Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Oct 1.
Published in final edited form as: Cancer Epidemiol Biomarkers Prev. 2014 Jul 13;23(10):2093–2100. doi: 10.1158/1055-9965.EPI-14-0177

Reduced insulin-like growth factor 1 receptor and altered insulin receptor isoform mRNAs in normal mucosa predict colorectal adenoma risk

M Agostina Santoro 1, Sarah F Andres 1, Joseph A Galanko 2, Robert S Sandler 2, Temitope O Keku 2, P Kay Lund 1
PMCID: PMC4201381  NIHMSID: NIHMS614074  PMID: 25017244

Abstract

Background

Hyperinsulinemia resulting from obesity and insulin resistance is associated with increased risk of many cancers, but the biology underlying this risk is unclear. We hypothesized that increased mRNA levels of the insulin-like growth factor 1 receptor (IGF1R) versus the insulin receptor (IR) or elevated ratio of IR-A:IR-B isoforms in normal rectal mucosa would predictadenoma risk, particularly in individuals with high body mass index (BMI) or plasma insulin.

Methods

Biopsies from normal rectal mucosa were obtained from consenting patients undergoing routine colonoscopy at UNC Hospitals. Subjects with colorectal adenomas were classified as cases (n = 100) and were matched to adenoma-free controls (n = 98) based on age, sex and BMI. IGF1R and IR mRNA levels were assessed by qRT-PCR, and IR-A:IR-B mRNA ratios by standard PCR. Plasma insulin and crypt apoptosis were measured by ELISA and TUNEL, respectively. Logistic regression models examined relationships between receptor mRNAs, BMI, plasma insulin and adenoma risk.

Results

Unexpectedly, cases were significantly more likely to have lower IGF1R mRNA levels than controls. No overall differences in total IR mRNA or IR-A:IR-B ratios were observed between cases and controls. Interestingly, in patients with high plasma insulin, increased IR-A:IR-B ratio was associated with increased likelihood of having adenomas.

Conclusions

Our work shows novel findings that reduced IGF1R mRNA and, during high plasma insulin, increased IR-A:IR-B ratios in normal rectal mucosa are associated with colorectal adenoma risk.

Impact

Our work provides evidence supporting a link between IGF1R and IR isoform expression levels and colorectal adenoma risk.

Keywords: IGF1 receptor, insulin receptor, IR-A, IR-B, colorectal cancer

Introduction

Despite increased colonoscopy-based screening and improved treatment strategies (1), colorectal cancer (CRC) remains the second leading cause of cancer-related deaths in the United States (2). Obesity, insulin resistance and type 2 diabetes are considered risk factors for CRC (3–5). Previous work by our group has linked elevated plasma insulin and low apoptosis in normal rectal mucosa to increased adenoma risk (6–8). Elevated plasma insulin (hyperinsulinemia) can increase levels of free insulin-like growth factor 1 (IGF1) in the circulation by inhibiting the production of IGF binding protein 1 (IGFBP1) (9, 10). In recent years, there has been increasing interest in targeting the insulin/IGF pathway for cancer treatment, as a large body of evidence links insulin/IGF1-mediated activation of insulin receptor (IR) or IGF1 receptor (IGF1R) to cancer of multiple organs (11–16). Furthermore, a number of studies have shown that IGF1R confers resistance to radiation therapy and chemotherapy (17, 18), and clinical evidence links IGF1R over-expression to colorectal tumor formation and progression (19, 20). Although IGF1R inhibitors showed a potential to reduce tumor growth (21, 22), recent reports suggested that IR may permit tumors to resist IGF1R inhibition, which led to the development of dual IGF1R/IR inhibitors (23–26).

Considerable evidence has highlighted the potential significance of different IR isoforms in growth and cancer (14, 27, 28). The IR gene yields two distinct IR isoforms due to alternate pre-mRNA splicing. IR-B is encoded by an mRNA that includes exon 11 and is the primary mediator of the metabolic actions of insulin (12, 29). IR-A is encoded by an mRNA that lacks exon 11, plays a role in fetal growth and may mediate proliferative or anti-apoptotic actions of insulin or the IGFs (27, 28). Evidence that IR-A may be the predominant IR isoform in tumors or tumor cells (12, 14, 27, 28, 30), including colon tumors (31, 32), has increased attention on this isoform as a possible mediator of cancer development or growth. However, the finding that IR-A knockdown increased viability of a colon cancer cell line via enhanced IGF1R activation (32) indicates that when IGF1R signaling is intact, IR may limit IGF1R signaling. Thus, the roles of IGF1R vs. IR in promoting colorectal tumorigenesis are not defined.

Little attention has been given to IGF1R and IR mRNA expression patterns during pre-neoplastic stages of malignancy, including whether IGF1R or IR levels in normal colorectal tissue differ between patients with adenomas and patients without adenomas. We hypothesized that elevated mRNA levels of IGF1R vs. IR or elevated IR-A:IR-B ratio in normal mucosa are associated with increased colorectal adenoma risk, elevated plasma insulin, and overweight/obese body mass index (BMI). To address this hypothesis, biopsies from normal rectal mucosa were obtained from adenoma or adenoma-free patients undergoing routine colonoscopy. Levels of mRNAs encoding IGF1R, IR and IR isoforms were quantified and the relationship between their expression, adenoma status, BMI and plasma insulin was evaluated.

Materials and methods

Participants

Participants were randomly selected from eligible subjects enrolled in the Diet and Health Study V (DHS V) who provided written informed consent and underwent routine colonoscopy at the University of North Carolina Hospitals, Chapel Hill, NC. The DHS V cohort has been described in previous studies (33–36). For the present study, a subset of 100 cases and 98 controls were selected so that the two groups were matched based on age, gender and BMI. Patients were excluded from the study if they had cancer, colitis, 100 or more polyps (polyposis), prior resection of the colon, or history of colorectal adenomas. Colonoscopy was performed by certified gastroenterologists and all polyps were removed for pathological examination and were not available for research purposes. Adenomas were confirmed and defined according to standard pathological criteria. Subjects with one or more adenomas were classified as “cases”and those without adenomas as “controls”. The study was approved by the School of Medicine Institutional Review Board at the University of North Carolina, Chapel Hill.

