AS, Macedo-Vinas M, Francois P, Renzi G, Vernaz N, Schrenzel J, Pittet D, Harbarth S. 2011. Trends in mupirocin resistance in meticillin-resistant Staphylococcus aureus and mupirocin consumption at a tertiary care hospital. J. Hosp. Infect. 77:360–362. 10.1016/j.jhin.2010.11.002 [DOI] [PubMed] [Google Scholar]
  • 12.Wysmolinska A, Orczykowska-Kotyna M, Komorowska I, Kozinska A, Empel J, Lee A, Harbarth S, Malhotra-Kumar S, Goossens H, Hryniewicz W. 2012. Clonal structure of MRSA isolates from surgical wards in Europe and Israel. Abstr. 22nd Eur. Cong. Clin. Microbiol. Infect. Dis., abstr 0266 [Google Scholar]
  • 13.Francois P, Huyghe A, Charbonnier Y, Bento M, Herzig S, Topolski I, Fleury B, Lew D, Vaudaux P, Harbarth S, van Leeuwen W, van Belkum A, Blanc DS, Pittet D, Schrenzel J. 2005. Use of an automated multiple-locus, variable-number tandem repeat-based method for rapid and high-throughput genotyping of Staphylococcus aureus isolates. J. Clin. Microbiol. 43:3346–3355. 10.1128/JCM.43.7.3346-3355.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Koessler T, Francois P, Charbonnier Y, Huyghe A, Bento M, Dharan S, Renzi G, Lew D, Harbarth S, Pittet D, Schrenzel J. 2006. Use of oligoarrays for characterization of community-onset methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 44:1040–1048. 10.1128/JCM.44.3.1040-1048.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. 2000. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38:1008–1015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mody L, Kauffman CA, McNeil SA, Galecki AT, Bradley SF. 2003. Mupirocin-based decolonization of Staphylococcus aureus carriers in residents of 2 long-term care facilities: a randomized, double-blind, placebo-controlled trial. Clin. Infect. Dis. 37:1467–1474. 10.1086/379325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Simor AE, Phillips E, McGeer A, Konvalinka A, Loeb M, Devlin HR, Kiss A. 2007. Randomized controlled trial of chlorhexidine gluconate for washing, intranasal mupirocin, and rifampin and doxycycline versus no treatment for the eradication of methicillin-resistant Staphylococcus aureus colonization. Clin. Infect. Dis. 44:178–185. 10.1086/510392 [DOI] [PubMed] [Google Scholar]
  • 18.Huang SS, Septimus E, Kleinman K, Moody J, Hickok J, Avery TR, Lankiewicz J, Gombosev A, Terpstra L, Hartford F, Hayden MK, Jernigan JA, Weinstein RA, Fraser VJ, Haffenreffer K, Cui E, Kaganov RE, Lolans K, Perlin JB, Platt R, CDC Prevention Epicenters Program; AHRQ DECIDE Network and Healthcare-Associated Infections Program 2013. Targeted versus universal decolonization to prevent ICU infection. N. Engl. J. Med. 368:2255–2265. 10.1056/NEJMoa1207290 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.O'Reilly T, Zak O. 1992. Elevated body temperature restricts growth of Haemophilus influenzae type b during experimental meningitis. Infect. Immun. 60:3448–3451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.van der Mee-Marquet N, François P, Domelier-Valentin AS, Coulomb F, Decreux C, Hombrock-Allet C, Lehiani O, Neveu C, Ratovohery D, Schrenzel J, Quentin R; Bloodstream Infection Study Group of Réseau des Hygiénistes du Centre (RHC). 2011. Emergence of unusual bloodstream infections associated with pig-borne-like Staphylococcus aureus ST398 in France. Clin. Infect. Dis. 52:152–153. 10.1093/cid/ciq053 [DOI] [PubMed] [Google Scholar]
  • 21.Antonio M, McFerran N, Pallen MJ. 2002. Mutations affecting the Rossman fold of isoleucyl-tRNA synthetase are correlated with low-level mupirocin resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 46:438–442. 10.1128/AAC.46.2.438-442.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Watanabe H, Masaki H, Asoh N, Watanabe K, Oishi K, Kobayashi S, Sato A, Sugita R, Nagatake T. 2001. Low concentrations of mupirocin in the pharynx following intranasal application may contribute to mupirocin resistance in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 39:3775–3777. 10.1128/JCM.39.10.3775-3777.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Upton A, Lang S, Heffernan H. 2003. Mupirocin and Staphylococcus aureus: a recent paradigm of emerging antibiotic resistance. J. Antimicrob. Chemother. 51:613–617. 10.1093/jac/dkg127 [DOI] [PubMed] [Google Scholar]
  • 24.Walker ES, Levy F, Shorman M, David G, Abdalla J, Sarubbi FA. 2004. A decline in mupirocin resistance in methicillin-resistant Staphylococcus aureus accompanied administrative control of prescriptions. J. Clin. Microbiol. 42:2792–2795. 10.1128/JCM.42.6.2792-2795.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mongkolrattanothai K, Pumfrey L, Mankin P, Gray BM. 2009. Acquisition of high-level mupirocin resistance and its fitness cost among methicillin-resistant Staphylococcus aureus strains with low-level mupirocin resistance. J. Clin. Microbiol. 47:4158–4160. 10.1128/JCM.01022-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hurdle JG, O'Neill AJ, Ingham E, Fishwick C, Chopra I. 2004. Analysis of mupirocin resistance and fitness in Staphylococcus aureus by molecular genetic and structural modeling techniques. Antimicrob. Agents Chemother. 48:4366–4376. 10.1128/AAC.48.11.4366-4376.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Walker ES, Vasquez JE, Dula R, Bullock H, Sarubbi FA. 2003. Mupirocin-resistant, methicillin-resistant Staphylococcus aureus: does mupirocin remain effective? Infect. Control Hosp. Epidemiol. 24:342–346. 10.1086/502218 [DOI] [PubMed] [Google Scholar]
  • 28.Diep BA, Gill SR, Chang RF, Phan TH, Chen JH, Davidson MG, Lin F, Lin J, Carleton HA, Mongodin EF, Sensabaugh GF, Perdreau-Remington F. 2006. Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet 367:731–739. 10.1016/S0140-6736(06)68231-7 [DOI] [PubMed] [Google Scholar]
  • 29.Biedenbach DJ, Bouchillon SK, Johnson SA, Hoban DJ, Hackel M. 2014. Susceptibility of Staphylococcus aureus to topical agents in the United States: a sentinel study. Clin. Ther. 36:953–960. 10.1016/j.clinthera.2014.04.003 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES