Abstract
Rapid, cell surface-initiated, pregenomic androgen actions have been described in various vertebrate cells, but the receptors mediating these actions remain unidentified. We report here the cloning and expression of a cDNA from Atlantic croaker (Micropogonias undulatus) ovaries encoding a 33-kDa, seven-transmembrane protein with binding and signaling characteristics of a membrane androgen receptor that is unrelated to any previously described steroid receptor. Instead, croaker membrane androgen receptor has 81–93% amino acid sequence identity with zinc transporter ZIP9 (SLC39A9) subfamily members, indicating it is a ZIP9 protein. Croaker ZIP9 is expressed in gonadal tissues and in brain and is up-regulated in the ovary by reproductive hormones. Croaker ZIP9 protein is localized to plasma membranes of croaker granulosa cells and human breast cancer (SKBR-3) cells stably transfected with ZIP9. Recombinant croaker ZIP9 has a high affinity (dissociation constant, Kd, 12.7 nM), limited capacity (maximal binding capacity 2.8 nM/mg protein), displaceable, single binding site-specific for androgens, characteristic of steroid receptors. Testosterone activates a stimulatory G protein coupled to ZIP9, resulting in increased cAMP production. Testosterone promotes serum starvation-induced cell death and apoptosis in transfected cells and in croaker ovarian follicle cells that is associated with rapid increases in intracellular free zinc concentrations, suggesting an involvement of zinc in this nonclassical androgen action to promote apoptosis. These responses to testosterone are abrogated by treatment with ZIP9 small interfering RNA. The results provide the first evidence that zinc transporter proteins can function as specific steroid membrane receptors and indicate a previously unrecognized signaling pathway mediated by steroid receptors involving alterations in intracellular zinc.
Many cellular responses to steroid hormones are too rapid to be induced through the classic mechanism of steroid action mediated by nuclear receptors involving alterations in gene transcription and translation that typically occur over a time scale of hours. Steroids have also been shown to bind to specific receptors on the plasma membranes of many cell types, resulting in rapid activation of intracellular signaling pathways within a few minutes and cellular responses that are frequently nongenomic (1–3). Evidence has been obtained for the involvement of both nuclear receptors and novel seven-transmembrane (7-TM) receptors in mediating rapid, nongenomic actions of estrogens and progestins in a wide range of cell types (4–7). In contrast, rapid nongenomic actions of androgens and their membrane receptors have received less attention (3, 8). Nonetheless, androgens have been demonstrated to exert nonclassical steroid actions in a variety of tissues and cells (3, 8, 9) including rapid actions in the brain to influence GnRH secretion, neuroprotection, and behavior (9), in reproductive tissues including Sertoli, prostate, and granulosa cells (10–13), in skeletal muscle (14), osteoblasts (15), T cells and macrophages (16, 17), and in the cardiovascular system (8). However, information is currently lacking on the identities of the receptor proteins mediating these rapid androgen effects (3, 8–13).
Androgen binding moieties with some biochemical features of membrane androgen receptors (mARs) have been identified on the plasma membranes of several vertebrate cells and tissues including endothelial cells (18), osteoblasts (19), T cells (20), human prostate and colon cancer cells (12, 21), in synaptosomes prepared from rat brains (22), in rat liver and prostate tissues (23), and in Atlantic croaker ovaries (24). Moreover, androgens have been shown to activate intracellular signaling pathways resulting in up-regulation of intracellular free calcium, diacylglycerol, and inositol-3-phosphate levels, and activation of MAPK by cell surface-mediated mechanisms (11, 13, 16, 17, 25) that often involve G protein activation, suggesting the involvement of G protein-linked receptors (15, 18, 25, 20, 26). Androgen activation of intracellular signaling pathways has also been demonstrated in cell types lacking the nuclear androgen receptor (nAR) (12, 27), implying the existence of novel, undescribed androgen receptors. Although these studies have provided indirect evidence for the existence of specific receptors unrelated to the nAR controlling membrane-induced androgen signaling, to date efforts to identify these receptors have been unsuccessful.
Rapid, nongenomic androgen actions have also been reported in vertebrate ovaries, including ovarian follicle cells of Atlantic croaker (10, 13). Previous studies showed that the biochemical ligand binding characteristics of the androgen membrane receptor in croaker ovaries differ markedly from those of nAR in this tissue, showing no binding for R1881 and mibolerone, whereas they display high relative binding affinities for croaker nAR (24, 28). These findings suggest the presence of a novel receptor protein unrelated to nARs in croaker ovaries. Therefore, we used a strategy similar to that used previously for the purification and cloning membrane progestin receptor (mPR) from a spotted seatrout ovarian cDNA library (5) to identify the mAR cDNA in croaker ovaries. Antiserum generated against a [3H]testosterone-binding membrane fraction partially purified on a diethylaminoethyl (DEAE) cellulose column was used to screen a croaker ovarian cDNA expression library. We describe in this paper a novel cDNA identified by this method and the mAR characteristics and functions of the protein it encodes. In addition, the role of the receptor in mediating cell death of croaker ovarian follicle cells was investigated because previous studies have shown that androgens modulate apoptosis and the cell cycle in the ovary and other reproductive tissues (12, 21, 29, 30). Involvement of the novel mAR in testosterone regulation of intracellular zinc concentrations was also examined because sequence and phylogenetic analyses indicated that it is a member of the ZIP9 (Zrt-, Irt-like protein family solute carrier family 39 member 9, SLC39A9) zinc transporter subfamily.
Materials and Methods
Cloning and expression of croaker membrane androgen receptor
Total RNA was extracted from croaker ovaries, cDNA was synthesized, ligated into EcoR1 sites of ZAP II vectors, and a cDNA library constructed as described previously (7). Phages (∼250 000) were screened using a picoBlue immunoscreening kit (Stratagene) with a mouse antibody generated to a partially purified testosterone binding ovarian membrane fraction (Supplemental Figure 1). Positive clones were subjected to two additional rounds of screening before excision and purification of the plasmid vector. Three identical positive cDNA clones were identified by sequencing. The sequence was analyzed with Vector NTI Advance 10 software (Invitrogen), and software on ExPASY proteomics server (www.expasy.ch) was used for topology predictions (TargetP, HMMTOP, TopPred, TMHMM, Tmpred, and SOSUI) and for posttranslational modification predictions (NetPhos, NetPhosK, OGPET, and YinOYang). Phylogenetic analysis was performed by neighbor-joining analysis and an unrooted bootstrap consensus tree was generated using ClustalW (http://www.ebi.ac.uk/tools/msa/clustalw2/). The coding region was amplified by PCR, inserted into a PBK-CMV expression vector (Stratagene), and transfected into SKBR-3 breast cancer cells using Lipofectamine 2000 (Invitrogen) following the manufacturer's suggestions. Stably transfected geneticin-resistant cells containing the putative membrane androgen receptor construct were selected and maintained with geneticin (G148, 500 μg/mL).
Preparation of plasma membranes and other subcellular fractions
Tissue and cell homogenates were prepared with a glass homogenizer and subcellular fractions were obtained by centrifugation following published procedures (24). Supernatants from an initial centrifugation (1000 × g for 7 minutes) of homogenates were centrifuged at 20 000 × g for 20 minutes at 4°C to pellet plasma membranes.
Cell culture
Croaker ZIP9-transfected (Tr) SKBR-3 cells were cultured in DMEM (Zn 1.5 μM; Sigma-Aldrich) supplemented with 10% fetal bovine serum and 100 μg/mL gentamicin. Croaker granulosa and theca (G/T) cells were isolated and cocultured for 2 days in DMEM supplemented with 2% fetal bovine serum prior to experimentation as described previously by which time they have negligible aromatase activity (31). For knock-down of ZIP9 mRNA expression, ZIP9 G/T cells were plated in DMEM without antibiotics prior to transfection of a mixture of ZIP9 small interfering RNA (siRNA) primers (AUGGGAGUUACCAAUCUGG, CCAGAUUGGUAACUCCCAU, GCUUAGAGCGGAAUCGAAU, and AUUCGAUUCCGCUCUAAGC) or nonsense primers (negative control) with Lipofectamine 2000 (Invitrogen). G/T cells were transiently transfected twice at 0 hours and 16 hours with 100 nM croaker nAR siRNA (primers AAGCCCAUCGUAGGCCCCA and UGGGGCCUCUACGAUGGGCUU) (Dharmacon) or nontarget siRNA using Lipofectamine and used in experiments 2 days later.
Androgen receptor binding assay
Specific binding of [2,4,6,7-3H]T ([3H]T; Amersham) to plasma membranes after a 30-minute incubation at 4°C was measured by filtration radioreceptor assay as described previously (24), and saturation analysis, affinity, and receptor number were determined from nonlinear regression of binding using GraphPad Prism software (http://www.graphpad.com). Competitive binding of steroids was determined over a range of concentrations (0.1 nM to 10 μM) to membranes in the presence of 10 nM [3H]T and expressed as a percentage of maximum testosterone binding (24).
For antibody pull-down of specific [3H]T binding in a receptor capture assay, a 96-well microtiter plate was coated with the antibody to the partially purified testosterone binding moiety diluted in 0.1 M Na2CO3 (pH 9.6), followed by incubation with blocking solution (5% dry milk) to saturate nonspecific binding sites. Membrane extracts from croaker ZIP9-transfected SKBR-3 cells and from nontransfected cells were added to antibody-coated wells, and excess membrane proteins not bound to the antibody were removed by washing. Bound proteins were incubated with [3H]T with (nonspecific binding, NSB) or without (total binding, TB) 1000-fold excess of cold testosterone, the aqueous mixture was removed, wells were washed, and the [3H]T binding in each well was measured by liquid scintillation counting.
Western blot and ligand blot analyses
Membrane proteins were resolved on 10% SDS PAGE gels, transferred to polyvinyl difluoride membranes, blocked with 5% nonfat dry milk, and incubated with croaker putative mAR polyclonal mouse antibody (1:5000) overnight prior to a 30-minute incubation with secondary antibody (1:5000 horseradish peroxidase conjugated to goat antimouse) and detection with SuperSignal (Pierce). For ligand blot analysis, proteins were resolved as described above, transferred to nitrocellulose membranes, and incubated with 30 nM [3H]T in Tris-buffered saline and 0.1% Tween 20 buffer for 30 minutes, washed, and [3H]T binding measured using a thin-layer plate radioisotope analyzer (Raytest) as described previously (32) followed by Western blot analysis.
Immunocytochemistry
Immunocytochemistry was performed on G/T cells grown on coverslips, fixed in 1% paraformaldehyde for 15 minutes, incubated in 0.1% NaBH4 for 10 minutes, followed by incubation for 1 hour in blocking solution (3% BSA in PBS), and then incubated with the croaker putative mAR antibody (1:5000) for 1 hour. Cells were then incubated for 30 minutes with a secondary antibody (1:5000), goat antimouse Alexa Fluor 488 (Molecular Probes), and incubated for 5 minutes in 150 mM 4′,6-diamidino-2-phenylindole (DAPI), mounted using ProLong Gold antifade reagent (Molecular Probes), and visualized using a fluorescent microscope.
RT-PCR and quantitative PCR (q-PCR)
Total RNA was extracted using Tri Reagent (Sigma-Aldrich) and treated with deoxyribonuclease (Zymo Research), and cDNAs were synthesized using SuperScript II reverse transcriptase (Invitrogen). PCR was performed using Platinum PCR SuperMix High Fidelity (Invitrogen) with specific ZIP9 primers: forward, 5′-TGGTGGGATGTTATGTGGCA-3′ and reverse, 5′-GTGGTGACCGACGGACAG-3′. Amplification was conducted for 35 cycles at 94°C for 30 seconds, 55°C for 1 minute, and 72°C for 1 minute prior to visualization with SYBR green after resolution on a 1% agarose gel. nAR PCRs were run by using specific primers (forward, 5′-TTCAACAAAGACCAGCAG-3′ and reverse, 5′-ATTCCCGACATGAAGCA-3′) under the same conditions as described above.
For q-PCR the reaction mixture consisted of 12.5 μL q-PCR master mix (Promega), 0.2 μM gene-specific primers (forward primer, 5′-CTGGCTGTCATCATCCCTGA-3′ and reverse primer, 5′-ATGAAGACGAAGCCCAGCAC-3′) and 1 ng of cDNA obtained as described above. 18S rRNA was amplified for each PCR reaction product with primers as an internal standard (33). The temperature cycle consisted of 94°C for 5 minutes, 40 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 60 seconds followed by 72°C for 10 minutes.
Hormonal regulation
Ovarian fragments (∼1 g) were incubated with 10 IU human chorionic gonadotropin (hCG) in 50 mL DMEM for 4 hours or 14 hours at 23°C prior to assessment of ZIP9 expression and [3H]T binding. All procedures with Atlantic croaker were approved by the Institutional Animal Care and Use Committee of the University of Texas at Austin.
G protein activation and coimmunoprecipitation with ZIP9
G protein activation was assessed by measuring [35S]GTPγS (Amersham) binding to ovarian plasma membranes after incubation with either 100 nM testosterone or vehicle (0.1% ethanol) for 20 minutes at 23°C, using excess GTP to stop the reaction, as described previously (6). Membrane-bound [35S]GTPγS was immunoprecipitated with an inhibitory G protein (Gαi1–2) and Gαs antibodies or rabbit IgG (1:100; Santa Cruz Biotechnology) using protein A/G Plus-agarose beads (6). Coimmunoprecipitation was conducted with testosterone-treated (100 nM for 10 min) plasma membranes incubated overnight with the croaker putative mAR antibody or control mouse IgG (1:100; Santa Cruz Biotechnology) and subsequent Western blot analysis of the immunoprecipitated proteins using a Gαs antibody (1:2000) as described above.
cAMP measurement
SKBR-3 Tr and nontransfected (NT) cells were incubated with different concentrations of testosterone in serum-free medium for 10 minutes, and the cAMP concentration in the cells was measured with an enzyme immunoassay kit (Biomedical Technologies) following the manufacturer's instructions.
Cell viability and apoptosis
SKBR-3 Tr and NT cells and G/T cells were incubated in serum-free media containing steroids for 48 hours, and adherent cells were harvested by enzymatic treatment (trypsin) and centrifugation. Trypan blue (final concentration 0.06%) staining of cells after 5 minutes of incubation at 23°C was counted (1000 cells/treatment) on a hemocytometer and expressed as percentage dead cells. Apoptotic cells were detected using an ApoAlert DNA fragmentation assay kit (Clontech) according to the manufacturer's instructions.