Data collection

Methods for data collection were previously described (33–36). Briefly, participants fasted overnight and body weight, height, and waist and hip circumference were measured at the time of colonoscopy. Within 3 months after colonoscopy, patients were interviewed by telephone to provide information about their lifestyle, diet and demographics. BMI between 18.5–24.9 kg/m2 (lean) was defined as “normal” and BMI equal to or higher than 25 kg/m2 (overweight/obese) was defined as “Ovt/Ob”.

Biological specimens and laboratory assays

Prior to the endoscopic procedure, normal mucosal pinch biopsies were obtained 8–12 cm from the anal verge using standard disposable, fenestrated forceps. Sampling site was the same in all patients. Two biopsies were pooled for RNA extraction and immediately flash frozen in liquid nitrogen and later transferred to −80°C. Another biopsy was fixed in 10% buffered formalin for histology and evaluation of apoptosis. Blood was collected via an intravenous catheter prior to administration of medication. Plasma was separated and insulin levels assayed for 95 controls and 79 cases by ELISA (Diagnostic Systems Laboratory, Webster, TX) as previously described (8). Plasma insulin levels below or above the median were defined as “low” or “high”, respectively.

Assays for apoptosis

Formalin fixed rectal biopsies were embedded in paraffin. Apoptosis was scored by terminal deoxynucleotidyltransferased UTP nick end labeling (TUNEL) using ApopTag Peroxidase In Situ Apoptosis Detection Kit (Millipore, Billerica, MA). This technology detects apoptotic cells by incorporating digoxigenin-conjugated nucleotides to the 3’OH termini of DNA fragments utilizing terminal deoxynucleotidyltransferase (TdT). Briefly, samples were deparaffinized in 100%, 95% and 70% ethanol, digested in proteinase K and blocked in 2% hydrogen peroxide. TdT reaction was performed for 1.5 hours at 37°C. Anti-digoxigenin conjugate was applied to the slides for 30 minutes, followed by a DAB (3, 3'-Diaminobenzidine) reaction for 1 minute. Samples were counterstained with hemotoxylin and dehydrated with 95% and 100% ethanol and xylene. Slides were cover slipped using Eukitt mounting medium (Sigma-Aldrich, St. Louis, MO) and visualized with a bright-field microscope. Open crypts with good orientation were selected for scoring. The mean number of TdT-labeled apoptotic cells per crypt was calculated for each patient sample by investigators blinded to adenoma status. Due to the low number of samples available for apoptosis scoring (21 controls and 68 cases), it was only possible to compare apoptosis in cases versus controls without further stratification.

RNA Extraction, Reverse Transcription (RT) and PCR

RNA was extracted from biopsies using RNeasy Kit (Qiaen, Valencia, CA) and reverse transcribed with High Capacity cDNA Reverse Transcription Kit, including RNase inhibitor (Applied Biosystems, Carlsbad, CA) according to manufacturer’s protocol. Quantitative real-time polymerase chain reaction (qRT-PCR) used the 7500 Real-Time PCR System (Applied Biosystems, Carlsbad, CA) to quantify IGF1R and IR mRNA levels. Hydroxymethylbilane synthase (HMBS), which we have found to be invariant across rectal biopsy mRNAs, was used as the housekeeping gene for normalization. The following TaqMan primer/probes (Applied Biosystems, Carlsbad, CA) were used: Hs00951562_m1 (IGF1R), Hs00961550_m1 (IR), and Hs00609297_m1 (HMBS). Pooled cDNA from colorectal cancer cell lines (Caco-2, SW480, Colo205) was run in all assays as a positive, internal control to account for inter-run variability. Samples were run in duplicate and water was run as a negative control. Reaction cycles consisted of initial denaturation at 95°C for 5 minutes, 45 cycles of 95°C denaturation for 15 seconds and 60°C annealing for 45 seconds. Data were analyzed using the Applied Biosystems 7500 software v2.0.1 and expression levels were calculated using the standard curve method. These values were then normalized to HMBS and to the internal control.

IR isoforms A and B were assessed by traditional, semi-quantitative PCR using 150 ng of cDNA template. Forward primer 5’-GAATGCTGCTCCTGTCCAAA -3’ and reverse primer 5’- TCGTGGGCACGCTGGTCGAG -3’ (Integrated DNA Technologies, Coralville, IA) were designed to flank exon 11, resulting in 250 bp (IR-B) and 214 bp (IR-A) amplified fragments. PCR protocol was modified from Brierley et al. (32) and consisted of initial denaturation at 92°C for 5 minutes followed by 40 cycles of 92°C denaturation for 30 seconds, 60°C annealing for 30 seconds and 72°C extension step for 30 seconds. Water and the internal control cDNA mentioned above were included in every assay. PCR products were run and visualized in a 2.5% agarose gel and band intensities were measured using Image J software (National Institutes of Health). Ratios of IR-A to IR-B were calculated for each patient sample and normalized to the internal control. All PCR assays were performed by an investigator blinded to case-control and BMI status, and samples were randomly organized by another investigator so that all the groups were represented in each assay run.

Statistical analysis

Means and standard errors were computed for continuous variables. Differences in continuous or categorical variables between adenoma cases and adenoma-free controls were compared by Student’s t-test or Chi-square test, respectively. BMI was divided into “normal” and“Ovt/Ob” (overweight/obese) and plasma insulin levels into “low” (below the median) and “high” (above the median) subgroups as described above. For each receptor mRNA, the levels in controls were used to generate quartiles, and the lowest quartile was considered as reference. Logistic regression models were used to compute odds ratios (ORs) and 95% confidence intervals (CIs) to examine the association between mRNA quartiles (predictors) and adenoma status (response). We also calculated P-values for interactions between mRNA variables and BMI/insulin subgroups in a model testing for an association with case status. The relationship between plasma insulin and receptor mRNA levels was evaluated by Spearman’s correlation coefficient. P-values less than 0.05 were considered statistically significant. All analyses were performed using SAS Version 9.3 (SAS Institute, Cary, NC).

