Skip to main content
Development (Cambridge, England) logoLink to Development (Cambridge, England)
. 2014 Aug;141(16):3212–3221. doi: 10.1242/dev.102541

Kremen1 restricts Dkk activity during posterior lateral line development in zebrafish

Hillary F McGraw 1, Maya D Culbertson 1,*, Alex V Nechiporuk 1,‡
PMCID: PMC4197539  PMID: 25038040

Abstract

Canonical Wnt signaling plays crucial roles during development and disease. How Wnt signaling is modulated in different in vivo contexts is currently not well understood. Here, we investigate the modulation of Wnt signaling in the posterior lateral line primordium (pLLP), a cohort of ∼100 cells that collectively migrate along the trunk of the zebrafish embryo. The pLLP comprises proliferative progenitor cells and organized epithelial cells that will form the mechanosensory organs of the posterior lateral line. Wnt signaling is active in the leading progenitor zone of the pLLP and restricted from the trailing zone through expression of the secreted Wnt inhibitors dkk1b and dkk2. We have identified a zebrafish strain, krm1nl10, which carries a mutation in the kremen1 gene, a non-obligate co-receptor for the Dkk family of proteins. Previous studies have shown that Kremen1 inhibits Wnt signaling by facilitating internalization of the Kremen1-Dkk-Lrp5/6 complex. Surprisingly, we found that disruption of Kremen1 in the pLLP exhibited molecular and cellular phenotypes associated with a decrease rather than overactivation of Wnt signaling. Transplantation of wild-type cells into the mutant primordia failed to rescue the krm1nl10 phenotype, thus revealing that the effects of Kremen1 loss are non-cell-autonomous. Finally, ectopic expression of Dkk1b-mTangerine protein revealed larger spread of the fusion protein in the mutant primordia compared with the wild type. Based on our data, we propose a novel mechanism in which Kremen1 modulates Wnt activity by restricting the range of secreted Dkk proteins during collective cell migration in the pLLP.

Keywords: Dkk, Kremen1, Lateral line, Wnt, Zebrafish

INTRODUCTION

Canonical Wnt signaling regulates many cellular behaviors during embryonic development, such as progenitor cell maintenance, proliferation, migration and differentiation (Grigoryan et al., 2008). The canonical Wnt signaling pathway is activated by a large family of secreted Wnt ligands that bind to Frizzled receptor and LDL receptor-related proteins 5 and 6 (Lrp5/6). The single-pass transmembrane proteins Kremen1 and Kremen2 have been identified as modulators of canonical Wnt signaling (Cselenyi and Lee, 2008; Nakamura et al., 2008). Kremen1/2 are high-affinity co-receptors for Dickkopf (Dkk) proteins, a family of secreted Wnt inhibitors. During development of various organs, including the nervous system, limbs and liver, Kremen1/2 synergize with the Dkk proteins to inhibit Wnt signaling (Davidson et al., 2002; Ellwanger et al., 2008; Lu et al., 2013). Dkk inhibits Wnt activity by competitively binding to Lrp5/6. In cultured cells, Dkk binds to Kremen1/2 and Lrp5/6, thereby forming a protein complex; this ternary complex is endocytosed and probably targeted for degradation (Nakamura et al., 2008). Studies in mice and Xenopus demonstrated that Dkk binding to Kremen1/2 inhibits canonical Wnt signaling, as loss of Kremen1/2 function leads to Wnt overactivation phenotypes, such as defects in anterior CNS development and limb formation (Davidson et al., 2002; Osada et al., 2006; Ellwanger et al., 2008). Furthermore, in zebrafish, Dkk and Kremen1 (a Kremen2 homolog has not been identified in zebrafish) have been shown to regulate mechanosensory organ size by inhibiting Wnt mediated proliferation (Wada et al., 2013). By contrast, in the absence of Dkk, Kremen1/2 were found to bind directly to Lrp5/6 in vitro, and Kremen2 facilitates Wnt activity during neural crest induction in Xenopus (Hassler et al., 2007). Further research is required to more fully elucidate how Kremen1/2 modulate canonical Wnt signaling during development in vivo.

The zebrafish posterior lateral line (pLL) mechanosensory system has proven to be an excellent model for studying how Wnt/β-catenin signaling regulates cellular dynamics during embryonic development. Formation of the pLL occurs through the collective migration of a cohort of ∼100 cells called the pLL primordium (pLLP) (Aman and Piotrowski, 2009; Chitnis et al., 2012). As the pLLP migrates, it deposits patterned clusters of cells that will form mechanosensory organs called neuromasts (NMs). As each maturing NM is deposited from the rostral (trailing) region of the pLLP, proliferating progenitor cells in the caudal (leading) region of the pLLP give rise to new proto-NMs. At the end of pLLP migration, the nascent pLL consists of 5-6 NMs along the trunk of the zebrafish embryo and a terminal cluster (tc) of 2-3 NMs at the end of the tail.

The Wnt/β-catenin and Fgf signaling pathways interact to regulate cellular proliferation, differentiation and migration in the pLLP (Aman and Piotrowski, 2009; Chitnis et al., 2012; Harding and Nechiporuk, 2012). Canonical Wnt signaling is active in the leading region of the pLLP and restricted in the trailing zone, in part by expression of dkk1b (Aman and Piotrowski, 2008). Conditional overexpression of dkk1b results in a dramatic truncation in the pLL due to loss of pLLP organization, decreased cellular proliferation, increased cell death and failed migration (Aman and Piotrowski, 2008; Aman et al., 2011; McGraw et al., 2011). The Fgf signaling pathway is active in the mid-region of the pLLP and is required for the formation of proto-NMs (Aman and Piotrowski, 2009; Chitnis et al., 2012; Harding and Nechiporuk, 2012). Recent work by Matsuda et al. (2013) showed that Wnt signaling through Lymphoid enhancer-binding factor 1 (lef1) regulates NM spacing along the trunk through the expression of the Fgf pathway inhibitor Dual specificity phosphatase 6 (dusp6) in the leading region of the pLLP (Matsuda et al., 2013). In summary, the Wnt pathway must be precisely regulated in the pLLP to ensure proper pLL development.

In this study, we show that Kremen1 acts in the pLLP to modulate Wnt signaling. We have identified a kremen1 mutant strain (krm1nl10) that displays a premature and progressive loss of Wnt activity in the leading region of the pLLP, as well as decreased cellular proliferation and increased cell death. Our mosaic analysis revealed that mutation of kremen1 leads to non-cell-autonomous defects in the pLLP that are morphologically similar to ectopic activation of Dkk1 (McGraw et al., 2011). Attenuating Dkk levels, either by morpholino knockdown of dkk1b/2 or inhibition of Fgf signaling, results in a partial rescue of the krm1nl10 phenotype. Analysis of tagged Dkk1b protein in krm1nl10 and wild-type (WT) embryos revealed a broader spread of Dkk1b in mutant primordia. Based on these data, we propose that an absence of Kremen1 function leads to an expanded range of the Dkk signal and, consequently, premature attenuation of Wnt signaling in the pLLP. Our study provides new insight into Kremen1-mediated modulation of Wnt activity in vivo during organogenesis and suggests a pathway that might be misregulated during disease.

RESULTS

Kremen1 is required for pLL formation

In an ongoing N-ethyl-N-nitrosourea (ENU)-based screen to identify zebrafish mutants with defects in pLL development, we isolated the strain krm1nl10. By contrast to complete pLLP migration in WT embryos, migration of the pLLP halted midway along the trunk in krm1nl10 mutants, and the pLLP dispersed into a single line of cells extending from the last deposited NM (Fig. 1A,B). Live imaging demonstrated that new NM deposition failed in the caudal portion of the trunk due to a failure of proto-NM renewal in mutant primordia (Fig. 1E,F; supplementary material Movies 1, 2). As a result, by 2 days post fertilization (dpf), krm1nl10 mutants showed significantly fewer NMs that were also shifted anteriorly, and an invariable lack of tc NMs (Fig. 1A,B,D,G). Adult krm1nl10 homozygous mutants were viable, mated naturally and produced offspring, although they lacked NMs on the caudal-most trunk and tail as adults (supplementary material Fig. S1A,B).

Fig. 1.

Fig. 1.

The pLL is truncated in krm1nl10 mutants. (A-C) Confocal projections of 2 dpf larvae expressing Tg(cldnB:GFP), (L1-L8: pLL NMs 1-8). (A) WT embryo showing completed pLLP migration and deposition of all NMs. (B) In a krm1nl10 mutant, there are fewer deposited NMs and the pLLP stalled prematurely (orange arrowhead). (C) kremen1 morphants show a similar reduction of NMs and pLLP stalling (orange arrowhead). (D) Quantification of neuromasts in WT, krm1nl10 mutant and krm1-MO-injected embryos (n=10 embryos per condition; **P<0.001, one-way ANOVA). (E-F‴) Still confocal projections from live 930-min time-lapse movies showing pLLP migration in WT and krm1nl10 embryos beginning at 36 hpf. At 0 min, WT and mutant primordia contain two proto-NMs (E,F, blue and yellow arrows). By 220 min, both WT and mutant primordia have added an additional proto-NM (E′,F′, red arrow). (E″) At 630 min, the WT pLLP contains the proto-NMs that will form the terminal cluster (green arrow). By contrast, the krm1nl10 pLLP fail to form a new proto-NM and migrate as a thin trail of cells (F″, orange arrowhead). By 930 min, WT pLLP has migrated out of frame (E⁗) and formed the tc (E‴). The mutant pLLP has stalled (a thin trail of cells extended from the last deposited NM, marked by orange arrowhead; F‴). (G) Quantification of L1-L5 NM location based on somite level (tc is not included). NMs are shifted anteriorly in krm1nl10 mutant and krm1-MOrphants relative to WT embryos (n=6 embryos per condition; P<0.001, two-way ANOVA with replication). Scale bars: 20 µm. NM, neuromast; tc, terminal cluster.

Positional cloning of the krm1nl10 mutation identified a single base pair change from thymine to cytosine in the splice donor site of intron 6 of the kremen1 gene on chromosome 5 (supplementary material Fig. S2A,B). RT-PCR for kremen1 generated a single product in WT embryos and at least two variants in krm1nl10 mutants (supplementary material Fig. S2C,D). Variant 1, the more abundant product, resulted from improper splicing and insertion of the 100 base pair (bp) intron 6 between exons 6 and 7. Variant 2 resulted from premature splicing of exon 7, which led to the loss of 31 bp in exon 6 (supplementary material Fig. S2D). Both variants contained predicted translational frame shifts, which resulted in premature stop codons and disruption of the CUB domain, an essential domain for Kremen1/Dkk binding (Mao et al., 2002), and in loss of the transmembrane domain (supplementary material Fig. S2E). Injection of 200 pg/nl WT kremen1 mRNA rescued the loss of tc NMs in krm1nl10 mutants without producing obvious loss of Wnt phenotypes in WT embryos. By contrast, expression of mRNA encoding mutant variants 1 or 2 failed to rescue tc NMs in krm1nl10 mutant embryos (supplementary material Fig. S2G). Injection of kremen1 morpholino antisense oligonucleotide (krm1-MO) (Gore et al., 2011), along with p53-MO to minimize non-specific cell death (Robu et al., 2007), into WT Tg(cldnB:GFP) zygotes produced embryos missing tc NMs and an anterior shift in the axial level of deposited NMs, phenotypes similar to those observed in krm1nl10 mutants (Fig. 1B,C,D,G). Together, these data indicate that the krm1nl10 mutant phenotype results from a loss of Kremen1 function.

kremen1, dkk1b/2 and lrp5/6 are expressed in the pLLP

At 30 hours post fertilization (hpf), kremen1 was expressed in discrete regions in the developing embryo, including the pLLP, lens, otic vesicle, midbrain-hindbrain boundary and the nascent tail fin fold (supplementary material Fig. S3A). The Kremen1 ligands dkk1b and dkk2 displayed complementary expression patterns to kremen1 in the developing embryo (supplementary material Fig. S3B,C). At 32 hpf, kremen1 was expressed in the leading and mid-zones of WT and krm1nl10 pLLP (Fig. 2A,B). By 40 hpf, kremen1 expression was restricted to the leading zone (Fig. 2C,D). We found that, in addition to the previously reported expression of dkk1b (Aman and Piotrowski, 2008), dkk2 was also expressed in the migrating pLLP. In WT embryos, both dkk1b and dkk2 were expressed in the mid-region of the pLLP between 32 and 40 hpf (Fig. 2E,G,I,K). dkk1b and dkk2 had similar expression domains in krm1nl10 primordia (Fig. 2F,H,J,L). By 40 hpf, dkk2 was primarily localized at the last deposited NM, and faint expression was present throughout the mutant pLLP, probably due to a loss of proper patterning in the mutant pLLP during late stages of migration (Fig. 2L). In addition, the Wnt and Dkk receptors lrp5 and lrp6 were expressed throughout the pLLP at 36 hpf (supplementary material Fig. S4A,B). In summary, the expression domains of kremen1, dkk1b, dkk2, lrp5 and lrp6 are consistent with their roles in modulating canonical Wnt activity in the pLLP.

Fig. 2.

Fig. 2.

kremen1, dkk1b and dkk2 are expressed in the pLLP of WT and krm1nl10 mutant embryos. (A-L) Expression of kremen1, dkk1b and dkk2 in the primordia (highlighted by dashed lines) of WT and krm1nl10 embryos at 32 and 40 hpf. kremen1 expression is progressively decreased and restricted to the leading zone between 32 and 40 hpf in WT (A,C) and krm1nl10 (B,D) embryos. dkk1b is expressed in the mid-zone of the pLLP at 32 and 40 hpf in WT (E,G) and krm1nl10 (F,H) embryos. dkk2 is expressed in the mid-zone at 32 hpf in WT (I) and mutant (J) primordia. At 40 hpf, dkk2 is expressed in the mid-zone of WT pLLP (K) and in the last deposited NM in mutant embryos; faint expression is present throughout the mutant pLLP (L). Scale bar: 20 µm.

Cellular proliferation and survival are impaired in krm1nl10 pLLP

Studies in mice and frogs have demonstrated that Kremen1 functions as an inhibitor of canonical Wnt signaling, and loss of Kremen1 function would therefore be expected to result in a Wnt overactivation phenotype (Nakamura et al., 2008). Zebrafish apcmcr mutants showed elevated Wnt/β-catenin activity that resulted in increased cellular proliferation and abnormal pLLP migration (Aman and Piotrowski, 2008; Aman et al., 2011). Surprisingly, rather than resembling a Wnt overactivation phenotype, the krm1nl10 pLL phenotype was strikingly similar to the loss of Wnt signaling found in lef1 mutants (McGraw et al., 2011; Valdivia et al., 2011). lef1 mutant primordia showed premature loss of pLLP organization and truncation of the pLL, due in part to a decrease of proliferative cells in the leading region of the pLLP. Thus, we asked whether cell proliferation is impaired in krm1nl10 mutant primordia.

Using a bromodeoxyuridine (BrdU) incorporation assay, we found that proliferation was reduced in krm1nl10 mutant pLLP compared with WT at 34 hpf (Fig. 3A-C). We also observed a significant increase in cell death in krm1nl10 primordia at 40 hpf using a terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay (17.1% TUNEL-positive primordia in WT embryos versus 40.0% in krm1nl10; Fig. 3D-F) and caspase immunoreactivity (13% of WT and 27% of mutant primordia showed increased caspase3 immunolabeling; supplementary material Fig. S5A-C). Interestingly, injection of the p53-MO did not rescue NM numbers or spacing in krm1nl10 mutants compared with uninjected mutant embryos (supplementary material Fig. S11E), suggesting that the loss of proliferation, but not a p53-dependent cell death, is a major cause of the krm1nl10 phenotype.

Fig. 3.

Fig. 3.

Cellular proliferation and survival are impaired in krm1nl10 pLLP. (A-B′) BrdU incorporation in WT and krm1nl10 primordia between 32.5 and 34 hpf. (C) Quantification of cells that have incorporated BrdU, showing a significant decrease in krm1nl10 mutant embryos versus WT (n=10 WT and 9 mutant embryos; **P<0.001, Student's t-test). (D-E′) Confocal projections of pLLP at 40 hpf labeled with TUNEL (red) in Tg(cldnB:GFP)+ (green) in WT (D,D′) and krm1nl10 (E,E′) embryos. (F) TUNEL-positive fractions of pLLPs. Significantly more krm1nl10 mutant pLLPs contained TUNEL-positive puncta (n=35 WT and 40 mutant embryos; *P<0.03, Fisher's Exact Test). (G-J′) Confocal projections of live Tg(cldnB:GFP) (green) embryos at 24 hpf labeled with nuclear-localized Kaede before (green) and after (red) photoconversion. At 24 hpf, both WT (G,G′) and krm1nl10 (H,H′) embryos contain photoconverted Kaede cells in the leading zone of the pLLP. At 48 hpf, photoconverted Kaede cells in the WT embryo have divided and are localized in the tc NMs (I,I′). In the krm1nl10 embryo, photoconverted cells have not proliferated (J,J′). (K) Quantification of photoconverted Kaede cells at 24 and 48 hpf; there are significantly fewer converted cells at 48 hpf in krm1nl10 mutant pLLP compared with WT (n=24 WT and 15 krm1nl10 mutant embryos; **P<0.001, Student's t-test). Scale bars: 20 µm.

To further define the cellular mechanisms underlying the krm1nl10 phenotype, we used photoconversion of the Kaede fluorophore to mark cells in the leading zone of pLLP at 24 hpf, and then examined their number and location at 48 hpf, when pLLP migration was complete. In WT embryos, labeled cells underwent multiple cell divisions (Fig. 3G,I,K) and populated the terminal NMs. In krm1nl10 embryos, there was no significant change in the number of labeled cells between 24 and 48 hpf (Fig. 3H,J,K). This result was strikingly different from the behavior of labeled progenitor cells in lef1nl2 mutants, which remained proliferative but prematurely exited the leading region (McGraw et al., 2011). Thus, krm1nl10 mutants more closely resemble a phenotype resulting from a global inhibition of Wnt activity by ectopic Dkk1b expression (Aman et al., 2011; McGraw et al., 2011) rather than loss of Wnt transcriptional activity seen in lef1nl2 mutants.

Wnt activity is prematurely and progressively decreased in krm1nl10 primordia

Because decreased proliferation and increased cell death are consistent with reduced Wnt signaling, we asked whether expression domains of Wnt target genes, lef1, axin2 and sef (Aman and Piotrowski, 2008), were altered in krm1nl10 mutant pLLPs. At 32 hpf, WT and krm1nl10 pLLPs showed similar expression patterns for lef1, axin2 and sef (Fig. 4A,B,G,H,M,N; Table 1). By 40 hpf, WT primordia displayed a reduction in expression of Wnt target genes, consistent with previous research showing that Wnt signaling was progressively decreased in the pLLP over the course of its migration (Valdivia et al., 2011; Matsuda et al., 2013). By contrast, krm1nl10 primordia showed an earlier reduction of target gene expression at 36 hpf and an even more substantial reduction by 40 hpf (Fig. 4D,F,J,L,P,R; Table 1).

Fig. 4.

Fig. 4.

Wnt activity is prematurely and progressively decreased in krm1nl10 mutants. (A-R) Expression of the Wnt targets, lef1, axin2 and sef, in the pLLP at 32, 36 and 40 hpf in WT and krm1nl10 embryos. In WT primordia, expression domains of lef1 (A,C,E), axin2 (G,I,K) and sef (M,O,Q) are progressively decreased between 32 and 40 hpf. In krm1nl10 mutant primordia, Wnt target expression is similar to WT at 32 hpf (B,H,N). At 36 hpf, expression domains are decreased in mutants compared with WT (D,J,P), and are absent in mutants at 40 hpf (F,L,R). dusp6 is expressed in the leading and mid-zones of WT primordia between 32 and 40 hpf (S,U,W); expression is absent in the leading zone of krm1nl10 mutant primordia at these stages (T,V,X). Scale bars: 20 µm.

Table 1.

Analysis of lef1 expression during pLLP migration

graphic file with name develop-141-102541-i1.jpg

To further investigate modulation of Wnt activity in krm1nl10 mutants, we used a transgenic biosensor line, Tg(7xtcf-siam:eGFP), which responds to Wnt/β-catenin activity (Valdivia et al., 2011; Moro et al., 2012). At 36 hpf, WT embryos showed GFP-positive cells predominantly in the leading region of the pLLP (supplementary material Fig. S6A-A″). By contrast, in krm1-MO-injected embryos, the number of GFP-positive cells was significantly decreased in the leading region of the pLLP (supplementary material Fig. S6B-B″,F), although the overall number of GFP-positive cells was not significantly different from WT (supplementary material Fig. S6E). By 40 hpf, GFP was significantly downregulated throughout the primordia of kremen1 morphants compared with WT embryos (supplementary material Fig. S6C-F). GFP-positive cells in the trailing and mid-region of morphant primordia at 40 hpf are localized at proto-NMs (supplementary material Fig. S6D-D″, yellow arrows). The fluorescent intensity of GFP expression was significantly reduced in morphant primordia compared with WT at both 36 and 40 hpf (supplementary material Fig. S6E). Together with decreased Wnt target expression, these results indicate a significant decline in Wnt activity in the leading region of the pLLP during later stages of mutant pLL formation.

Recent work has shown that expression of the ERK inhibitor dusp6 is regulated by canonical Wnt signaling through lef1 in the leading region of the pLLP and is required to inhibit Fgf activity (Matsuda et al., 2013). Whereas dusp6 was expressed in the leading and mid-region in WT primordia (Fig. 4S,U,W), its expression was absent in the leading region of the krm1nl10 mutant at 32 hpf (Fig. 4T) and restricted to the mid-zone and last-deposited NMs at 36 and 40 hpf (Fig. 4V,X). However, expression of the Wnt target fgf10a (Aman and Piotrowski, 2008; Matsuda et al., 2013) and the Fgf target pea3 were not grossly altered in krm1nl10 primordia (supplementary material Fig. S7A-L). Expression of the chemokines cxcr4b and cxcr7b that are required for proper pLLP migration were also not altered in krm1nl10 mutants compared with WT embryos (supplementary material Fig. S8A-D). Altogether, these data indicate that Wnt-mediated transcription is prematurely and progressively reduced, but not completely abolished in krm1nl10 primordia.

Loss of Kremen1 function leads to non-cell-autonomous defects in the pLLP

Because Kremen1 is a transmembrane receptor protein, we reasoned that decreased Wnt activity observed in krm1nl10 mutants might be rescued by introducing WT cells into krm1nl10 primordia. Mosaic WT embryos containing WT donor cells showed full extension of the pLL (6/6 embryos; Fig. 5A,B; supplementary material Fig. S9A,A′; Table 2). Surprisingly, presence of WT donor cells in krm1nl10 mutant pLLPs was unable to rescue pLL extension (0/16 embryos; Fig. 5C; supplementary material Fig. S9B,B′; Table 2). By contrast, similar numbers of WT donor cells were able to rescue pLL formation in lef1nl2 mutant hosts (5/5 embryos; supplementary material Fig. S9E,E′; Table 2) (McGraw et al., 2011). A similar non-cell-autonomous defect in pLLP migration was observed in mosaic embryos containing Tg(hsp70l:dkk1b-GFP) donor cells that were induced to secrete Dkk1b following heat shock (0/6 embryos showed tc formation; supplementary material Fig. S8D,D′; Table 2) (McGraw et al., 2011). Finally, mosaic embryos containing krm1nl10 donor cells on a WT background showed full pLL formation (10/10 embryos; supplementary material Fig. S9C,C′; Table 2). These results indicate that loss of Kremen1 function leads to non-cell-autonomous defects in mutant pLLP, similar to those induced by Dkk1b secretion; by contrast, mutant cells behave normally in a WT background.

Fig. 5.

Fig. 5.

Loss of Kremen1 leads to non-cell-autonomous defects in the pLLP. (A-D) Live confocal projections of mosaic, Tg(cldnB:GFP) WT or krm1nl10 embryos containing rhodamine-labeled donor cells (red) from WT donor embryos at 24 and 48 hpf. At 24 hpf, donor cells are found in the leading region of pLLP in WT (A) and mutant (C) hosts. At 48 hpf, the pLLP shown in A has migrated along the length of the trunk and formed the terminal cluster (tc; B), whereas the mutant pLLP in C has failed to migrate and diminished to a thin trail of cells (D, yellow arrowhead). (E-H″) Live confocal projections of WT and krm1nl10 host embryos that express TgBAC(neuroD:eGFP) and contain donor cells from Tg(7xtcf-siam:eGFP) donor embryos labeled with rhodamine (red). At 24 hpf, the leading region of primordia of both WT (E-E″) and mutant (F-F″) hosts contain GFP-positive (E′,F′) and rhodamine-positive (E″,F″) donor cells (white arrows). At 48 hpf, GFP/rhodamine-positive cells remain in the leading zone of WT primordia (G-H″, white arrows). In krm1nl10 mutant primordia, few GFP-positive cells remain (H-H′), and the remaining rhodamine-positive donor cells are fragmented and appear to undergo cell death (H″; blue arrowheads). (I) Quantification of Tg(7xtcf-siam:eGFP)-positive donor cells at 24 hpf and 48 hpf in control (WT donor cells in WT hosts) and experimental (WT donor cells in krm1nl10 hosts) primordia (n=5 krm1nl10 hosts, 10 WT hosts; **P=0.007, Student's t-test). Scale bars: 20 µm.

Table 2.

pLL formation in chimeric embryos

graphic file with name develop-141-102541-i2.jpg

The failure of WT donor cells to rescue the krm1nl10 phenotype could be explained by a non-cell-autonomous loss of Wnt signaling in these cells. We tested this by generating mosaic embryos that contained Tg(7xtcf-siam:eGFP) donor cells in WT or krm1nl10 hosts. At 24 hpf, GFP-positive donor cells were present in both WT and mutant host primordia (Fig. 5E,F,I). By 48 hpf, GFP-positive cells contributed to the deposited NMs, including the tc NMs of WT hosts (Fig. 5G,I; supplementary material Movie 3). By contrast, the majority of donor cells in krm1nl10 mutant hosts downregulated GFP and possibly underwent cell death, as indicated by the rhodamine-positive cell fragments in the pLLP (blue arrowheads; Fig. 5H,I; supplementary material Movie 4). Together, these data suggest that loss of Kremen1 function results in a non-cell-autonomous decrease in Wnt signaling in krm1nl10 primordia.

Attenuation of Dkk partially rescues the krm1nl10 phenotype

Based on our data, we hypothesized that a loss of Wnt signaling in krm1nl10 mutant pLLPs resulted from an expansion of Dkk activity. Unfortunately, we were unable to obtain commercial antibodies that recognized zebrafish Dkk1b or Dkk2 proteins to directly test this model. Thus, we used a number of approaches to decrease Dkk activity in WT and krm1nl10 embryos. We reasoned that if our hypothesis was correct, attenuating Dkk activity should rescue the pLL truncation in krm1nl10 mutants.

Fgf signaling in the pLLP is known to be required for the proper expression of dkk1b (Aman and Piotrowski, 2008). Thus, we decreased Dkk function in the pLLP by attenuating Fgf signaling with the pharmacological inhibitor SU5402 (Mohammadi et al., 1997). WT and krm1nl10 embryos were treated with a suboptimal dose of SU5402 (a dose that did not cause pLL patterning defect in WT) or DMSO (control) beginning at 24 hpf, and the extent of pLLP migration and NM spacing were analyzed at 2 dpf. As expected, dkk1b expression was decreased and lef1 expression increased following SU5402 treatment in both WT and krm1nl10 embryos when compared with DMSO-treated controls (Fig. 6G-N). We found that NM spacing, but not NM number, was rescued in the treated krm1nl10 mutant embryos, and that WT primordia migrated to the end of the tail to deposit a full complement of NMs (Fig. 6A-F). BrdU incorporation indicated that proliferation was not rescued in SU5402-treated krm1nl10 mutants compared with DMSO-treated controls and was decreased in SU5402 WT pLLP (supplementary material Fig. S10). These results suggest that reduction of Dkk levels through inhibition of Fgf signaling partially rescues pLLP patterning in krm1nl10 mutants.

Fig. 6.

Fig. 6.

Inhibition of Fgf signaling partially rescues NM spacing in krm1nl10 mutants. (A-D) Confocal projection of 2 dpf Tg(cldnB:GFP) WT or krm1nl10 embryos, treated with either DMSO (controls) or SU5402. (A,E) DMSO-treated WT embryos show full pLLP extension and tc formation. (B,E) krm1nl10 mutants treated with DMSO show pLL truncation midway along the trunk (yellow arrowhead). (C,E) Suboptimal SU5402 treatment of WT embryos results in normal pLL extension and tc formation. (D,E) In krm1nl10 mutants, pLLP migration is partially rescued and pLL is extended to the end of the tail (yellow arrowhead), although tc NMs are rarely present (n=10 embryos per condition; P<0.001, two-way ANOVA with replication). (F) NM numbers are not significantly different between WT embryos treated with DMSO or SU5402 and between krm1nl10 mutants treated with DMSO or SU5402 (n=10 embryos/condition; **P<0.001, Student's t-test). (G-N) Expression of dkk1b or lef1 in WT and krm1nl10 pLLPs treated with DMSO or SU5402 at 36 hpf. dkk1b is expressed in the mid-region of the pLLP of DMSO-treated WT (G) and mutant (H) embryos. In SU5402-treated embryos, dkk1b expression is reduced in WT pLLP (I) and absent in krm1nl10 pLLP (J). lef1 is expressed in the leading region of WT primordia (K) and absent in krm1nl10 mutant primordia treated with DMSO (L). SU5402 treatment results in increased lef1 expression in WT (M) and mutant (N) primordia. Scale bars: 20 µm.

Next, we blocked Dkk function by injecting WT or krm1nl10 zygotes with dkk1b and/or dkk2 splice-blocking morpholinos (supplementary material Fig. S11A-C). In all conditions, including control embryos, p53-MO was also co-injected to minimize non-specific cell death. Injection of the individual dkk-MOs resulted in a small but significant increase in the number of deposited NMs in krm1nl10 mutants compared with krm1nl10 embryos injected with p53-MO (supplementary material Fig. S11D). Co-injection of both dkk1b/2-MOs resulted in a rescue of NM numbers comparable to that of WT (supplementary material Fig. S11D). WT embryos injected with dkk1b, dkk2 or dkk1b/2-MOs did not show a significant change in NM number compared with WT p53 morphants, although their NMs were shifted caudally (supplementary material Fig. S11D; Fig. 7A,C,E). krm1nl10 embryos injected with dkk1b/2-MOs showed a partial rescue of NM spacing compared with control krm1nl10 embryos (Fig. 7B,D,E); in a subset of embryos, the pLLP migrated to the end of the tail. In addition, krm1nl10 embryos injected with dkk1b/2-MOs showed rescue of BrdU incorporation levels (Fig. 7J-N). Both WT and mutant embryos also showed expanded lef1 expression domains in the primordia following dkk1b/2-MO injection (Fig. 7F-I). This is consistent with a previous report, indicating that the size of the Wnt signaling domain in the pLLP regulated NM spacing (Matsuda et al., 2013). Together, these results support the model that expansion of Dkk activity in krm1nl10 mutants is responsible for the premature loss of Wnt activity in the pLLP. When Dkk function is inhibited by dkk1b/2-MO injection, Wnt activity and cellular proliferation are restored in krm1nl10 mutants, which in turn results in partial to full rescue of NM number and spacing.

Fig. 7.

Fig. 7.

dkk1b/2 morpholino injections rescue krm1nl10 pLL formation. (A-D) Confocal projection of 2 dpf Tg(cldnB:GFP) WT or krm1nl10 embryos, injected with either control or dkk1b/2-MOs. (A) Control WT embryos show full pLLP migration and tc formation. (B) Control krm1nl10 embryos display characteristic premature stalling of the pLLP (yellow arrowhead). (C) Injection of dkk1b/2-MOs in WT embryos results in full pLLP migration and tc formation, although NM spacing is shifted posteriorly. (D) In krm1nl10 mutants injected with dkk1b/2-MOs, pLLP migration and pLL formation are partially rescued (yellow arrowhead). (E) NM spacing in krm1nl10 mutants injected with dkk1b/2-MOs is not significantly different from WT control NMs (n=8 embryos/condition; P<0.001, two-way ANOVA with replication). (F-I) lef1 expression at 36 hpf is restricted to the pLLP leading region in control WT pLLP (F) and downregulated in control krm1nl10 mutant pLLP (G). dkk1b/2-MO injection results in an expansion of lef1 expression in both WT (H) and krm1nl10 (I) primordia. (J-M′) Confocal projections of BrdU incorporation in both WT and krm1nl10 control and dkk1b/2-MO-injected embryos at 30 hpf. BrdU incorporation index is high in the leading region of control WT embryos (J,J′,N) and significantly decreased in krm1nl10 mutants (K,K′,N). dkk1b/2-MO injection results in no change in WT (L,L′,N) and in a significant increase in the BrdU incorporation index in the leading region of krm1nl10 mutant primordia (M,M′,N) (n=10 embryos per condition; **P=0.007, Student's t-test). Scale bars: 20 µm.

Kremen1 restricts the spread of Dkk1b protein in the pLLP

Based on our data, we predicted that Kremen1 acts to restrict the domain of Dkk activity in the pLLP. To examine the behavior of Dkk1b protein during pLLP migration, we generated a tagged version of Dkk1b under the control of the heat shock promoter (hsp70:dkk1b-mTangerine). Mosaic expression of the ectopic Dkk1b-mTangerine protein beginning at 25 hpf resulted in severe pLL truncation and loss of NMs in both WT and krm1nl10 embryos at 2 dpf (supplementary material Fig. S12). This phenotype is consistent with global induction of Dkk1b expression (McGraw et al., 2011) and indicates that the fusion protein is functional. To examine the behavior of tagged Dkk1b protein during pLLP migration, we heat-shocked injected embryos at 25 hpf and examined the spread of mTangerine fluorescence in WT and krm1nl10 embryos at 28 hpf, prior to the onset of Dkk1b-induced cell death. We only analyzed primordia containing between one and three Dkk1b-mTangerine-positive cells, so we could unambiguously determine the source of the secreted fusion protein. In mutant primordia, we found a significant increase in the amount of Dkk1b-mTangerine at two cell diameters from the expressing cell compared with WT primordia. Importantly, despite the transient nature of the transgene expression, there was no significant difference in mTangerine levels within the source cells (Fig. 8A-D). These data suggest that Kremen1 is necessary to limit the spread, and possibly the subsequent activity, of Dkk1b in the pLLP.

Fig. 8.

Fig. 8.

Mosaic expression of Dkk1b-mTangerine shows a greater spread in krm1nl10 primordia. (A-B‴) Confocal projections of 28 hpf WT and krm1nl10 pLLP showing mosaic expression of Dkk1b-mTangerine driven by heat shock promoter, which was activated at 25 hpf. (A-A‴) WT showing expression of Dkk1b-mTangerine in a single cell (inner dashed lines) and low expression levels in surrounding cells (outer dashed lines). (B-B‴) krm1nl10 mutant expressing Dkk1b-mTangerine in a single cell (inner dashed lines) and punctate expression in surrounding cells (outer dashed lines). (C) Quantification of mTangerine fluorescence intensity in arbitrary units (A.U.). ROI: two cell diameters from the mTangerine-expressing source cell, excluding the source cell, minus background. (D) Quantification of mTangerine expression intensity in the source cell (A.U.) shows no significant difference between WT and mutant cells. Note that krm1nl10 mutants show a significant increase in fluorescence intensity compared with WT (n=31 WT and n=30 krm1nl10 primordia in six separate experiments; **P<0.04, Student's t-test). Scale bar: 20 µm.

DISCUSSION

In this paper, we describe a novel zebrafish mutant strain (krm1nl10) that carries a genetic lesion in kremen1, a non-obligate co-receptor for the Dkk family of secreted Wnt inhibitors. krm1nl10 mutants fail to form a complete pLL due to a loss of Wnt signaling in the leading region of the pLLP, which in turn results in a decreased cellular proliferation, increased cell death and loss of Wnt target gene expression. Transplantation of WT donor cells into the krm1nl10 primordia failed to rescue the mutant phenotype, demonstrating the non-cell-autonomous effects of the mutation. In mosaic embryos, krm1nl10 donor cells were able to contribute to pLL formation in a WT host, consistent with the role of Kremen1 as a non-obligate receptor for Dkk. Attenuation of Dkk levels either partially or completely rescued pLL formation in the krm1nl10 mutants. Our overexpression experiments also demonstrated that the Dkk1b fusion protein has a more extensive spread from the source cell in the mutant background. We conclude that Kremen1 restricts the domain of Dkk to the mid-region of the pLLP, probably through mediating the endocytosis of the Dkk-Lrp5/6 complex. In the absence of Kremen1 function, Dkk improperly spreads and inhibits normal Wnt signaling (supplementary material Fig. S13). This represents a previously unidentified mechanism for the precise modulation of canonical Wnt activity in the context of collective cell migration.

Kremen1 is required to modulate Wnt activity in the pLLP

Previous in vitro and in vivo studies have demonstrated that Kremen1 acts together with Dkk to inhibit Wnt signaling and that loss of Kremen1 results in overactivation of canonical Wnt signaling (Nakamura et al., 2008). By contrast, we observed phenotypes consistent with Wnt inhibition in the pLLP of the krm1nl10 mutants. The evidence for this included: truncation of the pLL and an anterior shift in the spacing of the deposited NMs; phenotypes observed during inhibition of Wnt signaling (McGraw et al., 2011; Valdivia et al., 2011; Matsuda et al., 2013); expression of Wnt target genes during pLLP migration were prematurely and progressively decreased in krm1nl10 mutants; expression of the Wnt sensor line Tg(7xtcf-siam:eGFP) was decreased in kremen1 morphants; and absence of Wnt-dependent dusp6 expression (Matsuda et al., 2013) in the leading region of krm1nl10 mutant primordia. Additionally, we observed a decrease in BrdU incorporation and an increase in cell death in the pLLPs of krm1nl10 mutants. Lineage labeling of progenitor cells in the pLLP further revealed that cells in krm1nl10 mutants failed to divide and remained in the leading region. Altogether, krm1nl10 mutants displayed a gradual loss of Wnt activity that resembled the phenotype seen after ectopic activation of Dkk1b activity (Aman et al., 2011; McGraw et al., 2011).

Dkk activity is ectopically expanded following loss of Kremen1 function

Based on the loss of Wnt activity phenotype and additional experiments (mosaic analyses, attenuation of Dkk expression and analysis of tagged-Dkk1b protein), we propose a model in which Kremen1 plays a role in limiting the range of Dkk proteins in the pLLP. We propose that in krm1n10 mutants, the absence of Kremen1 results in a failure of Dkk-Lrp5/6 endocytosis, leading to the spread of Dkk throughout the pLLP and to improper diminishment of Wnt activity in the leading region. Generation of mosaic embryos containing WT donor cells in krm1nl10 mutant hosts revealed that the absence of Kremen1 function resulted in non-cell-autonomous defects, i.e. a failure by donor cells to rescue the krm1nl10 phenotype. Additional mosaic analyses using Tg(7xtcf-siam:eGFP) donor cells in krm1nl10 hosts showed a distinct non-cell-autonomous loss of Wnt-mediated GFP expression in transplanted cells. This result is strikingly different from that observed in mosaic lef1nl2 embryos containing WT donor cells, which showed complete rescue of the pLL (McGraw et al., 2011), again underscoring the non-cell-autonomous nature of the krm1nl10 mutant phenotype. How could mutation of Kremen1, a membrane-localized receptor, exert non-cell-autonomous defects on cells in the pLLP? As Kremen1 is a receptor for the secreted Wnt inhibitor Dkk and regulates endocytosis of the Kremen1-Dkk-Lrp5/6 complex (Mao et al., 2002), we reasoned that in krm1nl10 mutants, Dkk was perhaps not properly cleared from the pLLP. We were unable to directly test this model due to a lack of antibodies that recognize zebrafish Dkk proteins. Thus, we used indirect methods, such as attenuation or blocking of Dkk activity and ectopic expression of tagged Dkk1b protein. When we decreased Dkk levels in the mutant pLLPs either by blocking Fgf signaling, which regulates dkk1b expression in the pLLP (Aman and Piotrowski, 2008), or by dkk1b/2 morpholino injections, we found a partial rescue pLL formation in krm1nl10 mutants. Mosaic expression of tagged Dkk1b protein in WT and krm1nl10 mutant primordia revealed a significant increase in the spread of Dkk1b-mTangerine in mutant pLLP. Together, these results support our model that Kremen1 functions to restrict the domain of Dkk activity in the pLLP. Future work is required to examine the behavior of native Dkk1b protein in these mutants.

Kremen1/2 can function to facilitate Wnt activity in the absence of Dkk

We show that kremen1, but not dkk1b/2, is expressed in the leading region of the pLLP. This raises the question of whether Kremen1 might have another function in addition to acting as a Dkk receptor. Previous work in vitro demonstrated that, in the absence of Dkk1, Kremen1/2 binds to and stabilizes Lrp6 at the cell surface, thus promoting Wnt activity. Additionally, Dkk2 has been shown to stimulate Wnt signaling during neural crest induction (Hassler et al., 2007). The possibility that Kremen1 might also play a role in promoting Wnt activity in the pLLP is compatible with our model, in which Kremen1 is also required to restrict the range of Dkk activity. However, inhibiting Dkk1b/2 function is able to partially or fully rescue pLL formation in krm1nl10 mutants, which argues against Kremen1 promoting Wnt activity. Future work is needed to determine whether Kremen1 has additional roles in modulating Wnt signaling in the pLLP.

In conclusion, we have shown that Kremen1 modulates Wnt signaling in the pLLP and is required for proper collective cell migration. Our data indicate that in the absence of Kremen1 function, Wnt signaling is prematurely downregulated in the pLLP in a non-cell-autonomous manner through an ectopic expansion of Dkk proteins. As improper Wnt signaling has been implicated in collective cancer invasion (Friedl and Gilmour, 2009), and expression of kremen1 is altered in some cancers (Dun et al., 2010; Murphy et al., 2012), our findings may provide a potential mechanism for Wnt misregulation during disease.

MATERIALS AND METHODS

Zebrafish strains

Embryonic and adult zebrafish were staged and maintained according to standard protocols (Kimmel et al., 1995). The transgenic fish strains used were: Tg(-8.0claudinB:lyneGFP)zf106, referred to as Tg(cldnB:GFP) (Haas and Gilmour, 2006), Tg(neuroD:eGFP)nl1 (Obholzer et al., 2008), Tg(hsp70l:dkk1b-GFP)w32 (Stoick-Cooper et al., 2007) and Tg(7xtcf-siam:eGFP)ia4 (Valdivia et al., 2011; Moro et al., 2012).

Positional cloning of krm1nl10 and mRNA injections

The genetic lesion underlying the krm1nl10 phenotype was identified using standard simple sequence length polymorphism (SSLP) mapping techniques (Gates et al., 1999). To identify polymorphisms, heterozygous carriers of krm1nl10 on a polymorphic *AB/WIK background were intercrossed to produce homozygous, heterozygous and WT progeny. The krm1nl10 lesion was located on the distal arm of chromosome 5, in the kremen1 gene (GenBank accession number: BC158176.1). WT and mutant mRNAs were generated using the mMessage kit (Ambion) and were injected at 200 pg/nl into one-cell stage zygotes.

RNA in situ hybridization, immunolabeling, TUNEL labeling, BrdU-incorporation and DASPEI labeling

RNA in situ hybridization was performed using standard protocols (Andermann et al., 2002). Antisense RNA probes generated were: lef1 (Dorsky et al., 1999), axin2 (Aman and Piotrowski, 2008), fgf10a (Grandel et al., 2000), pea3 (Raible and Brand, 2001; Roehl and Nüsslein-Volhard, 2001), sef (Aman and Piotrowski, 2008), dusp6 (Lee et al., 2005), dkk1b (Aman and Piotrowski, 2008), cxcr4b and cxcr7b (Dambly-Chaudiere et al., 2007). We cloned full-length cDNA and used it to generated probes for kremen1 (forward RT-PCR primer: AGTGTTATACAGCGAATGG, reverse RT-PCR primer: TTAGTTTCCCACAAGTGGG) and dkk2 (forward RT-PCR primer: ATGCTCACTGTTACGAGGAGT, reverse RT-PCR primer: GTATGGATCGTCCCTTCTTAG). Whole-mount immunolabeling was performed following established protocols (Ungos et al., 2003). The following antibodies were used: rabbit or mouse anti-GFP (Life Technologies, A11122 and A11120, respectively; both 1:1000), rat anti-BrdU (Abcam, ab6326; 1:100), rabbit anti-activated caspase 3 (Cell Signaling, 9664; 1:200), Alexa 488 (Life Technologies, A11001; 1:1000) and Alexa 568 (Life Technologies, A11011; 1:1000). TUNEL labeling was performed using an established protocol modified for fluorescent detection (Nechiporuk et al., 2005). BrdU incorporation was carried out using established protocols (Harris et al., 2003; Laguerre et al., 2005). Adult NMs were labeled with 0.005% 2-[4-(dimethylamino)styryl]-N-ethylpyridinium iodide (DASPEI; Life Technologies) in embryo medium for 20 min at room temperature.

Imaging, Kaede photoconversion and time-lapse microscopy

Confocal analyses and time-lapse imaging were performed using an Olympus FV1000 confocal system. Nomarski images were collected using a Zeiss Imager Z1 compound microscope. Individual cells were lineage-labeled using photoconversion of the Kaede fluorophore as previously described (Ando et al., 2002; McGraw et al., 2011). Cell counts were determined using DAPI (30 μM; Life Technologies)-labeled nuclei. For time-lapse imaging, embryos were analyzed between 36 and 48 hpf using established techniques (McGraw et al., 2011). Images were processed using ImageJ software (Abramoff et al., 2004). Brightness and contrast were adjusted using the Adobe Photoshop software package.

Morpholino injections and inhibitor treatment

All antisense oligonucleotide morpholinos (Genetools) were co-injected with the p53-MO (Robu et al., 2007) at twice the concentration of the experimental MOs. The p53-MO was injected at 10 μg/μl for control experiments. A translation-blocking MO against kremen1 (a gift from the Weinstein laboratory, 5′-AAGCTGCGACTCTCCACGAATCCAT-3′) (Gore et al., 2011) was injected at 0.5 μg/μl. Splice donor site-blocking MOs were designed against dkk1b exon 1/intron1 (dkk1b-MO: GCATATTTCTATGCTTACCTGCGGT) and dkk2 exon2/intron2 (dkk2-MO: AATTGAACAAGCGTACAGTTGCTGC), and injected at 7 μg/μl. RT-PCR was carried out using dkk1b-forward ATGATGCACA-TCGCCATGCTC/dkk1b-reverse GCACACATGCCAGAGACACTAA and the dkk2 primers described above. Fgf was inhibited using 75 μM SU5402 (Calbiochem) in embryo medium, and control embryos were treated with DMSO.

hsp70:dkk1b-mTangerine plasmid construction, injection and heat shock conditions

Full-length dkk1b was amplified by PCR from an EST clone (accession#: DV598280) using primers that contained attB1 and attB2 sites. Following amplification, PCR products were recombined into a pDONR221 vector, and the hsp70:dkk1b-mTangerine plasmid was assembled using components of the Tol2kit (Kwan et al., 2007). Ten pg/nl of the plasmid DNA was injected into one-cell stage embryos. At 25 hpf, embryos were heat-shocked at 39°C for 40 min using a thermocycler (Applied Biosystems).

Transplantation experiments

Transplantation experiments were carried out as previously described (Nechiporuk and Raible, 2008). In brief, rhodamine dextran (Life Technologies)-labeled donor cells from blastula stage embryos were transplanted in the left side of gastrula-stage host embryos. Host embryos were imaged at 24 hpf to determine the position of donor cells in the pLLP and at 48 hpf to assess pLL formation.

Data analysis and statistics

All data are presented as average±s.e.m. Fluorescence intensity was determined using the ImageJ analysis tool, and values (in arbitrary units, A.U.) were generated by selecting a region of interest (ROI) in the pLLP, collecting mean fluorescence intensity and then subtracting nearby background. For analysis of Dkk1b-mTangerine expression, the ROI was set at two cell diameters (based on DAPI and membrane marker expression) surrounding the Dkk1b-mTangerine-expressing cell, excluding the expressing cell itself. Separate expression levels were collected for the Dkk1b-mTangerine-expressing cell. Calculation of statistical significance was carried out using VassarStats (http://vassarstats.net/index.html).

Supplementary Material

Supplementary Material

Acknowledgements

We thank the Weinstein laboratory at The National Institute of Child Health and Human Development for reagents and David Kimelman and Catherine Drerup for comments on the manuscript.

Footnotes

Competing interests

The authors declare no competing financial interests.

Author contributions

H.F.M. conceived experiments, performed experiments, interpreted data and wrote the manuscript. M.D.C. performed experiments and A.V.N. conceived experiments and edited the manuscript.

Funding

This work was funded by The American Heart Association Postdoctoral Fellowship [11POST7210061] and The Collins Medical Trust Award to H.F.M. and by funds from the National Institute of Child Health and Human Development [1R01HD072844] and the American Cancer Society [RSG DDC-24733] to A.V.N. Deposited in PMC for release after 12 months.

Supplementary material

Supplementary material available online at http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.102541/-/DC1

References

  1. Abramoff M. D., Magelhaes P. J., Ram S. J. (2004). Image processing with ImageJ. Biophoton. Int. 11, 36-42. [Google Scholar]
  2. Aman A., Piotrowski T. (2008). Wnt/beta-catenin and Fgf signaling control collective cell migration by restricting chemokine receptor expression. Dev. Cell 15, 749-761 10.1016/j.devcel.2008.10.002 [DOI] [PubMed] [Google Scholar]
  3. Aman A., Piotrowski T. (2009). Multiple signaling interactions coordinate collective cell migration of the posterior lateral line primordium. Cell Adh. Migr. 3, 365-368 10.4161/cam.3.4.9548 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aman A., Nguyen M., Piotrowski T. (2011). Wnt/β-catenin dependent cell proliferation underlies segmented lateral line morphogenesis. Dev. Biol. 349, 470-482 10.1016/j.ydbio.2010.10.022 [DOI] [PubMed] [Google Scholar]
  5. Andermann P., Ungos J., Raible D. W. (2002). Neurogenin1 defines zebrafish cranial sensory ganglia precursors. Dev. Biol. 251, 45-58 10.1006/dbio.2002.0820 [DOI] [PubMed] [Google Scholar]
  6. Ando R., Hama H., Yamamoto-Hino M., Mizuno H., Miyawaki A. (2002). An optical marker based on the UV-induced green-to-red photoconversion of a fluorescent protein. Proc. Natl. Acad. Sci. USA 99, 12651-12656 10.1073/pnas.202320599 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chitnis A. B., Nogare D. D., Matsuda M. (2012). Building the posterior lateral line system in zebrafish. Dev. Neurobiol. 72, 234-255 10.1002/dneu.20962 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cselenyi C. S., Lee E. (2008). Context-dependent activation or inhibition of Wnt-beta-catenin signaling by Kremen. Sci. Signal. 1, e10 10.1126/stke.18pe10 [DOI] [PubMed] [Google Scholar]
  9. Dambly-Chaudière C., Cubedo N., Ghysen A. (2007). Control of cell migration in the development of the posterior lateral line: antagonistic interactions between the chemokine receptors CXCR4 and CXCR7/RDC1. BMC Dev. Biol. 7, 23 10.1186/1471-213X-7-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Davidson G., Mao B., del Barco Barrantes I., Niehrs C. (2002). Kremen proteins interact with Dickkopf1 to regulate anteroposterior CNS patterning. Development 129, 5587-5596 10.1242/dev.00154 [DOI] [PubMed] [Google Scholar]
  11. Dorsky R. I., Snyder A., Cretekos C. J., Grunwald D. J., Geisler R., Haffter P., Moon R. T., Raible D. W. (1999). Maternal and embryonic expression of zebrafish lef1. Mech. Dev. 86, 147-150 10.1016/S0925-4773(99)00101-X [DOI] [PubMed] [Google Scholar]
  12. Dun X., Jiang H., Zou J., Shi J., Zhou L., Zhu R., Hou J. (2010). Differential expression of DKK-1 binding receptors on stromal cells and myeloma cells results in their distinct response to secreted DKK-1 in myeloma. Mol. Cancer 9, 247 10.1186/1476-4598-9-247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ellwanger K., Saito H., Clement-Lacroix P., Maltry N., Niedermeyer J., Lee W. K., Baron R., Rawadi G., Westphal H., Niehrs C. (2008). Targeted disruption of the Wnt regulator Kremen induces limb defects and high bone density. Mol. Cell. Biol. 28, 4875-4882 10.1128/MCB.00222-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Friedl P., Gilmour D. (2009). Collective cell migration in morphogenesis, regeneration and cancer. Nat. Rev. Mol. Cell Biol. 10, 445-457 10.1038/nrm2720 [DOI] [PubMed] [Google Scholar]
  15. Gates M. A., Kim L., Egan E. S., Cardozo T., Sirotkin H. I., Dougan S. T., Lashkari D., Abagyan R., Schier A. F., Talbot W. S. (1999). A genetic linkage map for zebrafish: comparative analysis and localization of genes and expressed sequences. Genome Res. 9, 334-347. [PubMed] [Google Scholar]
  16. Gore A. V., Swift M. R., Cha Y. R., Lo B., McKinney M. C., Li W., Castranova D., Davis A., Mukouyama Y.-S., Weinstein B. M. (2011). Rspo1/Wnt signaling promotes angiogenesis via Vegfc/Vegfr3. Development 138, 4875-4886 10.1242/dev.068460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Grandel H., Draper B. W., Schulte-Merker S. (2000). dackel acts in the ectoderm of the zebrafish pectoral fin bud to maintain AER signaling. Development 127, 4169-4178. [DOI] [PubMed] [Google Scholar]
  18. Grigoryan T., Wend P., Klaus A., Birchmeier W. (2008). Deciphering the function of canonical Wnt signals in development and disease: conditional loss- and gain-of-function mutations of beta-catenin in mice. Genes Dev. 22, 2308-2341 10.1101/gad.1686208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Haas P., Gilmour D. (2006). Chemokine signaling mediates self-organizing tissue migration in the zebrafish lateral line. Dev. Cell 10, 673-680 10.1016/j.devcel.2006.02.019 [DOI] [PubMed] [Google Scholar]
  20. Harding M. J., Nechiporuk A. V. (2012). Fgfr-Ras-MAPK signaling is required for apical constriction via apical positioning of Rho-associated kinase during mechanosensory organ formation. Development 139, 3130-3135 10.1242/dev.082271 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Harris J. A., Cheng A. G., Cunningham L. L., MacDonald G., Raible D. W., Rubel E. W. (2003). Neomycin-induced hair cell death and rapid regeneration in the lateral line of zebrafish (Danio rerio). J. Assoc. Res. Otolaryngol. 4, 219-234 10.1007/s10162-002-3022-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hassler C., Cruciat C.-M., Huang Y.-L., Kuriyama S., Mayor R., Niehrs C. (2007). Kremen is required for neural crest induction in Xenopus and promotes LRP6-mediated Wnt signaling. Development 134, 4255-4263 10.1242/dev.005942 [DOI] [PubMed] [Google Scholar]
  23. Kimmel C. B., Ballard W. W., Kimmel S. R., Ullmann B., Schilling T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310 10.1002/aja.1002030302 [DOI] [PubMed] [Google Scholar]
  24. Kwan K. M., Fujimoto E., Grabher C., Mangum B. D., Hardy M. E., Campbell D. S., Parant J. M., Yost H. J., Kanki J. P., Chien C.-B. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev. Dyn. 236, 3088-3099 10.1002/dvdy.21343 [DOI] [PubMed] [Google Scholar]
  25. Laguerre L., Soubiran F., Ghysen A., König N., Dambly-Chaudière C. (2005). Cell proliferation in the developing lateral line system of zebrafish embryos. Dev. Dyn. 233, 466-472 10.1002/dvdy.20343 [DOI] [PubMed] [Google Scholar]
  26. Lee Y., Grill S., Sanchez A., Murphy-Ryan M., Poss K. D. (2005). Fgf signaling instructs position-dependent growth rate during zebrafish fin regeneration. Development 132, 5173-5183 10.1242/dev.02101 [DOI] [PubMed] [Google Scholar]
  27. Lu H., Ma J., Yang Y., Shi W., Luo L. (2013). EpCAM is an endoderm-specific Wnt derepressor that licenses hepatic development. Dev. Cell 24, 543-553 10.1016/j.devcel.2013.01.021 [DOI] [PubMed] [Google Scholar]
  28. Mao B., Wu W., Davidson G., Marhold J., Li M., Mechler B. M., Delius H., Hoppe D., Stannek P., Walter C., et al. (2002). Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. Nature 417, 664-667 10.1038/nature756 [DOI] [PubMed] [Google Scholar]
  29. Matsuda M., Nogare D. D., Somers K., Martin K., Wang C., Chitnis A. B. (2013). Lef1 regulates Dusp6 to influence neuromast formation and spacing in the zebrafish posterior lateral line primordium. Development 140, 2387-2397 10.1242/dev.091348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. McGraw H. F., Drerup C. M., Culbertson M. D., Linbo T., Raible D. W., Nechiporuk A. V. (2011). Lef1 is required for progenitor cell identity in the zebrafish lateral line primordium. Development 138, 3921-3930 10.1242/dev.062554 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Mohammadi M., McMahon G., Sun L., Tang C., Hirth P., Yeh B. K., Hubbard S. R., Schlessinger J. (1997). Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276, 955-960 10.1126/science.276.5314.955 [DOI] [PubMed] [Google Scholar]
  32. Moro E., Ozhan-Kizil G., Mongera A., Beis D., Wierzbicki C., Young R. M., Bournele D., Domenichini A., Valdivia L. E., Lum L., et al. (2012). In vivo Wnt signaling tracing through a transgenic biosensor fish reveals novel activity domains. Dev. Biol. 366, 327-340 10.1016/j.ydbio.2012.03.023 [DOI] [PubMed] [Google Scholar]
  33. Murphy A. J., de Caestecker C., Pierce J., Boyle S. C., Ayers G. D., Zhao Z., Libes J. M., Correa H., Walter T., Huppert S. S., et al. (2012). CITED1 expression in liver development and hepatoblastoma. Neoplasia 14, 1153-1163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Nakamura T., Nakamura T., Matsumoto K. (2008). The functions and possible significance of Kremen as the gatekeeper of Wnt signalling in development and pathology. J. Cell. Mol. Med. 12, 391-408 10.1111/j.1582-4934.2007.00201.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nechiporuk A., Raible D. W. (2008). FGF-dependent mechanosensory organ patterning in zebrafish. Science 320, 1774-1777 10.1126/science.1156547 [DOI] [PubMed] [Google Scholar]
  36. Nechiporuk A., Linbo T., Raible D. W. (2005). Endoderm-derived Fgf3 is necessary and sufficient for inducing neurogenesis in the epibranchial placodes in zebrafish. Development 132, 3717-3730 10.1242/dev.01876 [DOI] [PubMed] [Google Scholar]
  37. Obholzer N., Wolfson S., Trapani J. G., Mo W., Nechiporuk A., Busch-Nentwich E., Seiler C., Sidi S., Sollner C., Duncan R. N., et al. (2008). Vesicular glutamate transporter 3 is required for synaptic transmission in zebrafish hair cells. J. Neurosci. 28, 2110-2118 10.1523/JNEUROSCI.5230-07.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Osada M., Ito E., Fermin H. A., Vazquez-Cintron E., Venkatesh T., Friedel R. H., Pezzano M. (2006). The Wnt signaling antagonist Kremen1 is required for development of thymic architecture. Clin. Dev. Immunol. 13, 299-319 10.1080/17402520600935097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Raible F., Brand M. (2001). Tight transcriptional control of the ETS domain factors Erm and Pea3 by Fgf signaling during early zebrafish development. Mech. Dev. 107, 105-117 10.1016/S0925-4773(01)00456-7 [DOI] [PubMed] [Google Scholar]
  40. Robu M. E., Larson J. D., Nasevicius A., Beiraghi S., Brenner C., Farber S. A., Ekker S. C. (2007). p53 activation by knockdown technologies. PLoS Genet. 3, e78 10.1371/journal.pgen.0030078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Roehl H., Nüsslein-Volhard C. (2001). Zebrafish pea3 and erm are general targets of FGF8 signaling. Curr. Biol. 11, 503-507 10.1016/S0960-9822(01)00143-9 [DOI] [PubMed] [Google Scholar]
  42. Stoick-Cooper C. L., Weidinger G., Riehle K. J., Hubbert C., Major M. B., Fausto N., Moon R. T. (2007). Distinct Wnt signaling pathways have opposing roles in appendage regeneration. Development 134, 479-489 10.1242/dev.001123 [DOI] [PubMed] [Google Scholar]
  43. Ungos J. M., Karlstrom R. O., Raible D. W. (2003). Hedgehog signaling is directly required for the development of zebrafish dorsal root ganglia neurons. Development 130, 5351-5362 10.1242/dev.00722 [DOI] [PubMed] [Google Scholar]
  44. Valdivia L. E., Young R. M., Hawkins T. A., Stickney H. L., Cavodeassi F., Schwarz Q., Pullin L. M., Villegas R., Moro E., Argenton F., et al. (2011). Lef1-dependent Wnt/beta-catenin signalling drives the proliferative engine that maintains tissue homeostasis during lateral line development. Development 138, 3931-3941 10.1242/dev.062695 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wada H., Ghysen A., Asakawa K., Abe G., Ishitani T., Kawakami K. (2013). Wnt/Dkk negative feedback regulates sensory organ size in zebrafish. Curr. Biol. 23, 1559-1565 10.1016/j.cub.2013.06.035 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material

Articles from Development (Cambridge, England) are provided here courtesy of Company of Biologists

RESOURCES