Intracellular zinc assay and treatment with a zinc chelator
Changes in intracellular zinc levels in response to testosterone treatment (20 min) were determined using the fluorophore Zinquin ethyl ester (5 μmol/L for 20 min) and examined under a fluorescence microscope (λexc −365 nm, λem −420 nm) (34). Digital images were captured with a camera and Cool-Snap software (Photometrics) was used to measure signal intensity. Effects of the membrane-permeable zinc chelator, N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN; Cayman Biochemical), on testosterone induction of apoptosis were examined by preincubating transfected cells with 1 μM TPEN for 24 hours prior to testosterone treatment.
Statistical analysis
All data are reported as mean values ± SEM of at least three measurements in a single experiment. All experiments were repeated at least three times, and similar results were obtained on each occasion. Data were analyzed using GraphPad Prism software by one-way ANOVA with the Dunnett's multiple comparison test, and significance is reported as P < .05 (*).
Results
Cloning, sequence, and phylogenetic analyses of the putative mAR
The antibody generated against a partially purified croaker ovarian membrane fraction with androgen binding activity (putative mAR antibody; Supplemental Figure 1) was used to screen a croaker ovarian cDNA library. Positive cDNA clones displayed an open reading frame of 933 bp encoding a previously uncharacterized protein of 310 amino acids (GenBank accession number KF516233) with a predicted molecular mass of approximately 33 kDa. Multiple structural analyses of the deduced amino acid sequence using TargetP, HMMTOP, TopPred, TMHMM, Tmpred, and SOSUI computer programs predict the protein has 7-TM domains, which is characteristic of many hormone membrane receptors (Figure 1A and Supplemental Table 1). A BLAST search of vertebrate genome databases revealed that the croaker cDNA and deduced protein have high sequence identities, 71%–86% and 81%-93%, respectively, with zinc transporters belonging to the ZIP9 subfamily (SLC39A9/subfamily I; Table 1), identifying it as a ZIP9.
Figure 1.

Structural analysis of the deduced amino acid sequence of the putative membrane androgen receptor gene. A, Hydrophobicity profile showing transmembrane domains (numbered). B, Schematic diagram of encoded protein showing intracellular (white), extracellular (gray), and transmembrane domains (black). Numbers below indicate numbers of amino acids in each domain. Potential phosphorylation (▾) and glycosylation (▿) sites and their amino acid positions from the N-terminal end are shown above. C, Phylogenetic tree showing relationship of the croaker ZIP9 to teleost fish and human ZIP9 proteins. The deduced amino acid sequences of croaker and spotted sea trout ZIP9 proteins were aligned with stickleback (Gasterosteus aculeatus), medaka (Oryzias latipes), platyfish (Xiphophorus maculatus), tilapia (Oreochromis niloticus), fugu (Takifugu rubripes), pufferfish (Tetraodon nigroviridis), cod (Gadus morhua), zebrafish (Danio rerio), and human (Homo sapiens). The lengths of the bars represent the relative distances between ZIP9s of different species.
Table 1.
Percentage Amino Acid and Nucleotide Sequence Identities of ZIP9s From Different Species
| Atlantic* Croaker | Spotted* Seatrout | Platyfish | Medaka | Stickleback | Tilapia | Pufferfish | Fugu | Cod | Zebrafish* | Human* | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Nucleotide sequence comparison | |||||||||||
| Atlantic croaker | — | 94 | 86 | 85 | 89 | 85 | 86 | 85 | 83 | 78 | 73 |
| Spotted seatrout | 97 | — | 85 | 85 | 84 | 83 | 84 | 84 | 82 | 77 | 73 |
| Platyfish | 93 | 94 | — | 85 | 85 | 82 | 83 | 82 | 79 | 76 | 73 |
| Medaka | 93 | 94 | 94 | — | 85 | 81 | 81 | 82 | 81 | 74 | 71 |
| Stickleback | 93 | 94 | 92 | 93 | — | 85 | 86 | 85 | 82 | 76 | 72 |
| Tilapia | 93 | 94 | 94 | 92 | 92 | — | 83 | 82 | 78 | 78 | 73 |
| Pufferfish | 92 | 93 | 91 | 92 | 92 | 91 | — | 90 | 81 | 79 | 69 |
| Fugu | 92 | 93 | 91 | 91 | 92 | 91 | 96 | — | 80 | 76 | 71 |
| Cod | 89 | 90 | 87 | 88 | 90 | 89 | 88 | 88 | — | 74 | 71 |
| Zebrafish | 83 | 84 | 84 | 84 | 83 | 84 | 88 | 84 | 85 | — | 73 |
| Human | 81 | 82 | 81 | 81 | 82 | 81 | 81 | 81 | 83 | 82 | — |
| Deduced amino acid sequence comparison | |||||||||||
GenBank (*) and Ensembl accession numbers are as follows: Atlantic croaker (Micropogonias undulatus), KF516233*; spotted seatrout (Cynoscion nebulosus), KF516234*; platyfish (Xiphophorus maculatus), ENSXMAT00000009146 ; medaka (Oryzias latipes), ENSORLT00000012502 ; stickleback (Gasterosteus aculeatus), ENSGACT00000016433 ; tilapia (Oreochromis niloticus), ENSONIT00000024742 ; pufferfish (Tetraodon nigroviridis), ENSTNIT00000007485 ; fugu (Takifugu rubripes), ENSTRUT00000005854 ; cod (Gadus morhua), ENSGMOT00000015478 ; zebrafish (Danio rerio), NM_001013540*; human (Homo sapiens), FJ423549*.
Alignment of deduced amino acid sequences of croaker, Fugu, and human ZIP9s shows high sequence identity (∼85%) in most regions of the protein and a single highly variable region (amino acids 76–96) (Supplemental Figure 2). Modeling predicts that the C-terminal of the croaker protein is intracellular, whereas those of zebrafish and human ZIP9s are extracellular (Figure 1, A and B, and Supplemental Table 1). Moreover, whereas the croaker protein is predicted to have 7-TM domains, most vertebrate ZIP9 proteins are predicted to have eight-transmembrane (8-TM) domains (Supplemental Table 1). Multiple N-linked glycosylation sites and phosphorylation sites are predicted by NETPHOS and Proscan analyses (35) (Figure 1B). The croaker protein has multiple histidine repeat regions located in the intracellular and TM domains and also displays charged amino acids in the transmembrane domain, both of which are characteristic of ZIP proteins (36, 37). Phylogenetic analysis shows the croaker mAR gene and a cDNA cloned from a species in the same teleost family, spotted seatrout (GenBank accession number KF516234), are members of SLC39A (ZIP9) subfamily I and most closely related to ZIP9 of another teleost species, stickleback (Figure 1C).
