Purification and X-ray crystallographic analysis of 7-keto-8-aminopelargonic acid (KAPA) synthase from Mycobacterium smegmatis

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of 7-keto-8-aminopelargonic acid (KAPA) synthase from M. smegmatis are described..

Abstract

7-Keto-8-aminopelargonic acid synthase (KAPA synthase; BioF) is an essential enzyme for mycobacterial growth that catalyses the first committed step in the biotin-synthesis pathway. It is a pyridoxal 5′-phosphate (PLP)-dependent enzyme and is a potential drug target. Here, the cloning, expression, purification and crystallization of KAPA synthase from Mycobacterium smegmatis (MsBioF) and the characterization of MsBioF crystals using X-ray diffraction are described. The crystals diffracted to 2.3 Å resolution and belonged to the monoclinic space group P2₁, with unit-cell parameters a = 70.88, b = 91.68, c = 109.84 Å, β = 97.8°. According to the molecular weight of MsBioF, the unit-cell parameters and the self-rotation function map, four molecules are present in each asymmetric unit with a V _M value of 2.06 ų Da⁻¹ and a solvent content of 40.20%.

1. Introduction  

Mycobacterium tuberculosis (Mtb) is one of the most important human pathogens. In recent years, the emergence and spread of MDR (multidrug-resistant) and XDR (extensively drug-resistant) Mtb and co-infection of Mtb with HIV has resulted in a worldwide epidemic of tuberculosis (TB), making the treatment and control of TB problematic (Almeida Da Silva & Palomino, 2011 ▶). The development of new anti-TB drugs has thus become particularly important and urgent. Owing to the importance of biotin in cell-wall synthesis in mycobacteria (Oh et al., 2006 ▶; Kurth et al., 2009 ▶) and the absence of the biotin-synthesis pathway in mammals, which must obtain biotin through food intake and the action of gut bacteria (Said, 2009 ▶), the biotin-biosynthesis pathway is an attractive target for the design of antituberculosis inhibitors.

The biotin-synthesis pathway encompasses the synthesis of the precursor molecule pimeloyl-CoA (or pimeloyl-ACP; Lin et al., 2010 ▶) and four subsequent committed steps which are conserved in all biotin-synthesizing organisms. KAPA synthase (BioF) plays a key role as the ‘gatekeeper’ of the pathway, catalyzing the first committed step: decarboxylative condensation of l-alanine with pimeloyl-CoA to form 7-keto-8-aminopelargonic acid (AON). Pyridoxal 5′-phosphate (PLP) is an essential cofactor in this reaction (Alexeev et al., 1998 ▶; Ploux & Marquet, 1996 ▶; Ploux et al., 1992 ▶). The structure and function of 7-keto-8-aminopelargonic acid synthase (EcAONS) in Escherichia coli has been well studied (Alexeev et al., 1998 ▶; Webster et al., 2000 ▶).

It has been reported that there are significant differences in the enzymes involved in the biotin-synthesis pathway between Mtb and other organisms (Dey et al., 2010 ▶). Although it has been reported that bioF (Rv1569) is required for the survival of Mtb in vitro (Dey et al., 2010 ▶) and for infection in mice (Sassetti & Rubin, 2003 ▶), the structure and catalytic methanism of BioF in mycobacteria have yet to be resolved. Structural studies of mycobacterial KAPA synthase are of great biochemical interest for establishing the mechanism of the enzyme as well as for the possible development of new antibiotics against mycobacteria. This communication reports the cloning, purification, crystallization, data collection and initial diffraction data analysis of BioF from M. smegmatis (MsBioF), which shares 76% sequence identity with its Mtb homologue Rv1569.

2. Materials and methods  

2.1. Macromolecule production  

The MSMEG_3189 (MsbioF) gene was amplified from the chromosomal DNA of M. smegmatis using the polymerase chain reaction (PCR). The PCR product was then cloned into pET-28a (Invitrogen) with His₆ at the N-terminus using the NdeI and EcoRI restriction sites and was confirmed by DNA sequencing. The resulting expression vector pET-28a:MsbioF was transformed into E. coli strain BL21 (DE3) and the cells were grown in LB medium containing 30 µg ml⁻¹ kanamycin (Table 1 ▶). The transformed E. coli BL21 (DE3) cells were grown in the presence of 30 µg ml⁻¹ kanamycin at 310 K until the OD₆₀₀ reached 0.6–0.7. Expression of the protein was induced with 0.1 mM IPTG for 12 h at 289 K in order to maximize the yield of soluble protein. Cells were harvested from a 2 l culture by centrifugation before lysis in buffer A (20 mM Tris–HCl pH 7.9, 500 mM NaCl, 5 mM imidazole, 2 mM β-mercaptoethanol) by ultrasonication. After removal of insoluble debris by centrifugation, the supernatant was applied onto an Ni–NTA (Novagen) column at 4°C and the protein was eluted with buffer B (20 mM Tris–HCl pH 7.9, 500 mM NaCl, 200 mM imidazole, 2 mM β-mercaptoethanol). The eluted protein was loaded onto a HiPrep 26/10 Desalting Column (GE Healthcare Biosciences) to decrease the concentration of NaCl, and the protein was eluted using buffer C (20 mM Tris–HCl pH 7.9, 50 mM NaCl, 2 mM DTT). Fractions containing MsBioF were pooled and loaded onto a HiTrap Q Sepharose anion-exchange column (GE Healthcare Biosciences) pre-equilibrated with buffer B. The pure protein was eluted with a linear salt gradient (0–1 M NaCl) over 20 column volumes. The eluted protein was subjected to size-exclusion chromatography using a Superdex 200 10/300 GL column (GE Healthcare Biosciences) equilibrated with buffer D (20 mM Tris–HCl pH 7.9, 100 mM NaCl, 2 mM DTT) on an ÄKTAprime Plus system (GE Healthcare Biosciences). The purified protein was concentrated to 5 mg ml⁻¹. The molecular weight and purity of the protein were checked on a 12% SDS–PAGE gel (Fig. 1 ▶).

Table 1. Macromolecule-production information.

Source organism	M. smegmatis MC2 155
DNA source	The genome of M. smegmatis
Forward primer†	GGAATTCCATATGGTGACGCGCGCAGGTCTTTCAC
Reverse primer‡	CCGGAATTCTCATGCCCGCGCGGTGGCGAG
Cloning vector	pET-28a
Expression vector	pET-28a:MsbioF
Expression host	E. coli BL21 (DE3)
Complete amino-acid sequence of the construct produced	MGSSHHHHHHSSGLVPRGSHMMTRAGLSPLAWLADIEQRRRAEGLRRELRVRPPVAAELDLASNDYLGLSQHPDVLDGGVEALRTWGGGAGGSRLVTGNTELHEAFEHQLASFLGAESALVFSSGYTANLGALVALSGPGSLIVSDALSHASLVDACRLSRARVVVSPHRDVDAVDAALAARTEERAVVVTESVFSADGDLAPLRDLHAVCRRHGALLLVDEAHGLGVRGTRGQGLLHEVGLAGAPDIVMTTTLSKALGSQGGAVLGPEAVRAHLIDTARSFIFDTGLAPAAVGAASAALRVLDAEPQRARAVLDRAAELATIAGVTEAPVSAVVSVILGDPEIAVGAAAACLDRGVRVGCFRPPTVPAGTSRLRLAARASLTDDEMALARQVLTDVLATARA

^†The NdeI site is underlined.

^‡The EcoRI site is underlined.

Figure 1.

SDS–PAGE of purified MsBioF protein, confirming its molecular weight of 42 kDa. Lane M, molecular-weight markers (labelled in kDa); lane 1, MsBioF protein purified on an Ni–NTA (Novagen) column; lane 2, crude MsBioF protein sample after concentration; lane 3, MsBioF protein successively purified by HiTrap Q Sepharose anion-exchange chromatography and gel-filtration chromatography

2.2. Crystallization  

Initial crystallization conditions for the purified protein were screened using Crystal Screen and Crystal Screen 2 (Hampton Research, USA; Table 2 ▶). Crystals were obtained after one week under three conditions: (i) 0.1 M Tris pH 8.5, 25%(w/v) polyethylene glycol 3350, (ii) 0.2 M ammonium sulfate, 0.1 M HEPES pH 7.5, 25%(w/v) polyethylene glycol 3350 and (iii) 0.15 M dl-malic acid pH 7.0, 20%(w/v) polyethylene glycol 3350. Diffraction-quality crystals were obtained on further optimization of condition (iii) (Fig. 2 ▶). These crystals all appeared in 7 d and diffraction-quality crystals reached maximum dimensions (0.3 mm) in 14 d.

Table 2. Crystallization.

Method	Hanging-drop vapour diffusion
Plate type	16-well hanging-drop plate
Temperature (K)	298
Protein concentration (mgml1)	5
Buffer composition of protein solution	20mM TrisHCl pH 7.9, 100mM NaCl, 2mM DTT
Composition of reservoir solution	150mM DL-malic acid pH 7.4, 100mM NaCl, 25% PEG 3350
Volume and ratio of drop	2l (1:1)
Volume of reservoir (l)	200

Figure 2.