Results

Patient samples in this study were selected so that cases and controls were matched on age, sex and BMI. Subject characteristics are summarized in Table 1. Race was not associated with control or case status, and no differences in WHR, reported calorie intake or reported physical activity were observed between cases and controls. Consistent with previous studies from our group (6, 7), adenoma cases showed lower apoptosis (p=0.008) and a trend towards increased plasma insulin (p=0.055) relative to adenoma-free controls.

Table 1.

Descriptive characteristics of study participants

Variable Control Case P*
Age (mean (se)) 55.4 (0.7) 55.5 (0.7) 0.92
Race (n (%))
    White 76 (92) 79 (84) 0.17
    Black 7 (8) 15 (16)
Sex (n (%))
    Female 41 (48) 43 (45) 0.66
    Male 44 (52) 53 (55)
BMI (n (%))
    Normal 45 (48) 49 (49) 0.98
    Overweight 29 (31) 29 (29)
    Obese 20 (21) 21 (21)
Physical Activity in MET-minutes
per week (mean (se))
2,981 (341) 2,485 (263) 0.25
Apoptosis (mean (se)) 1.42 (0.12) 1.08 (0.06) 0.008†
Plasma insulin (mean (se)) 7.1 (0.8) 10.8 (1.7) 0.055
Calories (mean (se)) 2,101 (88) 1,949 (79) 0.20
Waist / Hip ratio (mean (se)) 0.908 (0.01) 0.915 (0.01) 0.54
*

Chi square for age, race and gender and student’s t-test for remaining variables

†

Significant at p < 0.05

MET: metabolic equivalent of task

IGF1R and IR mRNA levels in normal rectal mucosa were quantified by qRT-PCR. IR-A and IR-B mRNAs were assessed by standard PCR, where amplification of both isoforms by identical primers allowed us to calculate the ratio of IR-A:IR-B amplicon in each patient sample. We first compared mean mRNA levels between controls and cases overall and after stratifying for BMI and plasma insulin (Table 2). Overall, cases had significantly lower IGF1R mRNA levels (p=0.0003) than controls. This reduction in IGF1R mRNA was statistically significant in both normal (p=0.02) and Ovt/Ob (p=0.01) BMI subgroups and in subjects in the lower half of plasma insulin (p=0.007). Since cases had slightly higher plasma insulin levels than controls, and elevated insulin can down-regulate IGF1R as a consequence of increased free IGF1 in the circulation (37, 38), we asked if the lower IGF1R mRNA observed in cases could be associated with higher plasma insulin. Therefore, we examined IGF1R mRNA levels in controls versus cases after adjusting for plasma insulin. This analysis showed that even after controlling for insulin, cases still had lower IGF1R than controls (p=0.005). Total IR mRNA levels did not differ between cases and controls in any subgroup categorized for BMI or plasma insulin. IR-A:IR-B ratio was 1.96 ± 0.04 in controls and 1.96 ± 0.03 in cases, demonstrating approximately 2 fold higher IR-A mRNA expression in human rectum compared with IR-B, but no significant difference in cases and controls as a whole or when stratified for BMI (Table 2). Interestingly, among patients with high plasma insulin, adenoma cases had small but significant increases in IR-A:IR-B ratios relative to controls (p=0.006), which qualitatively reflected reduced IR-B mRNA (Figure 1).

Table 2.

Mean expression of IGF1R, IR and IR-A:IR-B mRNAs in controls vs. cases overall and grouped by BMI and plasma insulin status

Variable Subgroup n Control
mean (se)
n Case
mean (se)
P*
IGF1R Everyone 98 1.04 (0.03) 100 0.90 (0.02) 0.0003†
BMI Normal 45 1.06 (0.05) 49 0.91 (0.04) 0.02†
Ovt/Ob 49 1.00 (0.04) 50 0.88 (0.03) 0.01†
Insulin Low 48 1.09 (0.05) 36 0.93 (0.03) 0.007†
High 47 0.97 (0.04) 43 0.88 (0.03) 0.09

IR Everyone 98 1.17 (0.03) 100 1.17 (0.06) 0.94
BMI Normal 45 1.14 (0.05) 49 1.18 (0.11) 0.78
Ovt/Ob 49 1.17 (0.04) 50 1.15 (0.04) 0.82
Insulin Low 48 1.24 (0.05) 36 1.12 (0.05) 0.10
High 47 1.08 (0.04) 43 1.12 (0.04) 0.51

IR-A:IR-B Everyone 98 1.96 (0.04) 100 1.96 (0.03) 0.94
BMI Normal 45 2.01 (0.07) 49 1.96 (0.05) 0.52
Ovt/Ob 49 1.91 (0.04) 50 1.95 (0.03) 0.48
Insulin Low 48 2.07 (0.07) 36 1.95 (0.05) 0.18
High 47 1.85 (0.04) 43 2.01 (0.04) 0.006†
*

Student’s t-test

†

Significant at p < 0.05

Figure 1.

Figure 1

Representative gels showing IR-A and IR-B mRNAs in cases and controls with low and high plasma insulin. Controls with high insulin have decreased IR-A:IR-B ratios compared to controls with low insulin, potentially due to increased IR-B and maintained IR-A. Among patients with high insulin, cases have higher IR-A:IR-B ratios than controls, and this appears to result from decreased IR-B and unaltered IR-A. Samples were run in groups of 19 per gel, and representative images were obtained from different originals or multiple fields from the same image.