Tissue and cellular distribution of ZIP9 and its hormonal regulation
ZIP9 mRNA and protein were detected in the brain, liver, ovary, and testis of the predicted sizes, but not in gills, by RT-PCR and Western blot analyses (Figure 2, A and B). A single immunoreactive protein band with a molecular mass of approximately 40 kDa was detected on Western blots of plasma membranes but not in other subcellular fractions prepared from croaker ovaries (Figure 2C). The immunoreaction was blocked by preincubating the antibody with the partially purified androgen receptor antigen (fraction 2, Figure 2C, right lane). Extensive characterization of the antibody confirmed it is specific for croaker ZIP9 protein and the partially purified androgen receptor antigen (fraction 2), which does not contain the nAR (Supplemental Figure 3). Treatment of ovarian tissues in vitro with hCG for 4 hours caused concomitant increases in ZIP9 mRNA and protein concentrations and specific [3H]T binding, whereas after 14 hours of hCG treatment, both ZIP9 mRNA expression and [3H]T binding had returned to control levels (Figure 2D). ZIP9 expression and specific [3H]T binding were also up-regulated after 4 hours of treatment with estradiol-17β (E2) or testosterone (Supplemental Figure 4). Immunocytochemical (ICC) staining of isolated theca and granulosa cells shows that ZIP9 is detected only in the more rounded granulosa cells (∼30% of the cocultured cells; Figure 2H) on the plasma membrane and also intracellularly in a perinuclear location (Figure 2, E–G).
Figure 2.
Tissue distribution, cellular localization, and hormonal regulation of croaker ZIP9. A, Tissue distribution of ZIP9 mRNA. +, Reverse transcription plus; −, reverse transcription minus; B, brain; G, gill; L, liver; M, molecular weight maker; O, ovary; T, testis; W, H2O control. B, Western blot analysis of ZIP9 protein expression in plasma membrane preparations using the mouse polyclonal antibody directed against croaker putative mAR protein fraction (Supplemental Figure 1). C, Localization of ZIP9 protein in subcellular fractions. Actin, Loading control; B, antibody reaction blocked by preincubating plasma membrane with partially purified croaker putative mAR protein; C, cytosol; Nuc, nucleus; PM, plasma membrane. D, Effects of gonadotropin (15 IU/mL hCG) treatments for 4 hours and 14 hours on ovarian ZIP9 mRNA (dark gray bars) measured by q-PCR and membrane protein concentrations (top panel, equal protein loading/lane)) and specific [3H]T binding (light gray bars). Each bar represents the mean ± SEM of triplicate determinations. *, P < .01 compared with respective controls (Con). E, ICC staining of intact granulosa (Gr) and theca (Th) cells for cadherin (green), ZIP9 (red), both (orange), and DAPI (blue). F, Confocal image of a granulosa cell after ICC staining for ZIP9 (green) and DAPI. G, ICC staining of a granulosa and theca cell for ZIP9 (green) and DAPI. H, Phase contrast image showing 3β-hydroxysteroid dehydrogenase staining in cocultured granulosa and theca cells. Scale bar, 1 μm. All the experiments and analyses were repeated three times and similar results were obtained each time.
Steroid binding characteristics of recombinant croaker ZIP9
Plasma membranes of SKBR-3 cells stably transfected with croaker ZIP9 (Tr) displayed higher specific [3H]T binding than that to membranes from NT cells (Figure 3A), which was similar to that to glass fiber filters (results not shown). High ZIP9 expression in Tr cells was confirmed by RT-PCR and Western blot analyses, with a PCR product of the correct size and an immunoreactive band at approximately 40 kDa (Figure 3B), which likely represents the glycosylated protein (38, 48). Immunocytochemical analysis shows the ZIP9 protein is localized at the periphery of Tr cells, whereas no staining was detected in NT cells (Figure 3C). A ligand blot assay using Tr cell membranes showed the presence of a single peak of [3H]T binding at approximately 40 kDa (Figure 3D, bottom panel, and E), which corresponds to the position of ZIP9 on a Western blot (Figure 3D, top panel), whereas negligible [3H]T binding was detected at this position in NT preparations (Figure 3E). A receptor capture assay using the croaker putative mAR antibody detected high levels of specific [3H]T binding to membranes from Tr cells (Figure 3F). Saturation and Scatchard analyses indicated the presence of a single, high affinity (dissociation constant [Kd] −12.7 ± 3.2 nM), low-capacity (maximal binding capacity −2.8 ± 0.5 nM/mg protein) [3H]T binding site on Tr cell plasma membranes (Figure 3G). Association and dissociation kinetics of [3H]T membrane binding were rapid, with half-time (t1/2) values of 1–2 minutes (Figure 3H).
Figure 3.
Androgen binding characteristics of plasma membranes of SKBR-3 cells stably transfected with croaker ZIP9. A, Single-point assay of specific [3H]T binding to plasma membranes of cells transfected with ZIP9 (Tr) and nontransfected (NT) cells. B, Detection of ZIP9 mRNA in Tr cells by RT-PCR and ZIP9 protein in Tr cell membranes by Western blot analysis. Actin, loading control. C, ICC of croaker ZIP9 in Tr and NT SKBR-3 cells. The fluorescent images are overlaid phase contrast images to show the outlines of the cells. D, Representative ligand blot analysis of [3H]T binding to Tr cell membranes after electrophoresis and transfer to a nitrocellulose membrane expressed as a percentage of the total [3H]T on the membrane (below) and Western blot analysis of croaker ZIP9 on the same membrane (above). E, Comparison of [3H]T binding by membranes from Tr and NT cells at the position of ZIP9 on the ligand blot. F, Pull-down of specific [3H]-T binding to solubilized plasma membranes from Tr and NT cells with the ZIP9 antibody in a representative receptor capture assay. G, Representative saturation curve and Scatchard plot of specific [3H]T binding to the cell membranes of Tr cells. H, Time course of association (dotted line) and dissociation (solid line) of [3H]T binding to plasma membranes of Tr cells. I and J, Competition curves of steroid binding to Tr membranes expressed as a percentage of maximum [3H]T binding. ●, T; □, progesterone; ▴, dihydrotestosterone; ×, mibolerone; ★, R1881; ○, 17,20β,21-trihydroxy-4-pregnen-3-one; ♢, cortisol; ▾, E2. Each bar represents the mean ± SEM of triplicate determinations. *, P < .01 compared with respective controls. All the experiments were repeated at least three times and similar results were obtained each time.
Steroid binding to recombinant ZIP9 was highly specific for testosterone. Progesterone and 5α-dihydrotestosterone had relative binding affinities (RBAs) less than 10% and 1% that of testosterone, respectively (Figure 3I), whereas mibolerone and R1881 had lower RBAs (Figure 3J), and E2, cortisol, and the teleost progestin, 17,20β,21-trihydroxy-4-pregnen-3-one, displayed no affinity for the receptor (Figure 3, I and J). Androstenedione, 11-ketotestosterone, and the antiandrogen flutamide displayed low RBAs (<1%) for the receptor (Supplemental Table 2).
Interactions between ZIP9 and G proteins
Testosterone treatment significantly increased [35S]GTPγS binding to Tr cell membranes compared with NT controls, indicating croaker ZIP9 activates G proteins (Figure 4A). Pretreatment of cells with excess GTPγS decreased specific [3H]T binding to Tr cell membranes (Figure 4B), consistent with membrane receptors reverting to a low-affinity ligand binding state when they are not coupled to G proteins and a reduction in the number of binding sites after treatment with GTPγS (6, 39). Immunoprecipitation of solubilized membranes from Tr cells with the croaker putative mAR antibody and subsequent Western blotting with Gαs antibody showed a molecular mass band of the expected size for Gαs (∼55 kDa), similar to the moiety immunoprecipitated and detected with Gαs antibody, thereby indicating a close association between croaker ZIP9 and Gs (Figure 4C). Membrane-bound [35S]GTPγS from Tr cells pretreated with testosterone was immunoprecipitated with a Gαs antibody, but not with a Gαi1–2 antibody or rabbit IgG, demonstrating that ZIP9 activates a stimulatory G protein (Figure 4D). Testosterone treatment (50 nM) for 10 minutes caused a significant increase in intracellular cAMP concentrations in Tr, but not in NT cells, further suggesting the ZIP9 activates a stimulatory G protein (Figure 4E).
Figure 4.
Interactions between croaker ZIP9 and G proteins. A, Effects of 30 minutes of treatment with T (100 nM) on specific [35S]GTPγS binding to membranes of Tr and NT cells (n = 3). B, Effects of preincubation of Tr cell membranes with 15 μM GTPγS on specific [3H]T binding. C, Control. C, Coimmunoprecipitation of G proteins with croaker ZIP9 antibody followed by detection with Gαs antibody by Western blot analysis. Gs, Pull-down with Gs antibody; IgG, mouse IgG controls; ZIP9, pull-down with ZIP9 antibody. D, Immunoprecipitation of [35S]GTPγS bound to G proteins on Tr membranes after treatment with 100 nM T (dark gray bars) or vehicle (white bars) with specific Gαs and Gαi1–2 antibodies or rabbit IgG control (IgG) (n = 4). E, Effects of T treatments on cAMP production by Tr cells (dark gray) and NT cells (white) (n = 4). *, P < .05 compared with respective controls. All the experiments were repeated three times and similar results were obtained each time.
Testosterone regulation of cell death, apoptosis, and intracellular free zinc in ZIP9-transfected cells
Treatment for 72 hours with testosterone, but not with the nAR agonists, dihydrotestosterone, mibolerone, and R1881, or with E2 or cortisol caused a concentration-dependent increase in starvation-induced cell death in ZIP9-transfected cells but not in NT cells (Figure 5A). Testosterone treatment also significantly increased apoptosis of Tr cells, but mibolerone and R1881 were ineffective (Figure 5B). Long-term testosterone treatment also promoted serum starvation-induced death of cocultured G/T cells, whereas dihydrotestosterone, mibolerone, and R1881 were ineffective (Figure 5C). Interestingly, testosterone also caused an acute concentration-dependent increase in intracellular concentrations of free zinc in Tr cells (Figure 5D) but not in NT cells (Figure 5D, top panel). Chelation of intracellular zinc in Tr cells by treatment with TPEN blocked testosterone induction of apoptosis, suggesting this testosterone action is mediated through increasing cytosolic zinc concentrations (Figure 5E).
Figure 5.
Effects of steroid treatments on starvation-induced cell death, apoptosis, and intracellular zinc levels in ZIP9 Tr and G/T cells. A, Percentage cell death of ZIP9 Tr (light gray) and NT cells (white) after 72 hours treatment with 20–100 nM T and 100 nM of other steroids and nAR agonists. B, Percentage apoptotic cells of ZIP9 Tr cells after 72 hours of treatment with 100 nM T, mibolerone, and R1881. C, Effects of 72 hours of treatments with steroids and nAR agonists on starvation-induced death of cocultured G/T cells. D, Bottom panel, Effects of 20–100 nM T treatments on the relative levels of intracellular free zinc in ZIP9 Tr cells. Top panel, Representative images of zinc fluorescence in Tr cells after these treatments. E, Effects of the zinc chelator, TPEN, on 100 nM T-induced apoptosis of Tr cells. C, vehicle control; DHT, dihydrotestosterone; F, cortisol; M, mibolerone. *, P < .05 compared with respective controls (n = 3). All the experiments were repeated three times and similar results were obtained each time.
Role of croaker ZIP9 in membrane [3H]T binding and testosterone up-regulation of free zinc levels and apoptosis in cocultured G/T cells
Transfection of G/T cells with ZIP9 siRNA decreased ZIP9 mRNA and protein expression Figure 6A, bottom panel), which was accompanied with a significant decrease in specific [3H]T membrane binding compared with scrambled siRNA and untreated G/T cell controls (Figure 6A, top panel). Testosterone treatment also caused an increase in intracellular free zinc concentrations and apoptosis in cultured G/T cells, and these effects were abrogated by pretreatment with ZIP9 siRNA (Figure 6, B and C). In contrast, treatment with croaker nAR siRNA did not alter specific [3H]T membrane binding (Figure 6D) or testosterone-induced cell death (Figure 6E), although it decreased nAR mRNA expression. These results clearly show that ZIP9 mediates specific [3H]T binding to G/T plasma membranes and testosterone effects on intracellular zinc concentrations and apoptosis.
Figure 6.
Effects of transfection with croaker ZIP9 siRNA or nAR siRNA (siRNA) and scrambled siRNA controls (SC) or no treatment (G/T) on receptor expression and function in cocultured G/T cells. A, Effects of transfection with ZIP9 siRNA or SC on specific [3H]T binding to cell membranes (top panel) and ZIP9 mRNA and protein expression (bottom panel). SM, size marker. B, Bottom panel, Effects of transfection with ZIP9 siRNA or SC on free zinc response to 100 nM T (T) or vehicle control (C). Top panel, Representative images of zinc fluorescence after these treatments. C, Effects of transfection with ZIP9 siRNA or SC on apoptotic response to 100 nM T or vehicle control (C). D and E, Effects of transfection with nAR siRNA or SC on specific [3H]T binding to cell membranes (D, top panel), nAR mRNA expression (D, bottom panel), and percentage cell death (E). *, P < .05 compared with respective controls (n = 3). All the experiments were repeated three times and similar results were obtained each time.
Discussion
In this study, we describe the first identification of an androgen receptor in vertebrates structurally unrelated to nuclear steroid receptors. Interestingly, the croaker mAR is also unrelated to the previously described 7-TM progestin and estrogen receptors, mPRs and G protein-coupled receptor 30 (4, 5), and instead is a member of the ZIP9 subfamily. The novel croaker cDNA encodes a 7-TM protein with a predicted molecular mass of approximately 33 kDa present in gonadal and brain tissues with all the characteristics of a mAR. Recombinant ZIP9 membrane protein has a high-affinity, limited capacity, single androgen-binding site highly specific for testosterone. Moreover, alterations of ZIP9 levels in croaker ovarian follicle cell plasma membranes after hormonal and siRNA treatments are accompanied by parallel changes in receptor binding. In addition, we show the receptor protein mediates rapid testosterone activation of intracellular signal transduction pathways through a stimulatory G protein. Importantly, several lines of evidence suggest the putative receptor is an intermediary in testosterone stimulation of serum starvation-induced cell death and apoptosis, which is accompanied by increased intracellular free zinc levels. The discovery of a second type of androgen receptor distinct from the nAR that is localized on the plasma membrane may provide a mechanistic explanation for the pleiotropic actions of androgens in reproductive tissues.
An unexpected finding was that the nucleotide and amino acid sequences of the novel croaker mAR are similar to those of ZIP (zinc-regulated transporter [Zrt]- and Irt-like proteins or SLC39A proteins) zinc transporters identified in other vertebrate species that transport zinc into the cytoplasm across cell membranes from the extracellular fluid or from intracellular organelles (36). The mammalian ZIP family comprises 14 members (ZIP1–14) grouped into four subfamilies (36, 40). The novel croaker mAR has the highest sequence identity (81%–94%) with ZIP9, the only member of the ZIP I subfamily, indicating it is a ZIP9. However, hydrophobicity and transmembrane topology predicts croaker ZIP9 and ZIP9 in the closely related spotted seatrout (Cynoscion nebulosus) have 7-TM domains with intracellular C terminals, whereas most ZIPs are predicted to have 8-TM domains (36, 40, 41), including ZIP9s, with an extracellular C terminal (Supplemental Table 1). The substitution of isoleucine at amino acid position 38 from the N-terminal end of croaker and seatrout ZIP9s with valine (Supplemental Figure 2), which is at this position near the beginning of the second transmembrane domain of zebrafish and human ZIP9s, results in predictions of 8-TM domains for the croaker and seatrout ZIP9s in structural analyses (results not shown). However, other amino acid differences likely contribute to these different structure predictions because ZIP9 proteins of other teleost species with isoleucine at this position (tilapia and platyfish) are predicted to have 8-TM domains in most structural analyses (Supplemental Table 1).
ZIP9 proteins are not closely related to any other ZIPs and do not contain any of the putative metalloprotease-like motifs present in the nine ZIPs belonging to the LIV-1 (LZT, LIV-1 subfamily of zinc transporters) subfamily (36, 40). Although ZIP9 proteins are shorter (307–312 amino acids) than other ZIP proteins they share the histidine-rich clusters in the intracellular loop between transmembrane domains III and IV. They also have the charged/polar amino acids in the transmembrane domains present in other ZIP proteins that are thought to be important for forming the transportation channel for zinc and other ions (36, 40). The three histidine clusters in this region of mammalian ZIP9s are also present in teleost ZIP9s, including croaker, although the largest cluster in fish ZIP9s contains only four of the six histidines present in mammals, the functional significance of which is unknown (38). Currently little is known about the functions of ZIP9 proteins (42).
In agreement with the present results, recombinant human ZIP9 expressed in chicken ZIP9-knockout DT40 cells has been shown to regulate intracellular free zinc concentrations (43). However, in contrast to the findings with wild-type and recombinant croaker ZIP9s, which are primarily expressed on the plasma membrane, recombinant human ZIP9 expressed in HeLA cells and chicken DT40 cells was not detected on the cell membrane and instead was localized to the trans-Golgi apparatus (42, 43). Moreover, alterations in ZIP9 expression did not alter zinc homeostasis, which suggests human ZIP9 does not transport zinc across the plasma membrane in these cell models but instead is involved in the secretory pathway, regulating zinc release from intracellular stores (42, 43). Additional studies will be required to reconcile these disparate findings and to determine whether they reflect species differences in zinc transporter functions, different cellular locations in various cell types, or differences in zinc status as has been noted for other zinc transporters (40, 41). Also, further characterization of croaker ZIP9 structure and functions as well as comparisons with ZIP9 proteins in other vertebrate species are necessary to understand the broad significance of the present results. However, the finding that the testosterone-induced increase in intracellular zinc in croaker G/T cells and transfected cells is mediated by ZIP9 indicates that this androgen receptor also functions as a zinc transporter.
The steroid binding characteristics of recombinant croaker ZIP9 are similar to those of other mARs biochemically characterized in vertebrate tissues but differ from those of nARs. For example, the testosterone binding affinity of the recombinant ZIP9 protein (Kd 12.5 nM) is similar to that reported for mARs in croaker ovaries [Kd of 15.4 nM (24)] and rat brains [31.8 nM (22)] but only 10% of that for the croaker nAR (28), whereas the androgen binding/dissociation kinetics of the croaker ZIP9 (half-times < 2 min) are at least 20 times faster than those of the croaker ovarian nAR (28). Moreover, the finding that the nAR agonists, mibolerone and R1881, and the antagonist, flutamide, display less than 1% the affinity of testosterone for ZIP9, is in agreement with previous findings with the unidentified mAR biochemically characterized in croaker ovaries (24), suggesting that these compounds can be used to distinguish androgen actions mediated by the nAR from those through the croaker mAR. The ligand blot results showing that the peak of [3H]T binding to solubilized transfected cell membranes coincides with the 40-kDa croaker mAR immunoreactive band provide preliminary evidence that ZIP9 does not require another component as part of a receptor protein complex for its ligand binding function and that the ligand binding pocket resides in the ZIP9 protein. However, to confirm this, it will be necessary to demonstrate that recombinant ZIP9 produced in prokaryotic or yeast expression systems retains its [3H]T binding functions, as shown previously for the mPRs (3, 7).
Several lines of evidence indicate that testosterone activation of croaker G/T and SKBR-3 cells expressing ZIP9 causes signal transduction through G proteins, similar to rapid androgen actions reported in several other vertebrate cells (11, 13, 15). The experiments with Tr cells using radiolabeled GTPγS and specific G protein-α subunit antibodies show a stimulatory G protein is activated after T treatment, which is consistent with the increase in cAMP production observed. Both the decreased [3H]T binding observed in the presence of excess nonradiolabeled GTPγS and the coimmunoprecipitation of ZIP9 with Gαs suggest croaker ZIP9 is directly coupled to G proteins. Although croaker ZIP9 has the functional characteristics of a G protein-coupled receptor, our structural analyses indicate that the croaker mAR, like mPRs, is not a member of the G protein-coupled receptor (GPCR) superfamily but is a distinct ZIP9 7-TM receptor with high homology to other ZIP9 zinc transporters.
Other characteristics of the novel cDNA and protein are consistent with its identity as a mAR mediating reproductive functions. ZIP9 is expressed primarily in gonadal and brain tissues, and the protein is localized in granulosa cells, which suggest its functions are restricted to this cell type in the croaker ovary. Moreover, ZIP9 is expressed on the plasma membranes of cocultured croaker G/T cells and is up-regulated by gonadotropin, testosterone, and E2 treatments as well as during the reproductive cycle. In addition, evidence is presented that serum starvation-induced cell death is augmented by treatment with testosterone but not by nAR agonists, providing an initial indication that croaker ZIP9 mediates androgen-induced cell death of G/T cells. This was confirmed by showing abrogation of this response after treatment of the cells with siRNA for ZIP9. Androgens have previously been shown to promote apoptosis of rodent granulosa cells (29, 30). However, the role of apoptosis in regulating ovarian functions in fish is currently unknown (44), so the precise physiological significance of this testosterone-induced apoptosis of croaker G/T cells is unclear. It is interesting that ZIP9 levels are rapidly up-regulated in fully grown oocytes in response to gonadotropin treatment and in response to high concentrations of the ovarian steroids, E2 and testosterone. Testosterone is present in the circulation of female teleosts throughout the reproductive cycle and increases dramatically in many teleosts around the time of the ovulatory surge of gonadotropin. It is possible, therefore, that levels of ZIP9 increase during this period and that increased circulating levels of testosterone act through ZIP9 to initiate the process of apoptosis of G/T cells, which occurs after oocyte maturation and ovulation, resulting in atresia of the spent follicle at the end of the cycle.
Although it has been shown previously that steroid hormones can regulate the functions of zinc transporters belonging to both the ZnT (SLC30A) and ZIP families (41), the present results are the first evidence that a zinc transporter protein also functions as a mAR. Over the last decade, the importance of zinc in mediating cellular signaling to influence cellular function in both health and disease has become widely recognized (36, 40, 41, 45, 46). Zinc has an important role in the regulation of cell death in a wide range of cell types through both direct and indirect actions involving activation of proapoptotic pathways, although the mechanisms appear to be complex and poorly understood (45, 46). The results of this study indicate that androgen-induced apoptosis of G/T and ZIP9-transfected cells and increases in intracellular free zinc levels, as well as G protein-dependent signal transduction are all mediated through activation of a novel androgen receptor, croaker ZIP9. The experiment showing that testosterone stimulation of apoptosis of G/T cells is blocked by pretreatment with a zinc chelator, TPEN, indicates that these apoptotic actions of testosterone through ZIP9 are likely partially mediated through increases in intracellular zinc.
The discovery that a steroid hormone directly influences zinc signaling through a protein that has dual functions as a steroid receptor and zinc transporter provides a plausible mechanism by which steroids can modulate zinc homeostasis and its cellular functions. The present finding also expands the repertoire of intracellular signaling pathways directly influenced by hormones to include those mediated through a heavy metal, zinc. The demonstration that mammalian proteins homologous to the croaker ZIP9 have similar functions would provide the basis for investigating and potentially treating disruptions of zinc homeostasis in cancer (46) and other diseases and as a result of environmental heavy metal exposure (47).
Acknowledgments
The assistance of Susan Lawson with fish care is greatly appreciated.
This work was supported by National Institutes of Health Grant ESO 12961 (to P.T.).
Disclosure Summary: the authors have nothing to disclose
- DAPI
- 4′,6-diamidino-2-phenylindole
- E2
- estradiol-17β
- Gαi1–2
- inhibitory G protein
- G/T
- granulosa and theca
- hCG
- human chorionic gonadotropin
- [3H]T
- [2,4,6,7-3H]T
- ICC
- immunocytochemical
- Kd
- dissociation constant
- mAR
- membrane androgen receptor
- mPR
- membrane progestin receptor
- nAR
- nuclear androgen receptor
- NT
- nontransfected
- q-PCR
- quantitative PCR
- RBA
- relative binding affinity
- siRNA
- small interfering RNA
- 7-TM
- seven transmembrane
- 8-TM
- eight transmembrane
- TPEN
- N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine
- Tr
- transfected
- ZIP
- zinc-related transporter (Zrt) and Irt-like protein
- ZIP9
- zinc influx transporter 9.
References
- 1. Watson CS, Gametchu B. Membrane-initiated steroid actions and the proteins that mediate them. Proc Soc Exp Biol Med. 1999;220:9–19. [DOI] [PubMed] [Google Scholar]
- 2. Norman AW, Mizwicki MT, Norman DP. Steroid-hormone rapid actions, membrane receptors and a conformational ensemble model. Nat Rev Drug Discov. 2004;3:27–41. [DOI] [PubMed] [Google Scholar]
- 3. Thomas P. Rapid steroid hormone actions initiated at the cell surface and the receptors that mediate them with an emphasis on recent progress in fish models. Gen Comp Endocrinol. 2012;175:367–383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Boonyaratanakornkit V, Scott MP, Ribon V, et al. The role of extranuclear signaling actions of progesterone receptor in mediating progesterone regulation of gene expression and the cell cycle. Mol Endocrinol. 2007;21(2):359–375. [DOI] [PubMed] [Google Scholar]
- 5. Chen Z, Yuhanna IS, Galcheva-Gargoza Z, Karas RH, Mendelsohn ME, Shaul PW. Estrogen receptor alpha mediates the nongenomic activation of endothelial nitric oxide synthase by estrogen. J Clin Invest. 1999;103(3):401–406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Thomas P, Pang Y, Filardo EJ, Dong J. Identity of an estrogen membrane receptor coupled to G protein in human breast cancer cells. Endocrinology. 2005;146(2):624–632. [DOI] [PubMed] [Google Scholar]
- 7. Zhu Y, Rice CD, Pang Y, Pace M, Thomas P. Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci USA. 2003;100(5):2231–2236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Rahman F, Christian HC. Non-classical actions of testosterone: an update. Trends Endocrinol Metab. 2008;18:371–378. [DOI] [PubMed] [Google Scholar]
- 9. Foradori CD, Weiser Handa RJ. Non-genomic actions of androgens. Front Neuroendocrinol. 2008;29:169–181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Braun AM, Thomas P. Androgens inhibit estradiol-17β synthesis in Atlantic croaker (Micropogonias undulatus) ovaries by a nongenomic mechanism initiated at the cell surface. Biol Reprod. 2003;69(5):1642–1650. [DOI] [PubMed] [Google Scholar]
- 11. Gorczynska E, Handelsman DJ. Androgens rapidly increase the cytosolic calcium concentration in Sertoli cells. Endocrinology. 1995;136(5):2052–2059. [DOI] [PubMed] [Google Scholar]
- 12. Hatzoglou A, Kampa M, Kogia C, et al. Membrane androgen receptor activation induces apoptotic regression of human prostate cancer cells in vitro and in vivo. J Clin Endocrinol Metab. 2005;90(2):893–903. [DOI] [PubMed] [Google Scholar]
- 13. Machelon V, Nome F, Tesarik J. Nongenomic effects of androstenedione on human granulosa luteinizing cells. J Clin Endocrinol Metab. 1998;83(1):263–269. [DOI] [PubMed] [Google Scholar]
- 14. Estrada M, Liberona JL, Miranda M, Jaimovich E. Aldosterone- and testosterone-mediated intracellular calcium response in skeletal muscle cell cultures. Am J Physiol Endocrinol Metab. 2000;279:E132–E139. [DOI] [PubMed] [Google Scholar]
- 15. Lieberherr M, Grosse B. Androgens increase intracellular calcium concentration and inositol 1,4,5-trisphosphate and diacylglycerol formation via a pertussis toxin-sensitive G-protein. J Biol Chem. 1994;269(10):7217–7223. [PubMed] [Google Scholar]
- 16. Benten WP, Lieberherr M, Stamm O, Wrehlke C, Guo Z, Wunderlich F. Testosterone signaling through internalizable surface receptors in androgen receptor-free macrophages. Mol Biol Cell. 1999;10(10):3113–3123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Wunderlich F, Benten WP, Lieberherr M, et al. Testosterone signaling in T cells and macrophages. Steroids. 2002;67(6):535–538. [DOI] [PubMed] [Google Scholar]
- 18. Liu D, Dillon JS. Dehydroepiandrosterone activates endothelial cell nitric oxide synthase by a specific plasma membrane receptor coupled to Gai2,3. J Biol Chem. 2002;277:21379–21388. [DOI] [PubMed] [Google Scholar]
- 19. Armen TA, Gay CV. Simultaneous detection and functional response of testosterone and estradiol receptors in osteoblast plasma membranes. J Cell Biochem. 2000;79:620–627. [PubMed] [Google Scholar]
- 20. Benten WP, Lieberherr M, Giese G, et al. Functional testosterone receptors in plasma membranes of T cells. FASEB J. 1999;13(1):123–133. [DOI] [PubMed] [Google Scholar]
- 21. Gu S, Papadopoulou N, Gehring E-M, et al. Functional membrane androgen receptors in colon tumors trigger pro-apoptotic responses in vitro and reduce drastically tumor incidence in vitro. Mol Cancer. 2009;8:114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Ramirez VD, Zheng J, Siddique KM. Membrane receptors for estrogen, progesterone, and testosterone in the rat brain: fantasy or reality. Cell Mol Neurobiol. 1996;16(2):175–198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Konoplya EF, Popoff EH. Identification of the classical androgen receptor in male rat liver and prostate cell plasma membranes. Int J Biochem. 1992;24(12):1979–1983. [DOI] [PubMed] [Google Scholar]
- 24. Braun AM, Thomas P. Biochemical characterization of a membrane androgen receptor in the ovary of the Atlantic croaker (Micropogonias undulatus). Biol Reprod. 2004;71(1):146–155. [DOI] [PubMed] [Google Scholar]
- 25. Sun Y-H, Gao X, Tang Y-J, Xu C-L, Wang L-H. Androgens induce increases in intracellular calcium via a G protein-coupled receptor in LNCaP prostate cancer cells. J Androl. 2006; 27(5):671–678. [DOI] [PubMed] [Google Scholar]
- 26. Fix C, Jordan C, Cano P, Walker WH. Testosterone activates mitogen-activated protein kinase and the cAMP response element binding protein transcription factor in Sertoli cells. Proc Natl Acad Sci USA. 2004;101(30):10919–10924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Guo Z, Benten PM, Krucken J, Wunderlich F. Nongenomic testosterone calcium signaling. Genotropic actions in androgen receptor-free macrophages. J Biol Chem. 2002;277(33):29600–29607. [DOI] [PubMed] [Google Scholar]
- 28. Sperry TS, Thomas P. Characterization of two nuclear androgen receptors in Atlantic croaker: comparison of their biochemical properties and binding specificities. Endocrinology. 1999;140(4):1602–1611. [DOI] [PubMed] [Google Scholar]
- 29. Billig H, Furata I, Hsueh AJW. Oestrogens inhibit and androgens enhance ovarian granulosa cell apoptosis. Endocrinology. 1993;133:2204–2212. [DOI] [PubMed] [Google Scholar]
- 30. Pradeep PK, Li X, Peegel H, Menon KMJ. Dihydrotestosterone inhibits granulosa cell proliferation by decreasing the cyclin D2 mRNA expression and cell cycle arrest in G1 phase. Endocrinology. 2012;143:2930–2035. [DOI] [PubMed] [Google Scholar]
- 31. Benninghoff AD, Thomas P. Gonadotropin regulation of testosterone production by primary cultured theca and granulosa cells of Atlantic croaker: I. Novel role of CaMKs and interactions between calcium- and adenylyl cyclase-dependent pathways. Gen Comp Endocrinol. 2006;147(3):276–287. [DOI] [PubMed] [Google Scholar]
- 32. Thomas P, Alyea R, Pang Y, Peyton C, Dong J, Berg AH. Conserved estrogen binding and signaling functions of the G protein-coupled estrogen receptor 1 (GPER) in mammals and fish. Steroids. 2010;75:595–602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Rahman MS, Thomas P. Molecular cloning, characterization and expression of two hypoxia-inducible factor α subunits, HIF-1α and HIF-2α, in a hypoxia-tolerant marine teleost, Atlantic croaker (Micropogonias undulatus). Gene. 2007;396(2):273–282. [DOI] [PubMed] [Google Scholar]
- 34. Merten KE, Jiang Y, Kang YJ. Zinc inhibits doxorubicin-activated calcineurin signal transduction pathway in H9c2 embryonic rat cardiac cells. Exp Biol Med (Maywood). 2007;232(5):682–689. [PubMed] [Google Scholar]
- 35. Blom N, Gammeltoft S, Brunak S. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol. 1999;294(5):1351–1362. [DOI] [PubMed] [Google Scholar]
- 36. Eide DJ. The Zip family of zinc transporters. In: Kuldell N, Iuchi S, eds. Zinc Finger Proteins: From Atomic Contact to Cellular Function. New York: Kluwer Academic/Plenum Publishers; 2005:261–264. [Google Scholar]
- 37. Feeney GP, Zheng D, Kille P, Hogstrand C. The phylogeny of teleost ZIP and ZnT zinc Transporters and their tissue specific expression and response to zinc in zebrafish. Biochim Biophys Acta. 2005;1732(1–3):88–95. [DOI] [PubMed] [Google Scholar]
- 38. Pocanshi Cl, Ehsani S, Mehrabian M, et al. The ZIP5 ectodomain co-localizes with PrP and may acquire a PrP-like fold that assembles into a dimmer. PLOS One. 2013;8(9):e72556. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Birbaumer L, Abramowitz J, Brown AM. Receptor-effector interactions. Biochim Biophys Acta. 1990;1031 (92):163–224. [DOI] [PubMed] [Google Scholar]
- 40. Fukada T, Kambe T. Molecular and genetic features of zinc transporters in physiology and pathogenesis. Metallomics. 2011;3(7):662–674. [DOI] [PubMed] [Google Scholar]
- 41. Jeong J, Eide DJ. The SLC39 family of zinc transporters. Mol Aspects Med. 2013;34(2–3):612–619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Matsuura W, Yamazaki T, Yamaguchi-Iwai Y, et al. SLC39A9( Zip9) regulates zinc homeostasis in the secretory pathways: characterization of the ZIP subfamily I protein in vertebrate cells. Biosci Biotechnol Biochem. 2009;73 (5):1142–1148. [DOI] [PubMed] [Google Scholar]
- 43. Taniguchi M, Fukunaka A, Hagihara M, et al. Essential role of the zinc transporter ZIP9/SLC39A9 in regulating the activations of Akt and Erk in B-cell receptor signaling pathway in DT40 cells. PLOS ONE. 2013; 8(3) e58022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Wood AW, Van Der Kraak GJ. Apoptosis and ovarian function: novel perspectives from the teleosts. Biol Reprod. 2001;64(1):264–271. [DOI] [PubMed] [Google Scholar]
- 45. Chimienti F, Seve M, Richard S, Mathieu J, Favier A. Role of cellular zinc in programmed cell death: temporal relationship between zinc depletion, activation of caspases, and cleavage of Sp family transcription factors. Biochem Pharmacol. 2001;62(1):51–62. [DOI] [PubMed] [Google Scholar]
- 46. Franklin RB, Costello LC. The important role of the apoptotic effects of zinc in the development of cancers. J Cell Biochem. 2009;106(5):750–757. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Bressler JP, Olivi L, Cheong JH, Kim Y, Maerten A, Bannon D. Metal transporters in intestine and brain: their involvement in metal-associated neurotoxicities. Hum Exp Tox. 2007;26:221–229. [DOI] [PubMed] [Google Scholar]
- 48. Thomas P, Pang Y, Dong J, Berg AH. Identification and characterization of membrane androgen receptors in the ZIP9 zinc transporter subfamily: II. Role of human ZIP9 in testosterone-induced prostate and breast cancer cell apoptosis. Endocrinology. 2014;155:4250–4265. [DOI] [PMC free article] [PubMed] [Google Scholar]