MsBioF crystals grown using the hanging-drop method in 150 mM dl-malic acid pH 7.4, 100 mM NaCl, 25% PEG 3350.

2.3. Data collection and processing  

Prior to the collection of diffraction data, crystals were quickly transferred to corresponding cryoprotectant solutions containing 5%(v/v) glycerol and were then flash-cooled in liquid nitrogen. Diffraction data were collected from a single crystal at a wavelength of 0.9795 Å (Fig. 3 ▶). The data from 360 images were processed using MOSFLM (v.7.0.4; Leslie, 2006 ▶) and SCALA (v.6.0) from the CCP4 program suite (Winn et al., 2011 ▶). Final data-collection and processing statistics are given in Table 3 ▶.

Figure 3.

Diffraction pattern collected from MsBioF crystals. The oscillation width was 1° and the exposure time was 1 s.

Table 3. MsBioF diffraction data collection and processing.

Values in parentheses are for the outer shell.

Diffraction source	Beamline BL17U, SSRF
Wavelength ()	0.9795
Temperature (K)	100
Detector	ADSC Quantum 315 CCD
Crystal-to-detector distance (mm)	350
Rotation range per image ()	1
Total rotation range ()	360
Exposure time per image (s)	1
Space group	P21
a, b, c ()	70.88, 91.68, 109.84
, , ()	90.0, 97.8, 90.0
Mosaicity ()	0.75
Resolution range ()	63.032.30 (2.422.30)
Total No. of reflections	428697 (58947)
No. of unique reflections	61286 (8828)
Completeness (%)	98.9 (98.1)
Multiplicity	7.0 (6.7)
I/(I)	10.6 (4.9)
R r.i.m. † (%)	11.9 (37.6)
Overall B factor from Wilson plot (2)	36.6

^† R _r.i.m. = , where I _i(hkl) is the intensity of the ith measurement of reflection hkl, is the sum over the individual measurements of a reflection and is the sum over all reflections.

3. Results and discussion  

The biotin-synthesis pathway is a potential source of antituberculosis drug targets. The structure and catalytic mechanism of mycobacterial BioF (Rv1569), which catalyses the first committed step in the biotin-synthesis pathway, has not been studied in detail. Here, MsbioF, the M. smegmatis homologue of Rv1569, was successfully cloned, expressed, purified and crystallized. We first cloned the MsbioF gene into a pET-28a plasmid with a 6×His tag at its N-terminus and transformed the expression vector pET-28a:MsbioF into E. coli BL21 (DE3) cells. The integrity of the gene and its transformation were validated by PCR and sequencing, and the expression of MsBioF was confirmed by Western blotting of the synthesized gene product using an anti-His tag monoclonal antibody. The expressed protein was then successively purified using Ni–NTA column chromatography, a desalting column and anion-exchange and gel-filtration chromatography. Protein purity was assessed on a 12% SDS–PAGE gel. The molecular weight of MsBioF was 42 kDa, the same as its predicted size, and the purity of the protein was greater than 95% (Fig. 1 ▶). Diffraction data were collected from a single crystal which was crystallized using 150 mM dl-malic acid pH 7.4, 100 mM NaCl, 25% PEG 3350 (Fig. 2 ▶). The diffraction resolution was 2.3 Å (Fig. 3 ▶). Data processing revealed that the crystal belonged to the monoclinic space group P2₁, with unit-cell parameters a = 70.88, b = 91.68, c = 109.84 Å, α = 90.0, β = 97.8, γ = 90.0°. According to the molecular weight of MsBioF and the unit-cell parameters, solvent-content analysis indicated that there were either three or four molecules per asymmetric unit, with V _M values (calculated according to Matthews, 1968 ▶) of 2.74 and 2.06 ų Da⁻¹, respectively, and solvent contents of 55.15 and 40.20%, respectively. Calculation of the self-rotation function (Fig. 4 ▶) indicated the presence of at least one noncrystallographic twofold symmetry axis along the x or z axis, suggesting that there should be an even number of molecules, i.e. two or four molecules, per asymmetric unit. In addition, it has been reported that EcAONS is a dimer (Alexeev et al., 1998 ▶), implying that most likely all of the bacterial homologues are obligate dimers. It is thus likely that there are four rather than three MsBioF molecules per asymmetric unit. Based on both the Matthews coefficient and the self-rotation function, and the previous report for EcAONS, we propose that there are four molecules per asymmetric unit, with a V _M value of 2.06 ų Da⁻¹ and a solvent content of 40.20%. Further structural refinement is currently under way.

Figure 4.

Self-rotation function map at χ = 180° calculated from the diffraction data, showing at least one NCS twofold axis along the x or z directions. This figure was generated using MOLREP (Vagin & Teplyakov, 2010 ▶).