To further evaluate the potential relationship between mRNA levels and colorectal adenoma risk, we studied the association between quartiles of IGF1R, IR and IR-A:IR-B mRNA expression and the odds of being a case, with the lowest quartile set as the reference (Table 3). Subjects in the highest two quartiles for IGF1R mRNA were significantly less likely to be cases. There were no significant associations between IR mRNA, IR-A:IR-B ratio and case status. To explore the association between receptor mRNA expression and adenoma risk in each subgroup, we used a logistic regression model to test for interactions between mRNA levels and BMI or plasma insulin status (Table 4). We found no interactions between BMI or plasma insulin and either IGF1R or IR mRNA levels. We did, however, observe a significant interaction between plasma insulin and IR-A:IR-B ratio (p=0.005). With increasing IR-A:IR-B mRNA ratios, patients with high plasma insulin were more likely to have adenomas than were patients with low plasma insulin (Supplementary Fig. S1).

Table 3.

ORs and 95% CIs for the association between colorectal adenomas and IGF1R, IR and IR-A:IR-B mRNA expression

Variable n (Control/Case) OR* (95% CI) P*
IGF1R
    Q1 25/46 1.0 (Reference) -
    Q2 25/23 0.5 (0.2–1.1) 0.07
    Q3 25/19 0.4 (0.2–0.9) 0.02†
    Q4 23/12 0.3 (0.1–0.7) 0.004†
IR
    Q1 25/26 1.0 (Reference) -
    Q2 24/28 1.1 (0.5–2.4) 0.77
    Q3 25/30 1.2 (0.5–2.5) 0.71
    Q4 24/16 0.6 (0.3–1.5) 0.30
IR-A:IR-B
    Q1 25/29 1.0 (Reference) -
    Q2 24/20 0.7 (0.3–1.6) 0.42
    Q3 25/23 0.8 (0.4–1.7) 0.56
    Q4 24/28 1.0 (0.5–2.2) 0.99
*

Odds of being a case

†

Significant at p < 0.05

Table 4.

Association between colorectal adenomas and IGF1R, IR and IR-A:IR-B mRNA expression influenced by BMI and plasma insulin

P for interaction

Variable BMI
(Normal vs. Ovt/Ob)
Insulin
(Low vs. High)
IGF1R 0.78 0.47
IR 0.74 0.11
IR-A:IR-B 0.34 0.005†
†

Significant at p < 0.05

We next compared mRNA expression between subgroups in controls and cases separately. We found that in the control group, subjects with high plasma insulin had reduced mean IGF1R, IR and IR-A:IR-B mRNA levels (p=0.048, p=0.02, p=0.01, respectively) relative to subjects with low plasma insulin. This association was not found in cases. Qualitative evaluation of the IR isoforms suggested that the reduced IR-A:IR-B ratio observed in controls with high insulin reflected higher IR-B (Figure 1). To further examine the possible effect of elevated insulin on gene expression, we calculated the correlation coefficients between plasma insulin and IGF1R, IR and IR-A:IR-B mRNA levels (Table 5). We indeed found significant negative correlations between plasma insulin and all three mRNA variables in controls, while in cases this relationship was significant only for IGF1R mRNA. In fact, in cases there was a non-significant trend for a positive correlation between IR-A:IR-B ratio and plasma insulin (p=0.06).

Table 5.

Correlation between plasma insulin and IGF1R, IR and IR-A:IR-B mRNA expression

Plasma insulin

Variable Controls (n=95) Cases (n=79)
r* P r* P
IGF1R −0.21 0.045† −0.30 0.01†
IR −0.26 0.01† −0.14 0.21
IR-A:IR-B −0.31 0.002† 0.21 0.06
*

Spearman’s correlation coefficient

†

Significant at p < 0.05

Discussion

This case-control study provides novel evidence that, compared to adenoma-free controls, rectal mucosal biopsies of patients with adenomas are likely to have 1) significantly lower levels of IGF1R mRNA, 2) unaltered IR mRNA, and 3) higher ratios of IR-A:IR-B isoforms in those individuals with elevated plasma insulin. Consistent with our previous findings in three different patient groups (6–8), the presence of adenomas was associated with reduced apoptosis in normal appearing rectal mucosa and increased plasma insulin, although the latter was borderline significant in this smaller study population.

Identifying molecular biomarkers that predict early pre-cancerous lesions could significantly improve our understanding of factors that promote CRC risk, which could eventually contribute to better CRC prevention or screening. This study aimed to establish whether elevated mRNA expression of IGF1R, IR or relative expression of isoforms IR-A and IR-B in normal rectal mucosa predicts adenomas and whether this is influenced by BMI or plasma insulin levels. IGF1R signaling can be activated during elevated insulin and has been linked to reduced apoptosis and cancer progression in a number of organs, including the intestine (11, 13, 39). Thus, we hypothesized that patients with adenomas would have up-regulated IGF1R mRNA expression in their normal rectal mucosa, particularly in those with high plasma insulin. Unexpectedly, we found that cases had significantly lower IGF1R mRNA levels than controls, and the odds of having colorectal adenomas diminished with increasing IGF1R mRNA expression. We considered whether elevated insulin could be linked to the reduced IGF1R mRNA in cases, since elevated insulin is known to down-regulate IGFBP1 resulting in higher levels of free circulating IGF1 (9, 10) that can down-regulate IGF1R (38). However, the association between decreased IGF1R mRNA and presence of adenomas persisted even after adjusting for plasma insulin, suggesting that the reduced IGF1R mRNA observed in cases was not merely a result of elevated plasma insulin in this group. We next tested for interactions between mRNA levels and BMI or plasma insulin that may impactcase status. We found a significant interaction between IR-A:IR-B ratio and plasma insulin, where increased IR-A:IR-B ratio was associated with increased colorectal adenoma risk in patients with high plasma insulin compared to those with low plasma insulin. This suggests that circulating insulin levels may play an important role in influencing tumor risk associated with high IR-A:IR-B expression, and that more attention should be given to the impact of hyperinsulinemia on relative tissue expression of these IR isoforms.

Insulin has long been known to down-regulate its own receptor by negative feedback to properly regulate glucose uptake in a number of tissues (40–44), and some evidence suggests that hyperinsulinemia and insulin resistance can impact isoform expression (45–48). Insulin can also down-regulate IGF1R, potentially by increasing levels of free IGF1 in plasma (16, 37, 38). Down-regulation of IGF1R transcript in situations of high insulin has been described in skeletal muscle of diabetic db/db mice, where reduced Igf1r mRNA relative to normoglycemic littermates was associated with increased Igf1r promoter methylation (49). These numerous lines of evidence for negative feedback effects of elevated insulin are supported by the present study showing that in adenoma-free controls, levels of IGF1R and IR mRNAs, and IR-A:IR-B ratios each negatively and significantly correlated with plasma insulin. Qualitative analysis of IR isoforms suggested that reduced IR-A:IR-B ratio in controls with high plasma insulin appeared to be due primarily to increased IR-B. Patients with adenoma differed from controls in that only IGF1R mRNA levels significantly and negatively correlated with insulin, and for IR-A:IR-B mRNA ratios there was actually a trend for a positive correlation with insulin. This suggests a difference in the relationship between plasma insulin and IR mRNA levels or IR-A:IR-B mRNA ratios in cases versus controls that may be relevant to mechanisms underlying adenoma risk.

IR isoforms in humans have been studied primarily in breast and prostate cancers and it is well established that IR-A exerts proliferative actions and is overexpressed in tumor tissue (14, 27, 28, 50). However, little is known about the relative expression of IR isoforms in normal gastrointestinal organs including the colorectum. Our findings that mean levels of IR-A mRNA are about 2 fold higher than IR-B mRNA in the human rectal mucosa are relevant to normal and aberrant growth of colon epithelium. A predominance of IR-A might contribute to the relatively low levels of spontaneous colonocyte apoptosis (51) and increased susceptibility to insulin-mediated reductions in apoptosis. Our recent publication demonstrated a switch from predominance of IR-A in proliferative intestinal stem or progenitor cells to IR-B predominance in differentiated enterocytes (31). Furthermore, IR-B expression was reduced in mouse pre-cancerous adenomas versus normal colon and was dramatically reduced in aggressive, poorly differentiated human CRC cell lines versus differentiated CRC cells (31). Consistent with this finding, other studies have recently shown that the relative mRNA levels of IR-A versus IR-B are elevated in both tumor and grossly normal adjacent tissue of human breast and prostate, compared to purely benign tissue (52, 53). However, whether IR isoform expression is altered in normal colorectum in the presence or absence of pre-malignant lesions had not to our knowledge been investigated previously. Our study suggests that among patients in the upper half of plasma insulin, those with adenomas had higher mean IR-A:IR-B ratio in their normal rectal mucosa compared to controls, which appeared to result from decreased IR-B and maintained IR-A as observed by qualitative examination. These data were supported by logistic regression analyses, which showed that increasing IR-A:IR-B ratios predicted adenomas in patients with elevated plasma insulin. A limitation of these findings is that they resulted from a subgroup comparison, in a relatively small number of patients. However, they do suggest that the relationship between plasma insulin and relative IR-A:IR-B expression in normal tissues should be further explored, as they may be relevant to improved understanding of the roles of hyperinsulinemia and impact of IR isoforms on colorectal tumorigenesis.

A limitation of this study is that alterations in receptor mRNA levels do not necessarily reflect changes in protein expression and phosphorylation, as increased activation of IGF1R and IR has been reported in cancer (54, 55). This is particularly difficult to address for IR-A due to the lack of available antibodies to permit immunohistochemistry or western immunoblot for this isoform. We chose to analyze RNA because sufficient RNA for evaluation of receptor levels is readily obtained from biopsies but we recognize the limitation with regard to predicting protein expression or activation. Another limitation of our study is the lack of access to actual adenomas as these are considered clinical specimens and were not available to us for research. Recent findings from our group using pre-clinical adenoma models provided evidence for increased IR-A:IR-B ratios in colon adenomas relative to normal colon mucosa in mice (31), but whether this is altered in humans and in the context of elevated plasma insulin needs further investigation. An additional limitation is that the differences in mean receptor mRNA expression across patient groups in this study are relatively small. Despite these limitations, the potential significance of our observations is highlighted by the growing interest in the role of the insulin/IGF pathway in cancer and IR/IGF1R inhibitors as potential therapies (22, 24, 26). To date, IR and IR isoforms have been understudied in the gastrointestinal tract, and our work suggests that further studies focusing on these receptors and relative IR-A and IR-B expression are needed to better understand their roles in initiation and pathophysiology of colorectal pre-cancerous lesions. Therefore, our previous and current work indicates that additional attention to the relative expression levels and biological roles of IR-A and IR-B is warranted.

Overall, this is to our knowledge the first study to show that the presence of colorectal adenomas is associated with decreased IGF1R mRNA and, during elevated plasma insulin, increased IR-A:IR-B mRNA ratio in normal rectal mucosa. Particularly, our data raise the important possibility that high IR-A:IR-B mRNA ratio may contribute to colorectal adenoma initiation during elevated plasma insulin. In addition, reduced IGF1R expression and increased relative expression of IR-A:IR-B in normal mucosa should be further investigated as potential predictive biomarkers of pre-malignant colorectal lesions.

Supplementary Material

1

Acknowledgements

The authors thank the Microbiome and qRT-PCR Core of the Center for Gastrointestinal Biology and Disease (CGIBD) at UNC, especially Dr. M. Andrea Azcarate-Peril and Dr. M. Belen Cadenas from for providing laboratory space, training on equipment and technical assistance. We thank Ms. Carolyn Suitt for histology and Ms. Nikki McCoy for assistance with apoptosis assays. Statistical assistance by the CGIBD Biostatistics and Data Management Core is gratefully acknowledged.

Financial support: This research was supported by grants from the National Institute of Health P30 DK034987 (UNC Center for Gastrointestinal Biology and Disease) and R01s CA044684 (UNC Diet and Health Study V), CA136887 (T.O. Keku) and DK040247 (P.K. Lund), and UNC Dissertation Completion Fellowship (M.A. Santoro).

Footnotes

Conflict of interests: The authors declared no conflict of interests.

References

  • 1.Edwards BK, Ward E, Kohler BA, Eheman C, Zauber AG, Anderson RN, et al. Annual report to the nation on the status of cancer, 1975–2006, featuring colorectal cancer trends and impact of interventions (risk factors, screening, and treatment) to reduce future rates. Cancer. 2010;116:544–573. doi: 10.1002/cncr.24760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.U.S. Cancer Statistics Working Group. Atlanta, GA: U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, and National Cancer Institute; 2013. United States Cancer Statistics: 1999–2010 Incidence and Mortality Web-based Report. [Google Scholar]
  • 3.Giovannucci E. Metabolic syndrome, hyperinsulinemia, and colon cancer: a review. The American journal of clinical nutrition. 2007;86:s836–s842. doi: 10.1093/ajcn/86.3.836S. [DOI] [PubMed] [Google Scholar]
  • 4.Hillon P, Guiu B, Vincent J, Petit JM. Obesity, type 2 diabetes and risk of digestive cancer. Gastroenterol Clin Biol. 2010;34:529–533. doi: 10.1016/j.gcb.2010.07.021. [DOI] [PubMed] [Google Scholar]
  • 5.Siddiqui AA. Metabolic Syndrome and Its Association With Colorectal Cancer: A Review. The American Journal of the Medical Sciences. 2011;341:227–231. doi: 10.1097/MAJ.0b013e3181df9055. [DOI] [PubMed] [Google Scholar]
  • 6.Keku TO, Lund PK, Galanko J, Simmons JG, Woosley JT, Sandler RS. Insulin resistance, apoptosis, and colorectal adenoma risk. Cancer Epidemiol Biomarkers Prev. 2005;14:2076–2081. doi: 10.1158/1055-9965.EPI-05-0239. [DOI] [PubMed] [Google Scholar]
  • 7.Keku T, Sandler R, Simmons J, Galanko J, Woosley J, Proffitt M, et al. Local IGFBP-3 mRNA expression, apoptosis and risk of colorectal adenomas. BMC Cancer. 2008;8:143. doi: 10.1186/1471-2407-8-143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Vidal AC, Lund PK, Hoyo C, Galanko J, Burcal L, Holston R, et al. Elevated C-peptide and insulin predict increased risk of colorectal adenomas in normal mucosa. BMC Cancer. 2012;12:389. doi: 10.1186/1471-2407-12-389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Conover CA, Lee PD, Kanaley JA, Clarkson JT, Jensen MD. Insulin regulation of insulin-like growth factor binding protein-1 in obese and nonobese humans. Journal of Clinical Endocrinology & Metabolism. 1992;74:1355–1360. doi: 10.1210/jcem.74.6.1375600. [DOI] [PubMed] [Google Scholar]
  • 10.Calle EE, Kaaks R. Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat Rev Cancer. 2004;4:579–591. doi: 10.1038/nrc1408. [DOI] [PubMed] [Google Scholar]
  • 11.Simmons JG, Ling Y, Wilkins H, Fuller CR, D'Ercole AJ, Fagin J, et al. Cell-specific effects of insulin receptor substrate-1 deficiency on normal and IGF-I-mediated colon growth. American journal of physiology Gastrointestinal and liver physiology. 2007;293:G995–G1003. doi: 10.1152/ajpgi.00537.2006.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Belfiore A, Frasca F, Pandini G, Sciacca L, Vigneri R. Insulin receptor isoforms and insulin receptor/insulin-like growth factor receptor hybrids in physiology and disease. Endocr Rev. 2009;30:586–623. doi: 10.1210/er.2008-0047. [DOI] [PubMed] [Google Scholar]
  • 13.Gallagher EJ, LeRoith D. The proliferating role of insulin and insulin-like growth factors in cancer. Trends in endocrinology and metabolism: TEM. 2010;21:610–618. doi: 10.1016/j.tem.2010.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Belfiore A, Malaguarnera R. Insulin receptor and cancer. Endocrine-Related Cancer. 2011;18:R125–R147. doi: 10.1530/ERC-11-0074. [DOI] [PubMed] [Google Scholar]
  • 15.Pollak M. The insulin and insulin-like growth factor receptor family in neoplasia: an update. Nat Rev Cancer. 2012;12:159–169. doi: 10.1038/nrc3215. [DOI] [PubMed] [Google Scholar]
  • 16.Hursting SD. Obesity, energy balance, and cancer: a mechanistic perspective. Cancer treatment and research. 2014;159:21–33. doi: 10.1007/978-3-642-38007-5_2. [DOI] [PubMed] [Google Scholar]
  • 17.Valenciano AH-HL, Moreno M, Lloret M, Lara PC. Role of IGF-1 receptor in radiation response. Transl Oncol. 2012;5:1–9. doi: 10.1593/tlo.11265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Rosenzweig SA. Acquired resistance to drugs targeting receptor tyrosine kinases. Biochemical Pharmacology. 2012;83:1041–1048. doi: 10.1016/j.bcp.2011.12.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hakam A, Yeatman TJ, Lu L, Mora L, Marcet G, Nicosia SV, et al. Expression of insulin-like growth factor-1 receptor in human colorectal cancer. Human Pathology. 1999;30:1128–1133. doi: 10.1016/s0046-8177(99)90027-8. [DOI] [PubMed] [Google Scholar]
  • 20.Shan H-B, Zhang R, Li Y, Xu G-L, Luo G-Y, Gao X-Y, Yang H-L. Expression of IGF-1R in Colorectal Polyps and its Role in Colorectal Carcinogenesis. Technol Cancer Res Treat. 2011;10:381–389. doi: 10.7785/tcrt.2012.500215. [DOI] [PubMed] [Google Scholar]
  • 21.Karp DD, Pollak MN, Cohen RB, Eisenberg PD, Haluska P, Yin D, et al. Safety, pharmacokinetics, and pharmacodynamics of the insulin-like growth factor type 1 receptor inhibitor figitumumab (CP-751,871) in combination with paclitaxel and carboplatin. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2009;4:1397–1403. doi: 10.1097/JTO.0b013e3181ba2f1d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ewing GP, Goff LW. The Insulin-like Growth Factor Signaling Pathway as a Target for Treatment of Colorectal Carcinoma. Clinical Colorectal Cancer. 2010;9:219–223. doi: 10.3816/CCC.2010.n.032. [DOI] [PubMed] [Google Scholar]
  • 23.Buck E, Gokhale PC, Koujak S, Brown E, Eyzaguirre A, Tao N, et al. Compensatory insulin receptor (IR) activation on inhibition of insulin-like growth factor-1 receptor (IGF-1R): rationale for cotargeting IGF-1R and IR in cancer. Mol Cancer Ther. 2010;9:2652–2664. doi: 10.1158/1535-7163.MCT-10-0318. [DOI] [PubMed] [Google Scholar]
  • 24.Flanigan SA, Pitts TM, Eckhardt SG, Tentler JJ, Tan AC, Thorburn A, et al. The Insulin-like Growth Factor I Receptor/Insulin Receptor Tyrosine Kinase Inhibitor PQIP Exhibits Enhanced Antitumor Effects in Combination with Chemotherapy Against Colorectal Cancer Models. Clinical Cancer Research. 2010;16:5436–5446. doi: 10.1158/1078-0432.CCR-10-2054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ulanet DB, Ludwig DL, Kahn CR, Hanahan D. Insulin receptor functionally enhances multistage tumor progression and conveys intrinsic resistance to IGF-1R targeted therapy. Proceedings of the National Academy of Sciences of the United States of America. 2010;107:10791–10798. doi: 10.1073/pnas.0914076107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Anastassiadis T, Duong-Ly KC, Deacon SW, Lafontant A, Ma H, Devarajan K, et al. A highly selective dual insulin receptor (IR)/insulin-like growth factor 1 receptor (IGF-1R) inhibitor derived from an ERK inhibitor. Journal of Biological Chemistry. 2013;288:28068–28077. doi: 10.1074/jbc.M113.505032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Frasca F, Pandini G, Scalia P, Sciacca L, Mineo R, Costantino A, et al. Insulin receptor isoform A, a newly recognized, high-affinity insulin-like growth factor II receptor in fetal and cancer cells. Mol Cell Biol. 1999;19:3278–3288. doi: 10.1128/mcb.19.5.3278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Denley A, Wallace JC, Cosgrove LJ, Forbes BE. The Insulin Receptor Isoform Exon 11-(IR-A) in Cancer and Other Diseases: A Review. Horm Metab Res. 2003;35:778–785. doi: 10.1055/s-2004-814157. [DOI] [PubMed] [Google Scholar]
  • 29.Berlato C, Doppler W. Selective response to insulin versus insulin-like growth factor-I and -II and up-regulation of insulin receptor splice variant B in the differentiated mouse mammary epithelium. Endocrinology. 2009;150:2924–2933. doi: 10.1210/en.2008-0668. [DOI] [PubMed] [Google Scholar]
  • 30.Sciacca L, Mineo R, Pandini G, Murabito A, Vigneri R, Belfiore A. In IGF-I receptor-deficient leiomyosarcoma cells autocrine IGF-II induces cell invasion and protection from apoptosis via the insulin receptor isoform A. Oncogene. 2002;21:8240–8250. doi: 10.1038/sj.onc.1206058. [DOI] [PubMed] [Google Scholar]
  • 31.Andres SF, Simmons JG, Mah AT, Santoro MA, Van Landeghem L, Lund PK. Insulin receptor isoform switching in intestinal stem cells, progenitors, differentiated lineages and tumors: evidence that IR-B limits proliferation. Journal of cell science. 2013;126:5645–5656. doi: 10.1242/jcs.132985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Brierley GV, Macaulay SL, Forbes BE, Wallace JC, Cosgrove LJ, Macaulay VM. Silencing of the insulin receptor isoform A favors formation of type 1 insulin-like growth factor receptor (IGF-IR) homodimers and enhances ligand-induced IGF-IR activation and viability of human colon carcinoma cells. Endocrinology. 2010;151:1418–1427. doi: 10.1210/en.2009-1006. [DOI] [PubMed] [Google Scholar]
  • 33.Shen XJ, Rawls JF, Randall T, Burcal L, Mpande CN, Jenkins N, et al. Molecular characterization of mucosal adherent bacteria and associations with colorectal adenomas. Gut microbes. 2010;1:138–147. doi: 10.4161/gmic.1.3.12360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sanapareddy N, Legge RM, Jovov B, McCoy A, Burcal L, Araujo-Perez F, et al. Increased rectal microbial richness is associated with the presence of colorectal adenomas in humans. The ISME journal. 2012;6:1858–1868. doi: 10.1038/ismej.2012.43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.McCoy AN, Araujo-Perez F, Azcarate-Peril A, Yeh JJ, Sandler RS, Keku TO. Fusobacterium is associated with colorectal adenomas. PloS one. 2013;8:e53653. doi: 10.1371/journal.pone.0053653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kang M, Edmundson P, Araujo-Perez F, McCoy AN, Galanko J, Keku TO. Association of plasma endotoxin, inflammatory cytokines and risk of colorectal adenomas. BMC Cancer. 2013;13:91. doi: 10.1186/1471-2407-13-91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Rosenfeld RG, Dollar LA. Characterization of the somatomedin-C/insulin-like growth factor I (SM-C/IGF-I) receptor on cultured human fibroblast monolayers: regulation of receptor concentrations by SM-C/IGF-I and insulin. The Journal of clinical endocrinology and metabolism. 1982;55:434–440. doi: 10.1210/jcem-55-3-434. [DOI] [PubMed] [Google Scholar]
