Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Oct 1.
Published in final edited form as: Br J Haematol. 2014 Jun 25;167(2):281–285. doi: 10.1111/bjh.12983

Molecular Subtype Classification of Formalin-Fixed, Paraffin-Embedded Diffuse Large B-Cell Lymphoma Samples on the ICEPlex® System

Angela M B Collie 1, Jörk Nölling 2, Kiran M Divakar 3, Jeffrey J Lin 1, Paula Carver 1, Lisa M Durkin 1, Brian T Hill 4, Mitchell R Smith 4, Tomas Radivoyevitch 5, Lilly I Kong 3, Thomas Daly 1, Gurunathan Murugesan 1, Jeanna Guenther-Johnson 1, Sandeep S Dave 6, Elena A Manilich 7, Eric D Hsi 1
PMCID: PMC4188713  NIHMSID: NIHMS601016  PMID: 24961756

Microarray gene expression profiling (GEP) has been used to identify molecular subtypes of diffuse large B-cell lymphoma (DLBCL) based on the similarity of GEP to a putative “cell of origin” (COO) and defines two molecular subtypes: activated B-cell-like (ABC) DLBCL and germinal centre B-cell-like (GCB) DLBCL (Alizadeh, et al 2000). This dichotomization has prognostic and biological significance, with the ABC subtype having a worse outcome and distinct pathobiology that includes activation of the B-cell receptor and nuclear factor (NF)-κB pathways (Lenz, et al 2008). Attempts to reduce this subclassification to practice using immunohistochemistry are fraught with technical and interpretive issues such that a need for practical quantitative molecular assays exists (Coutinho, et al 2013, de Jong, et al 2007, de Jong, et al 2009, Salles, et al 2011). Indeed, studies have refined this COO concept using limited gene sets, including a 14-gene model to assign ABC and GCB DLBCL subtype developed by Wright et al (2003) as well as a recently-described DLBCL subtyping assay based on parsimonious digital gene expression (Nanostring) technology (Scott, et al 2014). In order to support clinical trials for therapies targeting populations enriched in ABC DLBCL and to offer prognostic information for DLBCL patients as part of our clinical service, we developed a novel multiplex, single-tube, gene expression assay on the ICEPlex® system (PrimeraDx, Mansfield, MA), which allows differentiation between GCB and ABC DLBCL subtypes in formalin-fixed paraffin-embedded (FFPE) specimens using a Food and Drug Administration-cleared platform.

Institutional review board approval was obtained for review of newly diagnosed DLBCL specimens at our institution. Paired frozen tissue was available for 30 patients and was used to isolate RNA for hybridization to U219 (27 samples) or U133plus2.0 (3 samples) Affymetrix microarrays. Microarray subtype classification was assigned based on the Wright algorithm, which calculates a linear predictor score (LPS) by multiplying a gene weight and Ct value for each gene and summing the resulting numbers for 14 genes (Wright, et al 2003). Samples with LPS above -150 were classified as GCB, scores between -150 and -200 were unclassified, and scores less than -200 were classified as ABC.

A multiplex quantitative reverse transcription polymerase chain reaction (RT-PCR) DLBCL subtyping assay was developed on the ICEPlex system (PrimeraDx), targeting expression of the 14 genes used in the Wright algorithm, two reference genes and an internal control (enterobacteriophage MS2) (Table I) (Hlousek, et al 2012). Primers were designed to amplify short template mRNA regions of exon-spanning junctions. To allow discrimination of target-specific amplicons on the ICEPlex platform by fluorescent label and by size using capillary electrophoresis, PCR reverse primers were labelled with FAM or TYE fluorescent dyes, and forward and reverse PCR primers were equipped with 5′-nucleotide tags. RNA was extracted from a 10-μm FFPE slice of a DLBCL specimen using the Qiagen Allprep DNA/RNA FFPE kit (Germantown, MD). cDNA was generated using SuperScript III (Life Technologies, Grand Island, NY) and RT primers. PCR was performed in triplicate for each 10-μm FFPE slice on the ICEPlex system with Roche AptaTaq ΔExo polymerase (Indianapolis, IN), proprietary buffer (PrimeraDx), and primers. The resulting Ct values were normalized for each replicate and averaged for each gene. The integrity of the results was evaluated using a quality (Q) score calculated for each sample replicate [(mean Ct value of all targets)/(total number of target genes + number of target genes with Ct values less than 36)]. Reactions with a Q-score greater than 1.0 were rejected.

Table I.

DLBCL Molecular Subtyping Assay Genes and Primers

Gene
Symbol
Gene Name Primers
Wright Algorithm genes (n=14)
BCL6 B-cell CLL/lymphoma 6 RT: 5′-CTTTTGTGACGGAAATG-3′
F: 5′-ACCTCGAATGTAGACCTCGTCTAACATATAAAGTTTCCGGCACCTTCAGACT-3′
R: 5′-FAM-ATACTTTTGTGACGGAAATGCAGGTTACAC-3′
Amplicon Size: 145
CCND2 Cyclin D2 RT: 5′-AGAGGGAAGACCTCTT-3′
F: 5′-TTACAGCCGAGCTCTGTCTCTGAACAATTTATTTATTAATAAATTTTAATTTTTTAATTAATTCAGAAGGACATCCAACCCT-3′
R: 5′-TYE-AATATTTATATAGAGGGAAGACCTCTTCTTCGCA-3′
Amplicon Size: 169
ENTPD1 Ectonucleoside triphosphate diphosphohydrolase 1 RT: 5′-AGGTTCAGCATGTAGC-3′
F: 5′AGCTTTCGCAACGGAGGTTACATTGATAATTAAAATATTATATTATTATTATTTTTATTTAAAAATTTTAATAAGGCTATCATTTCACAGCTGA-3′
R: 5′-FAM-ATAGGTTCAGCATGTAGCCCAAAGTC-3′
Amplicon Size: 208
FUT8 Fucosyltransferase 8 RT: 5′-ATGGGATGGAAGGCA-3′
F: 5′-TCACGACGCGAGCTTACTAGTTTCGATTTATAACAAGAAGCTTGGCTTCAAACATC-3′
R: 5′-FAM-ATGGGATGGAAGGCAGCTTCTGT-3′
Amplicon Size: 120
IGHM Immunoglobulin heavy chain constant region mu RT: 5′-GTCAACTTGGTGGACT-3′
F: 5′-CCACCGCCTTCAAGTTTAACGACACTAATTTTATAATTTTGCGTCCTCCATGTGTGTC-3′
R: 5′-TYE-ATAAAGTCAACTTGGTGGACTTGGTGAGGA-3′
Amplicon Size: 169
IL16 Interleukin 16 RT: 5′-AAATCCCAATGGGGCCATA-3′
F: 5′-GCGAGTGCTTCTTCCGTTACGTACCATATAAATTTATTTATAAATTTTAAGTCATCTCCAACATCGTGCT-3′
R: 5′-FAM--AAATCCCAATGGGGCCATAAATGCTG-3′
Amplicon Size: 168
IRF4 Interferon regulatory factor 4 RT: 5′-GACGTGGTCAGCTCCT-3′
F: 5′-GAGACTACACACGCCGCTAAAGGACATATAATTTTATAAATTTTATTATTTTTAATAAATAATATTTTAAGCATAAGGTCTGCCGAAG-3′
R: 5′-TYE-ATAAAAATTAATATTTATATGACGTGGTCAGCTCCTTCACGA-3′
Amplicon Size: 197
ITPKB Inositol 1,4,5-triphosphate 3-kinase B RT: 5′-CTTGAAGAAGGGAGAAAC-3′
F: 5′-TACAACATTATTTAACTTAAACATTAAAACATTATAAATTCATATAATTAATAATTCAGAGAGTTCACTAAAGGAAAC-3′
R: 5′-TYE-CTTGAAGAAGGGAGAAACTTCTAGAGTGGT-3′
Amplicon Size: 151
LMO2 Lim Domain only 2 RT: 5′-CACGAATCCGCTTGT-3′
F: 5′-TTGCACCGCACCACATACTAGTACGAAATAATATTATATTATAATTTATTTATTAATATATAAATTTTTTAATTTATTATTTTTAGGCGCCTCTACTACAAACTG-3′
R: 5′-FAM-ATAAAAATTACACGAATCCGCTTGTCACAGGA-3′
Amplicon Size: 197
LRMP Lymphoid-restricted membrane protein RT:5′-CTCCTCTTTCTTACAGAG-3′
F: 5′-TCTCAGCCTGTTAGTCTACAATAGCATATAAATTTTATAAATTTTATTATTTTTCGACAGACGGTACTATAACTTCAAG-3′
R: 5′-FAM-CTCCTCTTTCTTACAGAGCGAGTTTCTGTC-3′
Amplicon Size: 176
MME Membrane metalloendopeptidase (CD10) RT:5′-TCCCATTGACATAGTTTG-3′
F: 5′-AGCCTTGCGGTACGGTTAGTGTTTCAATATTTTTATATTAAAAATATTTAAAATATTAAATGAACCTACAAGGAGTCCAGAAATG-3′
R: 5′-TYE-ATATCCCATTGACATAGTTTGCACAACGTC-3′
Amplicon Size: 166
MYBL1 V-myb avian myeloblastosis viral oncogene homolog-like 1 RT: 5′-ACTGGTAACGTCACTC-3′
F: 5′-AGTGCGAAAGGCGAGCTCTAACAAGATATTAAGCAAACGCTGTGTTATCCTCT-3′
R: 5′-FAM-ACTGGTAACGTCACTCCATGCTACAG-3′
Amplicon Size: 128
PIM1 pim-1 oncogene RT: 5′-TGGTCTCAGGGCCAA-3′
F:- 5′-ATGTAGACAACATGTGTCTTGGTAGATATAAATTATTTATAAATTTTATTCGAGCATGACGAAGAGATCATCA-3′
R: 5′-FAM-ATAAAAATTAGTCTCAGGGCCAAGCACCA-3′
Amplicon Size: 186
PTPN1 Protein tyrosine phosphatase, non-receptor type 1 RT: 5′-CAGGGACTCCAAAGT-3′
F: 5′-AGCCTGCATCGAGAGAAGACAGAACTATACAGTGCGACAGCTAGAATTG-3′
R: 5′-FAM-CAGGGACTCCAAAGTCAGGCCAT-3′
Amplicon Size: 133
Housekeeping Genes and Control
CLCN7 Chloride channel 7 RT: 5′-TGCTCAGAACAAAATTCA-3′
F: 5′-AGGCAAGGTGGAACAGATTCCTCTCATATTTAAATTTTTATAGGTGCGTCCTTCTGGAAC-3′
R: 5′-FAM-ATAATAAATTTTATGCTCAGAACAAAATTCAGGGTGAAC-3′
Amplicon Size: 159
TBP TATA box-binding protein RT: 5′-CACGAAGTGCAATGG-3′
F: 5′-TCTGTCTTGTCTGAAGCTAACTTAGATATAAATTTATAATTAAATATTTATTATTTAATTAATAAATAACCAGCTTCGGAGAGTTCTG-3′
R: 5′-TYE-ATTAATATTCACGAAGTGCAATGGTCTTTAGGTCAAG-3′
Amplicon Size: 183
MS2 MS2 Bacteriophage sequence RT: 5′-ACCTTTTCCCACACTATA-3′
F: 5′-AATAATATTTTAATATTTAATGTCAGGTCGGTACTAACATC-3′
R: 5′-FAM-ATAATTTAAATTAACCTTTTCCCACACTATACCTA-3′
Amplicon Size: 212

Abbreviations: RT, reverse transcription primer; F, forward polymerase chain reaction (PCR) primer; R, reverse PCR primer.

A subtyping (S) score was calculated using the normalized Ct data and gene weights of the Wright algorithm (Wright et al 2013). If there was no Ct value for a target, the value was set to a defined target-specific, upper-limit Ct value. Based on correlations with the microarray data and paired FFPE, samples corresponding to an S-score between -100 and 0 were unclassified, while S-scores less than -100 were classified as ABC and greater than 0 were classified as GCB. Thus, our training set of 30 DLBCL FFPE samples with matched frozen tissue microarray GEP data served as the gold standard against which initial S-scores were calibrated. The test set showed 96.7% and 90% agreement compared to microarray subtype for assignment of ABC cases and overall (ABC, GBC, and unclassified) cases, respectively (Figure 1 a).

Figure 1. Comparison of microarray GEP LPS and DLBCL molecular subtyping assay S-score for test (circles) and validation (diamonds) DLBCL cohorts (n=53).

Figure 1

a. Microarray GEP LPS less than -200 were classified as ABC molecular subtype (red) while those above -150 were classified as GCB molecular subtype (green). LPS between -200 and -150 were considered UNC, (grey). DLBCL molecular subtyping assay S-scores less than -100 were classified as ABC, while S-scores above 0 were considered GCB. S-scores between 0 and -100 were considered UNCL.

b. The DLBCL molecular subtyping assay S-score shows concordant classification of clinical samples both between runs and within a single run for samples analysed as five replicates in five different runs. CV between runs was 6.1% for the GCB DLBCL sample and 2.9% for the ABC DLBCL sample.

GEP, gene expression profiling; LPS, linear predictor score; DLBCL, diffuse large B-cell lymphoma; ABC, activated B-cell-like; GCB, germinal centre B-cell-like; UNCL, unclassified; CV, coefficient of variance.

To validate the S-score cut-off values, additional DLBCL specimens, described previously (Zhang, et al 2013), with paired frozen and FFPE samples were analysed. Microarray data from the Affymetrix Genechip Human Gene 1.0 ST (Santa Clara, CA) platform was obtained, and LPS were calculated (Wright, et al 2003). The DLBCL molecular subtyping assay was performed on FFPE-extracted RNA, and S-scores were obtained for 23 samples (Figure 1 a). The validation set performed similarly, with 91.3% and 87.0% agreement compared to microarray subtype for assignment of ABC samples and overall samples, respectively. This validated the chosen S-score cut-off values, giving a sensitivity of 95.2% and specificity of 93.8% for assignment of the ABC subtype for the combined test and validation sets. For the combined sets, the sensitivity was 95.2% and specificity was 90.6% for assignment of the GCB subtype.

Inter-assay and intra-assay variation was determined using two DLBCL specimens (Figure 1 b). The coefficient of variance (CV) was 6.1% for the GCB DLBCL specimen and was 2.9% for the ABC DBCL specimen. The assay was performed on freshly-isolated RNA from an additional 45 FFPE DLBCL samples from up to 12 years prior. When included with other samples from our institution in the test and validation cohorts, the assay failed in only 7 out of 88 samples (8.0%). Dilution studies showed that samples with as low as 0.4 μg of RNA per 10-μm FFPE slice yielded acceptable Q-scores and appropriate subtype classification.

In summary, we have successfully developed a multiplex quantitative expression profiling assay designed for DLBCL tumour classification into GCB or ABC subtypes from a single 10-μm FFPE section. This DLBCL molecular subtyping assay has the potential to provide rapid and accurate subclassification for DLBCL patients for prognostic implication as well as clinical trial patient selection in a Clinical Laboratory Improvement Amendments-certified laboratory environment. Finally, the assay, validated against GEP, could be used as an external reference for those clinical laboratories attempting to validate their immunohistochemical-based algorithms against a GEP-based standard.

Acknowledgments

Sources of support: This work was supported by a grant from the National Cancer Institute, U.S.A (Grant 1R33CA160011, JN primary investigator).

Footnotes

Authorship contributions

AMBC, JN, KMD, JJL, PC, and LMD performed the research. AMBC, JN, BTH, MRS, TR, LIK, TD, GM, JG-J, EAM, EDH designed the research study. SSD and EDH contributed essential reagents or tools. AMBC, JN, TR, TD, GM, JG-J, EAM, and EDH analyzed the data. AMBC, JN, BTH and EDH wrote the paper. All authors critically reviewed the manuscript.

Conflict of interest disclosures: Jörk Nölling, Kiran M. Divakar, and Lilly I. Kong are or were employed by PrimeraDx. The other authors have no conflicts of interest to declare.

References

  1. Alizadeh AA, Eisen MB, Davis RE, Ma C, Lossos IS, Rosenwald A, Boldrick JC, Sabet H, Tran T, Yu X, Powell JI, Yang L, Marti GE, Moore T, Hudson J, Jr, Lu L, Lewis DB, Tibshirani R, Sherlock G, Chan WC, Greiner TC, Weisenburger DD, Armitage JO, Warnke R, Levy R, Wilson W, Grever MR, Byrd JC, Botstein D, Brown PO, Staudt LM. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403:503–511. doi: 10.1038/35000501. [DOI] [PubMed] [Google Scholar]
  2. Coutinho R, Clear AJ, Owen A, Wilson A, Matthews J, Lee A, Alvarez R, da Silva MG, Cabecadas J, Calaminici M, Gribben JG. Poor Concordance among Nine Immunohistochemistry Classifiers of Cell-of-Origin for Diffuse Large B-Cell Lymphoma: Implications for Therapeutic Strategies. Clin Cancer Res. 2013;19:6686–6695. doi: 10.1158/1078-0432.CCR-13-1482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. de Jong D, Rosenwald A, Chhanabhai M, Gaulard P, Klapper W, Lee A, Sander B, Thorns C, Campo E, Molina T, Norton A, Hagenbeek A, Horning S, Lister A, Raemaekers J, Gascoyne RD, Salles G, Weller E. Immunohistochemical prognostic markers in diffuse large B-cell lymphoma: validation of tissue microarray as a prerequisite for broad clinical applications--a study from the Lunenburg Lymphoma Biomarker Consortium. J Clin Oncol. 2007;25:805–812. doi: 10.1200/JCO.2006.09.4490. [DOI] [PubMed] [Google Scholar]
  4. de Jong D, Xie W, Rosenwald A, Chhanabhai M, Gaulard P, Klapper W, Lee A, Sander B, Thorns C, Campo E, Molina T, Hagenbeek A, Horning S, Lister A, Raemaekers J, Salles G, Gascoyne RD, Weller E. Immunohistochemical prognostic markers in diffuse large B-cell lymphoma: validation of tissue microarray as a prerequisite for broad clinical applications (a study from the Lunenburg Lymphoma Biomarker Consortium) J Clin Pathol. 2009;62:128–138. doi: 10.1136/jcp.2008.057257. [DOI] [PubMed] [Google Scholar]
  5. Hlousek L, Voronov S, Diankov V, Leblang AB, Wells PJ, Ford DM, Nolling J, Hart KW, Espinoza PA, Bristol MR, Tsongalis GJ, Yen-Lieberman B, Slepnev VI, Kong LI, Lee MC. Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets. Biotechniques. 2012;52:316–324. doi: 10.2144/0000113852. [DOI] [PubMed] [Google Scholar]
  6. Lenz G, Wright G, Dave SS, Xiao W, Powell J, Zhao H, Xu W, Tan B, Goldschmidt N, Iqbal J, Vose J, Bast M, Fu K, Weisenburger DD, Greiner TC, Armitage JO, Kyle A, May L, Gascoyne RD, Connors JM, Troen G, Holte H, Kvaloy S, Dierickx D, Verhoef G, Delabie J, Smeland EB, Jares P, Martinez A, Lopez-Guillermo A, Montserrat E, Campo E, Braziel RM, Miller TP, Rimsza LM, Cook JR, Pohlman B, Sweetenham J, Tubbs RR, Fisher RI, Hartmann E, Rosenwald A, Ott G, Muller-Hermelink HK, Wrench D, Lister TA, Jaffe ES, Wilson WH, Chan WC, Staudt LM. Stromal gene signatures in large B-cell lymphomas. New England Journal of Medicine. 2008;359:2313–2323. doi: 10.1056/NEJMoa0802885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Salles G, de Jong D, Xie W, Rosenwald A, Chhanabhai M, Gaulard P, Klapper W, Calaminici M, Sander B, Thorns C, Campo E, Molina T, Lee A, Pfreundschuh M, Horning S, Lister A, Sehn LH, Raemaekers J, Hagenbeek A, Gascoyne RD, Weller E. Prognostic significance of immunohistochemical biomarkers in diffuse large B-cell lymphoma: a study from the Lunenburg Lymphoma Biomarker Consortium. Blood. 2011;117:7070–7078. doi: 10.1182/blood-2011-04-345256. [DOI] [PubMed] [Google Scholar]
  8. Scott DW, Wright GW, Williams PM, Lih CJ, Walsh W, Jaffe ES, Rosenwald A, Campo E, Chan WC, Connors JM, Smeland EB, Mottok A, Braziel RM, Ott G, Delabie J, Tubbs RR, Cook JR, Weisenburger DD, Greiner TC, Glinsmann-Gibson BJ, Fu K, Staudt LM, Gascoyne RD, Rimsza LM. Determining cell-of-origin subtypes of diffuse large B-cell lymphoma using gene expression in formalin-fixed paraffin-embedded tissue. Blood. 2014;123:1214–1217. doi: 10.1182/blood-2013-11-536433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Wright G, Tan B, Rosenwald A, Hurt EH, Wiestner A, Staudt LM. A gene expression-based method to diagnose clinically distinct subgroups of diffuse large B cell lymphoma. Proc Natl Acad Sci U S A. 2003;100:9991–9996. doi: 10.1073/pnas.1732008100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Zhang J, Grubor V, Love CL, Banerjee A, Richards KL, Mieczkowski PA, Dunphy C, Choi W, Au WY, Srivastava G, Lugar PL, Rizzieri DA, Lagoo AS, Bernal-Mizrachi L, Mann KP, Flowers C, Naresh K, Evens A, Gordon LI, Czader M, Gill JI, Hsi ED, Liu Q, Fan A, Walsh K, Jima D, Smith LL, Johnson AJ, Byrd JC, Luftig MA, Ni T, Zhu J, Chadburn A, Levy S, Dunson D, Dave SS. Genetic heterogeneity of diffuse large B-cell lymphoma. Proc Natl Acad Sci U S A. 2013;110:1398–1403. doi: 10.1073/pnas.1205299110. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES