Abstract
• Premise of the study: A total of 17 polymorphic microsatellite markers were developed for the tropical Atlantic seagrass Syringodium filiforme (Cymodoceaceae), enabling analysis of population genetic structure in this species for the first time.
• Methods and Results: The 17 primers amplified di- and trinucleotide repeats revealing two to eight alleles per locus among the South Florida populations tested. In the analysis of two populations from the Florida Keys (Florida, USA), observed heterozygosity ranged from 0.063 to 0.905, although sampling was from relatively closely located populations so heterozygosity is expected to be higher across larger spatial scales. Multiplex PCRs consisting of two 6-plex and one 5-plex reactions were developed to maximize genotyping efficiency.
• Conclusions: We present here 17 polymorphic markers that will be useful for the study of clonality and population structure of S. filiforme, a marine plant that forms extensive habitat throughout the tropical Atlantic and Caribbean.
Keywords: Caribbean, clonality, Cymodoceaceae, population genetics, seagrass, Syringodium filiforme
Syringodium filiforme Kütz. (Cymodoceaceae) is one of three dominant seagrasses native to the tropical Atlantic. It is widely distributed and habitat forming, often growing intermixed with other species and sometimes in dense, monospecific meadows (Green and Short, 2003). Syringodium filiforme is capable of both recruitment from seed and clonal propagation through rhizome expansion (Kendrick et al., 2012). The relative contribution of each strategy is difficult to determine, but may be resolved using polymorphic microsatellites to accurately identify clones and examine genetic structure of populations (Arnaud-Haond et al., 2005). Primers for microsatellite loci have been developed for the only other congener, S. isoetifolium (Asch.) Dandy (Matsuki et al., 2013; Wainwright et al., 2013). The evolutionary distance between species of Syringodium Kütz. (Les et al., 1997) renders these markers unlikely to be suitable for use in S. filiforme, thus new markers were isolated. The microsatellite markers developed here will enable assessment of genetic diversity and population structure of S. filiforme throughout its range.
METHODS AND RESULTS
Genomic DNA was extracted from leaf tissue of S. filiforme from eight samples collected in the Indian River Lagoon, Florida, USA (27.19298°N, 80.18067°W) using a DNeasy Plant Kit (QIAGEN, Valencia, California, USA) according to manufacturer’s protocols. Approximately 250 ng of DNA from each sample was pooled to create a final solution containing 2 μg of total genomic DNA. Microsatellite loci were isolated by GenoScreen (Lille, France) following the methods described by Malausa et al. (2011). Libraries were prepared by mechanically fragmenting genomic DNA and probing for the following microsatellite repeats: TG, TC, AAC, AAG, AGG, ACG, ACAT, and ACTC. Enriched fragments were amplified, purified, and quantified. Sequencing using 454 GS-FLX Titanium chemistry (454 Life Sciences, a Roche Company, Branford, Connecticut, USA) returned a total of 4410 distinct sequences containing microsatellite motifs. QDD software (Meglécz et al., 2010) was used to design 51 primer pairs. Primers were synthesized (Invitrogen, Carlsbad, California, USA) with M13 tails (5′-TGTAAAACGACGGCCAGT-3′) preceding the 5′ end of the forward primer sequences to facilitate cost-efficient fluorescent labeling of PCR products (Schuelke, 2000). To improve genotyping accuracy, PIG-tails (5′-GTTTCT-3′) were added to the 5′ end of the reverse primer sequences (Brownstein et al., 1996).
Primers were initially tested using DNA from eight samples from two populations, Florida Bay (vouchers deposited at the State Herbarium of South Australia [AD]: AD267896, AD267897; geo-reference: 25.12575°N, 80.78830°W) and Tampa Bay (27.65007°N, 82.67941°W). Given the close proximity of locations and unambiguous taxonomy, vouchers were only collected from one Florida Bay sampling site representing the entire South Florida region. DNA was extracted as above and gradient PCR performed containing the following reagent amounts in each 15-μL reaction: 1.5 mM MgCl2, 1.3 mM dNTPs, 6.7 μg/µL bovine serum albumin (BSA), 0.5 units Bioline Immolase DNA polymerase and 1.50 μL Bioline ImmoBuffer (Bioline, Taunton, Massachusetts, USA). Primer quantities included 0.6 pmol of the M13-labeled forward primer, 2.4 pmol each reverse primer and the fluorolabeled M13 primer (5′-FAM, 5′-NED, or 5′-VIC; Invitrogen), and 1.0–3.0 ng·μL−1 of DNA template. PCR cycling conditions were 95°C for 10 min, 35 cycles of 45 s at 95°C, 30 s at an annealing temperature gradient of 52–58°C, and 30 s at 72°C, with final extension at 72°C held for 5 min. PCR products were visualized on a 1.5% agarose gel where a single band of approximate expected size according to locus primer design signified successful amplification. To determine polymorphism, PCR products were analyzed by capillary electrophoresis on a MegaBACE 1000 (GE Biosciences, Pittsburgh, Pennsylvania, USA) with an internal ET-ROX 400 Size Standard (GE Biosciences). A final set of 17 microsatellite loci were found to be polymorphic in S. filiforme (Table 1).
Table 1.
Characteristics of 17 microsatellite loci developed for Syringodium filiforme.
| Locus | Primer sequences (5′–3′)a | Repeat motif | Allele size range (bp) | Ta (°C) | GenBank accession no. |
| SYF-02 | F: ACGAAGAAGAGGAGGAAGAGG | (GAG)10 | 108–117 | 60 | KM359149 |
| R: GTGTGGAATTGCAAGGAGGT | |||||
| SYF-03 | F: ACAAATGATGACTAAGGAGGGG | (TC)12 | 244–258 | 60 | KM359150 |
| R: CTTATTAAGAATTAGTGCTCTTATGGC | |||||
| SYF-04 | F: GGTGGTCGTACTTTTCAGGC | (GTT)11 | 139–169 | 60 | KM359151 |
| R: CAAAGCCAAGCAAACCTCAT | |||||
| SYF-06 | F: ATCAATTCTTTGCCGATCC | (AG)10 | 196–236 | 60 | KM359152 |
| R: GAGGAGGATGATCTTGACCG | |||||
| SYF-12 | F: TGAAACTGTTGAAGTGGAGGTG | (TC)10 | 206–218 | 60 | KM359153 |
| R: GCTGCAATTGTAAACCCCATT | |||||
| SYF-14 | F: CCCTTGCATCGACACTATCC | (TTC)11 | 134–166 | 60 | KM359154 |
| R: CCCACTAAAAGAACATACGTACTGAA | |||||
| SYF-15 | F: TTAGTTTCACTTTTCTGGCCG | (CTT)17 | 281–293 | 60 | KM359155 |
| R: GAACAGAAGCATGCAGTCTAGC | |||||
| SYF-16 | F: CAAACATGGGCAGAGAAACA | (TC)10 | 155–157 | 60 | KM359156 |
| R: TGATCATGGACCTCAGGGA | |||||
| SYF-19 | F: AAATCTCAAATCATCCTACGCA | (TC)12 | 139–147 | 60 | KM359157 |
| R: CGTCTGAAGGGTAGGTGTGG | |||||
| SYF-20 | F: CCAACTCTGGCTGGCTGT | (CT)10 | 180–198 | 60 | KM359158 |
| R: GTTTCTGTCGGTATGTTCGAGCCATATT | |||||
| SYF-22 | F: GAAAGGCCTCCATTCCATTT | (AGG)9 | 146–161 | 60 | KM359159 |
| R: TCGATTCTCCTCTTTCTTCGAC | |||||
| SYF-25 | F: CCGTCGTAAGGACAAGGAAG | (GAC)9 | 94–106 | 60 | KM359160 |
| R: AGCAAAACAGCGTTCATGG | |||||
| SYF-29 | F: GGACGAAATGAATGGTACGC | (GA)9 | 215–223 | 60 | KM359161 |
| R: GATTCTCACCTCGGAGCAAC | |||||
| SYF-37 | F: TAGTCATTGCTCTATTGGGGTG | (TTC)8 | 240–246 | 60 | KM359162 |
| R: TGTGATTGTTAAGCCGAAAGG | |||||
| SYF-40 | F: TCGTTGATCATAGAAGTCTCATCTC | (TC)8 | 114–116 | 60 | KM359163 |
| R: CCATAAAGGTAGCCCACACC | |||||
| SYF-49 | F: TAAGAGGAACGACCCCATCA | (GAC)8 | 140–143 | 60 | KM359164 |
| R: CCTTGTCCTCCTCGTCTTCA | |||||
| SYF-51 | F: TAGGGTTGTAGGAGCCAGGA | (GA)8 | 164–174 | 60 | KM359165 |
| R: GGGTGACTAGAAGCATTGCC |
Note: Ta = annealing temperature.
Reverse primer sequences, and therefore also size range, do not include the optional PIG-tail (5′-GTTTCT-3′) sequence.
The high number of polymorphic loci enabled the development of multiplex PCR panels in which several loci are amplified in a single reaction, increasing genotyping efficiency while minimizing costs. Using the software Multiplex Manager version 1.2 (Holleley and Geerts, 2009), two 6-plex and one 5-plex multiplexes were designed, and new fluorescently labeled forward primers synthesized (Invitrogen; Table 2). Multiplex PCRs were conducted using a Type-it Microsatellite Multiplex PCR Kit (QIAGEN) in 10-μL reactions containing 5 μL of Type-it PCR Multiplex Master Mix, 0.5 μL of 2 μM primer mix (Table 2), and 1–5 ng of template DNA. PCR conditions were set to the manufacturer’s optimized cycling protocol (Type-it Microsatellite Multiplex PCR Kit, QIAGEN).
Table 2.
Suggested multiplex PCR panels for Syringodium filiforme using fluorescent labels FAM, NED, and VIC, and primer stock concentration of 100 μM.
| Locus | Label | Volume (μL)a |
| Panel Syf-A | ||
| SYF-25 | VIC | 5 |
| SYF-19 | FAM | 12 |
| SYF-02 | NED | 7.5 |
| SYF-20 | NED | 7.5 |
| SYF-15 | NED | 7.5 |
| Panel Syf-B | ||
| SYF-40 | FAM | 10 |
| SYF-51 | FAM | 10 |
| SYF-16 | NED | 10 |
| SYF-04 | VIC | 7.5 |
| SYF-12 | VIC | 7.5 |
| SYF-03 | VIC | 7.5 |
| Panel Syf-C | ||
| SYF-29 | FAM | 10 |
| SYF-14 | VIC | 6 |
| SYF-49 | NED | 5 |
| SYF-22 | NED | 7 |
| SYF-06 | NED | 7 |
| SYF-37 | NED | 8 |
The volume listed is for both forward and reverse primers to be added to each panel with water to a total volume of 500 μL.
To assess the genetic diversity of selected loci, two populations of S. filiforme were screened from the Florida Keys in Florida, USA: the Elbow Reef (25.12960°N, 80.26537°W; n = 36) in the Upper Keys and the Sluiceway (24.82836°N, 80.87138°W; n =34) in the Middle Keys. Samples were collected at least 2 m apart from an area of approximately 50 × 50 m. Fragment analysis of PCR products was performed on a capillary-based 3730xl DNA Analyzer (Applied Biosystems, Carlsbad, California, USA) with an internal ET-ROX 500 Size Standard at the Georgia Genomics Facility (University of Georgia, Athens, Georgia, USA).
A total of 70 individual shoots sampled from two populations in the Florida Keys were screened, and 37 unique multilocus genotypes were identified. The probability individuals sharing the same genotype were derived via separate sexual events (Pgen) and the probability of clonal identity (Psex) were calculated in GenClone2.0 (Arnaud-Haond and Belkhir, 2007). The highest values observed for Pgen and Psex were 1.07·10−5 and 1.27·10−4, respectively. The loci SYF-16, SYF-40, and SYF-51 were fixed for single alleles although they were polymorphic in the initial screening runs. All of the other 14 loci were polymorphic, and allelic diversity was A = 2–8 (Table 3). Heterozygosity was only analyzed for genets, the presumptive genetic individuals based on unique multilocus genotypes, to avoid bias due to overrepresentation of a single clone. Observed heterozygosity ranged from 0.063 to 0.905 and unbiased expected heterozygosity ranged from 0.063 to 0.808. Deviation from Hardy–Weinberg equilibrium was not observed for any locus (P > 0.05). Linkage disequilibrium among loci was tested using GENEPOP web version 4.2, using Fisher’s method (Raymond and Rousset, 1995; Rousset, 2008), and was detected between loci pairs SYF-2 and SYF-6, SYF-6 and SYF-20, and SYF-2 and SYF-14 (P < 0.05), but is most likely an artifact of sampling relatively closely related populations.
Table 3.
Summary genetic statistics for two populations of Syringodium filiforme screened with the newly developed microsatellites.
| Elbow Reef (n = 36) | Sluiceway (n = 34) | Tampa Bay and Florida Bay (n = 8)a | |||||||
| Locus | A | Ho | He | Pb | A | Ho | He | Pb | A |
| SYF-02 | 3 | 0.714 | 0.547 | 0.173 | 3 | 0.813 | 0.579 | 0.069 | 3 |
| SYF-03 | 5 | 0.762 | 0.722 | 0.800 | 3 | 0.875 | 0.675 | 0.478 | 3 |
| SYF-04 | 5 | 0.762 | 0.754 | 0.759 | 2 | 0.688 | 0.514 | 0.309 | 2 |
| SYF-06 | 6 | 0.905 | 0.792 | 0.627 | 3 | 0.625 | 0.685 | 0.609 | 3 |
| SYF-12 | 3 | 0.714 | 0.675 | 0.772 | 2 | 0.125 | 0.121 | 1.000 | 3 |
| SYF-14 | 8 | 0.810 | 0.808 | 0.470 | 3 | 0.875 | 0.595 | 0.042 | 3 |
| SYF-15 | 3 | 0.381 | 0.361 | 0.381 | 3 | 0.625 | 0.675 | 0.277 | 2 |
| SYF-16 | 1 | — | — | — | 1 | — | — | — | 2 |
| SYF-19 | 4 | 0.714 | 0.618 | 0.192 | 2 | 0.467 | 0.370 | 0.528 | 2 |
| SYF-20 | 4 | 0.571 | 0.632 | 0.186 | 3 | 0.750 | 0.548 | 0.215 | 2 |
| SYF-22 | 3 | 0.619 | 0.577 | 1.000 | 2 | 0.375 | 0.315 | 1.000 | 2 |
| SYF-25 | 3 | 0.619 | 0.633 | 0.579 | 3 | 0.250 | 0.232 | 1.000 | 2 |
| SYF-29 | 2 | 0.095 | 0.093 | 1.000 | 2 | 0.563 | 0.417 | 0.256 | 2 |
| SYF-37 | 2 | 0.095 | 0.093 | 1.000 | 2 | 0.375 | 0.387 | 1.000 | 2 |
| SYF-40 | 1 | — | — | — | 1 | — | — | — | 2 |
| SYF-49 | 2 | 0.143 | 0.136 | 1.000 | 2 | 0.063 | 0.063 | — | 2 |
| SYF-51 | 1 | — | — | — | 1 | — | — | — | 3 |
Note: A = number of alleles; He = unbiased expected heterozygosity; Ho = observed heterozygosity.
The number of alleles observed in the Tampa Bay and Florida Bay populations has also been provided to show that additional alleles are detected across larger spatial scales among the small number of preliminary screening samples.
P values for deviation from Hardy–Weinberg equilibrium.
CONCLUSIONS
The 17 polymorphic microsatellite loci and multiplex PCR panels developed in this study will facilitate population genetic analyses of the extensive meadows of S. filiforme found throughout tropical Atlantic marine ecosystems. The allelic diversity detected will allow assessment of clonality, genetic diversity, and population genetic structure. Fixed alleles observed in the populations in the Florida Keys are probably due to the relatively close proximity of the sampling locations, as all loci were found to be polymorphic when comparing fewer samples from the Tampa Bay and Florida Bay populations. Clonal plant populations existing within geographical extremes of their range may exhibit higher clonality and less diversity, which may be true for S. filiforme in subtropical latitudes (Billingham et al., 2003). Therefore, it is expected that sampling more broadly across the species range will increase the number of alleles detected. The available microsatellite loci encourage future study of population connectivity and gene flow in S. filiforme that will further contribute to the management and conservation of this species.
LITERATURE CITED
- Arnaud-Haond S., Alberto F., Teixeira S., Procaccini G., Serrao E., Duarte C. 2005. Assessing genetic diversity in clonal organisms: Low diversity or low resolution? Combining power and cost efficiency in selecting markers. Journal of Heredity 96: 434–440 [DOI] [PubMed] [Google Scholar]
- Arnaud-Haond S., Belkhir K. 2007. GENCLONE: A computer program to analyse genotypic data, test for clonality and describe spatial clonal organization. Molecular Ecology Notes 7: 15–17 [Google Scholar]
- Billingham M., Reusch T., Alberto F., Serrao E. 2003. Is asexual reproduction more important at geographical limits? A genetic study of the seagrass Zostera marina in the Ria Formosa, Portugal. Marine Ecology Progress Series 265: 77–83 [Google Scholar]
- Brownstein M., Carpten J., Smith J. 1996. Modulation of non-templated nucleotide addition by Taq DNA polymerase: Primer modifications that facilitate genotyping. BioTechniques 20: 1004–1010 [DOI] [PubMed] [Google Scholar]
- Green E. P., Short F. T. [eds.]. 2003. World atlas of seagrasses; University of California Press, Berkeley, California, USA [Google Scholar]
- Holleley C. E., Geerts P. G. 2009. Multiplex Manager 1.0: A cross-platform computer program that plans and optimizes multiplex PCR. BioTechniques 46: 511–517 [DOI] [PubMed] [Google Scholar]
- Kendrick G. A., Waycott M., Carruthers T. J. B., Cambridge M. L., Hovey R., Krauss S. L., Lavery P. S., et al. 2012. The central role of dispersal in the maintenance and persistence of seagrass populations. Bioscience 62: 56–65 [Google Scholar]
- Les D. H., Cleland M. A., Waycott M. 1997. Phylogenetic studies in Alismatidae, II: Evolution of marine angiosperms (seagrasses) and hydrophily. Systematic Botany 22: 443–463 [Google Scholar]
- Malausa T., Gilles A., Meglécz E., Blanquart H., Duthoy S., Costedoat C., Dubut V., et al. 2011. High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Molecular Ecology Resources 11: 638–644 [DOI] [PubMed] [Google Scholar]
- Matsuki Y., Takahashi A., Nakajima Y., Lian C., Fortes M. D., Uy W. H., Campos W. L., et al. 2013. Development of microsatellite markers in a tropical seagrass Syringodium isoetifolium (Cymodoceaceae). Conservation Genetics Resources 5: 715–717 [Google Scholar]
- Meglécz E., Costedoat C., Dubut V., Gilles A., Malausa T., Pech N., Martin J. 2010. QDD: A user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics (Oxford, England) 26: 403–404 [DOI] [PubMed] [Google Scholar]
- Raymond M., Rousset F. 1995. GENEPOP (version 1.2): Population-genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249 [Google Scholar]
- Rousset F. 2008. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106 [DOI] [PubMed] [Google Scholar]
- Schuelke M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18: 233–234 [DOI] [PubMed] [Google Scholar]
- Wainwright B. J., Arlyza I. S., Karl S. A. 2013. Isolation and characterization of eighteen polymorphic microsatellite loci for the topical [sic] seagrass, Syringodium isoetifolium. Conservation Genetics Resources 5: 943–945 [Google Scholar]