  • 38.Chi MM, Schlein AL, Moley KH. High insulin-like growth factor 1 (IGF-1) and insulin concentrations trigger apoptosis in the mouse blastocyst via down-regulation of the IGF-1 receptor. Endocrinology. 2000;141:4784–4792. doi: 10.1210/endo.141.12.7816. [DOI] [PubMed] [Google Scholar]
  • 39.Frasca F, Pandini G, Sciacca L, Pezzino V, Squatrito S, Belfiore A, et al. The role of insulin receptors and IGF-I receptors in cancer and other diseases. Arch Physiol Biochem. 2008;114:23–37. doi: 10.1080/13813450801969715. [DOI] [PubMed] [Google Scholar]
  • 40.Kahn CR, Neville DM, Roth J. Insulin-receptor interaction in the obese-hyperglycemic mouse: A model of insulin resistance. Journal of Biological Chemistry. 1973;248:244–250. [PubMed] [Google Scholar]
  • 41.Kosmakos FC, Roth J. Insulin-induced loss of the insulin receptor in IM-9 lymphocytes. A biological process mediated through the insulin receptor. Journal of Biological Chemistry. 1980;255:9860–9869. [PubMed] [Google Scholar]
  • 42.Kasuga M, Kahn CR, Hedo JA, Van Obberghen E, Yamada KM. Insulin-induced receptor loss in cultured human lymphocytes is due to accelerated receptor degradation. Proceedings of the National Academy of Sciences of the United States of America. 1981;78:6917–6921. doi: 10.1073/pnas.78.11.6917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Green A, Olefsky JM. Evidence for insulin-induced internalization and degradation of insulin receptors in rat adipocytes. Proceedings of the National Academy of Sciences of the United States of America. 1982;79:427–431. doi: 10.1073/pnas.79.2.427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Marshall S, Garvey WT, Geller M. Primary culture of isolated adipocytes. A new model to study insulin receptor regulation and insulin action. Journal of Biological Chemistry. 1984;259:6376–6384. [PubMed] [Google Scholar]
  • 45.Sell SM, Reese D, Ossowski VM. Insulin-inducible changes in insulin receptor mRNA splice variants. The Journal of biological chemistry. 1994;269:30769–30772. [PubMed] [Google Scholar]
  • 46.Huang Z, Bodkin NL, Ortmeyer HK, Hansen BC, Shuldiner AR. Hyperinsulinemia is associated with altered insulin receptor mRNA splicing in muscle of the spontaneously obese diabetic rhesus monkey. The Journal of clinical investigation. 1994;94:1289–1296. doi: 10.1172/JCI117447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kellerer M, Sesti G, Seffer E, Obermaier-Kusser B, Pongratz DE, Mosthaf L, et al. Altered pattern of insulin receptor isotypes in skeletal muscle membranes of type 2 (non-insulin-dependent) diabetic subjects. Diabetologia. 1993;36:628–632. doi: 10.1007/BF00404072. [DOI] [PubMed] [Google Scholar]
  • 48.Mosthaf L, Eriksson J, Haring HU, Groop L, Widen E, Ullrich A. Insulin receptor isotype expression correlates with risk of non-insulin-dependent diabetes. Proceedings of the National Academy of Sciences of the United States of America. 1993;90:2633–2635. doi: 10.1073/pnas.90.7.2633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Nikoshkov A, Sunkari V, Savu O, Forsberg E, Catrina SB, Brismar K. Epigenetic DNA methylation in the promoters of the Igf1 receptor and insulin receptor genes in db/db mice. Epigenetics : official journal of the DNA Methylation Society. 2011;6:405–409. doi: 10.4161/epi.6.4.14791. [DOI] [PubMed] [Google Scholar]
  • 50.Sciacca L, Costantino A, Pandini G, Mineo R, Frasca F, Scalia P, et al. Insulin receptor activation by IGF-II in breast cancers: evidence for a new autocrine/paracrine mechanism. Oncogene. 1999;18:2471–2479. doi: 10.1038/sj.onc.1202600. [DOI] [PubMed] [Google Scholar]
  • 51.Merritt AJ, Potten CS, Watson AJ, Loh DY, Nakayama K, Nakayama K, et al. Differential expression of bcl-2 in intestinal epithelia. Correlation with attenuation of apoptosis in colonic crypts and the incidence of colonic neoplasia. Journal of cell science. 1995;108(Pt 6):2261–2271. doi: 10.1242/jcs.108.6.2261. [DOI] [PubMed] [Google Scholar]
  • 52.Huang J, Morehouse C, Streicher K, Higgs BW, Gao J, Czapiga M, et al. Altered expression of insulin receptor isoforms in breast cancer. PloS one. 2011;6:e26177. doi: 10.1371/journal.pone.0026177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Heni M, Hennenlotter J, Scharpf M, Lutz SZ, Schwentner C, Todenhöfer T, et al. Insulin Receptor Isoforms A and B as well as Insulin Receptor Substrates-1 and-2 Are Differentially Expressed in Prostate Cancer. PloS one. 2012;7:e50953. doi: 10.1371/journal.pone.0050953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Law JH, Habibi G, Hu K, Masoudi H, Wang MYC, Stratford AL, et al. Phosphorylated Insulin-Like Growth Factor-I/Insulin Receptor Is Present in All Breast Cancer Subtypes and Is Related to Poor Survival. Cancer Research. 2008;68:10238–10246. doi: 10.1158/0008-5472.CAN-08-2755. [DOI] [PubMed] [Google Scholar]
  • 55.Gallagher EJ, Alikhani N, Tobin-Hess A, Blank J, Buffin NJ, Zelenko Z, et al. Insulin receptor phosphorylation by endogenous insulin or the insulin analog AspB10 promotes mammary tumor growth independent of the IGF-1 receptor. Diabetes. 2013;62:3553–3560. doi: 10.2337/db13-0249. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES