Abstract
The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ‘‘split-Cre’’ fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre) of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre) or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS) was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.
Introduction
The phage P1 Cre recombinase is a member of the tyrosine recombinase family and catalyzes site-specific DNA recombination between tandem 34-bp loxP DNA sequences [1], [2]. If two loxP sites are introduced in the same orientation into a genomic locus, Cre-mediated recombination will result in the deletion of the loxP-flanked DNA sequences. The Cre/loxP recombination system is a sophisticated tool for general knockouts, conditional knockouts and reporter strains, and has been widely used in a variety of organisms, including yeasts [3], [4], plants [5]–[9] and animals [1], [9]–[12]. In general, Cre recombinase is expressed under the control of a cell-or tissue-specific promoter to achieve targeted gene knockout in a spatial-temporal fashion [13]–[15]. However, it is not always facile to find a gene-specific promoter to control expression of the Cre recombinase specifically in a desired cell type.
Active protein can be cleaved into two inactive fragments which can directly re-associate to restore activity [16]–[18]. Cre recombinase consists of 343 amino acids that form two distinct domains. The N-terminal domain encompasses residues 20–129 and contains five α-helical segments linked by a series of short loops. The C-terminal domain contains amino acids 132–341 and harbors the active site of the enzyme [19]. Based on its protein structure, the Cre recombinase has previously been split into two complementation polypeptides at different break points such as Asn59/Asn60, Leu104/Arg106 and Gly190/Gly191[16], [20], [21], [22], [23], and the recombination activity could be reconstituted in vivo. In a previous report, Cre recombinase was divided into two independent polypeptides, a-NH2 terminal with the amino acids 19–59 and b-COOH terminal with the amino acids 60–343 [24]. When two fragments with overlapping amino acid sequences of the Cre gene were co-expressed, recombinase activity was restored even without the addition of dimerization modules [24], [25]. Maruo et al. (2008) systematically analyzed the efficiency of Cre complementation by screening multiple dimerization modules in Cos7 cells and primary neurons [26]. To improve the efficiency of split-Cre a-complementation, two inactive fragments were reconstituted by the leucine zipper domain dimerization [20]. However, reassembling split-Cre protein has not yet been reported in higher plants. In this study, we used the a-complementation approach to split Cre and introduce the two inactive fragments into transgenic tobacco (Nicotiana tabacum cv. Xanthi). Our experiments revealed that no recombination activity was detected in transgenic tobacco hair roots when individual N- or C-terminal fragments of Cre recombinase gene were expressed. While Cre enzyme activity was able to be restored in vivo when co-expressed these polypeptides. Therefore, we provide a new strategy for DNA recombination and gene expression regulation in plants.
Materials and Methods
Plant material and bacterial strains
Nicotiana tabacum cv. Xanthi was grown on Murashige and Skoog medium in a greenhouse under an 18/6h(light/dark)photoperiod at 25°C.
Escherichia coli strain DH5a was used as the recipient for transformation, genetic manipulation and production of plasmid DNA for sequencing. E. coli strain BL-21 (DE3) was used for protein expression. The disarmed Agrobacterium rhizogenes strain C58C1 was used for tobacco transformation.
Vector construction
The N- (amino acids 1–59) and C-terminal (aa 60–343) moieties of Cre recombinase [20], [21] and full-length Cre were amplified by PCR using primers NCre-F, NCre-R, CCre-F and CCre-R (listed in Table 1) with EcoRI and HindIII restriction sites at their 5′ ends. The NCre and CCre gene fragments were cloned into the multiple cloning sites of prokaryotic expression vector pMAL-C2X digested with the same enzymes, respectively. Cre gene fragment was cloned into prokaryotic expression vector pET-28a. All the recombinant plasmids were then transformed into host cells E. coli BL-21 (DE3).
Table 1. DNA oligo sequences utilizes in this report.
| Primer name | Primer sequence (5'-3') | Restriction enzyme site |
| NCre-F | cggaattcatgtccaatttactgaccgtac | EcoR I |
| NCre-R | cccaagcttctaattcaacttgcaccatgcc | Hind III |
| CCre-F | cggaattcatgaaccggaaatggtttcccg | EcoR I |
| CCre-R | cccaagcttctaatcgccatcttccagca | Hind III |
| pX6-NCre-F | gaagatctatgtccaatttactgaccgtac | Bgl II |
| pX6-NCre-R | catgggatccctaattcaacttgcaccatgcc | BamH I |
| pX6-NLS-NCre-F | gaagatctcccaagaagaagaggaaggtgatg | Bgl II |
| tccaatttactgaccgtac | ||
| pX6-CCre-F | atgaaccggaaatggtttcccg | / |
| pX6-CCre-R | ctaatcgccatcttccagca | / |
| pX6-NLS-CCre-F | atgcccaagaagaagaggaaggtgaaccggaa | / |
| atggtttcccg | ||
| pCa-F | gatgacgcacaatcccactatcc | / |
| pCa-R | gtacagactagttcgtcggttctg | / |
| F1 | cgggatccgaacgtgcaaaacaggctct | / |
To construct the plant binary vectors, we synthesized the loxP-nos-loxP fusion sequences by a commercial company (Huada, Shenzhen, China). Sequences were as follows:5′-CGGGATCCGCATAACTTCGTATAATGTATGCTATACGAAGTTATAGATCTTCCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG ATAACTTCGTATAATGTATGCTATACGAAGTTATGGATCCCG-3′. The bold letters represent the loxP site (34 bp) and the italic letters represent the NOS terminator sequence (253 bp). The underlined letters show the restriction enzyme sites: BamHI, BglII and BamHI, respectively. The BamHI-digested loxP-nos-loxP fragment was ligated to the binary vector pCAMBIA1305.1 which was digested with BglII, producing the vector ploxP. The NCre, CCre and full-length Cre fragments were amplified by PCR and inserted respectively into the vector pCXSN [27], respectively. And then the 35S-NCre-nos, 35S-CCre-nos, 35S-Cre-nos fusion gene segments were excised from the resulting pCXSN vectors with EcoRI/HindIII digestion and then ligated into the corresponding sites of the ploxP vector, producing the vectors pCre, pNCre and pCCre. To add an extra nuclear localization signal (NLS) sequence to N-terminus of Cre, NCre and CCre, the oligos (nNCre-F and nCCre-F) (Table 1) were utilized. PCR fragments were cloned into the ploxP vector to produce pnCre, pnNCre and pnCCre, respectively. To construct the vectors pCCre-nNCre and pnCCre-nNCre, the loxP-nNCre-loxP fusion gene fragment was amplified by PCR and ligated into the pCCre and pnCCre by digesting with BglII, respectively. All the plant binary vectors were introduced into the A. rhizogenes strain C58C1 via a simple freeze/thaw transformation method [28].
Expression and purification of proteins
The E. coli strain BL-21 (DE3) was transformed with expression vectors containing NCre, CCre and full length Cre proteins. A colony of the transformed cells was cultured in LB medium with ampicillin (100 µg/mL) at 37°C with 180 rpm until OD600 = 0.6. Protein expression was induced by isopropyl β-D-thiogalactoside (IPTG) at 0.1 mM. Incubation was continued to culture at 25°C with 180 rpm for 4 h before the bacteria were harvested by centrifugation. The cells were resuspended in phosphate buffered saline (PBS) after washing. Clear lysate was obtained after centrifugation because NCre, CCre and full length Cre proteins are expressed in the soluble fraction. The purity and relative concentrations of these proteins were examined by 12% SDS-PAGE [29], [30]. All of the purified proteins were stored at -80°C after adding glycerol with a 1∶1 ratio.
In vitro assays of recombination activity
In order to detect the recombination activity of purified proteins, including split-Cre (NCre and CCre) and full-length Cre, the plasmid ploxP-CCre629, in which a 1200-bp DNA fragment was flanked by two loxP recognition sites in the same orientation, was digested at 37°C for 1 h by the purified proteins. The reaction system was as follows: 1 µL 10 × Buffer L (TaKaRa, Dalian, China), 5 µL plasmid (90 ng/µL), 3 µL purified protein and 1 µL ddH2O, total 10 µL. As a control, the plasmid ploxP-CCre629 was also digested with HindIII and BamHI at 37°C for 1 h. The digested product was used for DNA electrophoresis.
Transformation of tobacco plants
A. rhizogenes strain C58C1 with the plant binary vectors was incubated in liquid YEP medium supplemented with 50 mg/L kanamycin and 40 mg/L rifampicin at 28°C and 180 rpm until the cultures reached an optimal density of approximately 0.6–0.8 at OD600 [31]. After centrifuged for 10 min at 4,000 rpm and 4°C,the cultures were resuspended with an equal volume of liquid MS medium (MS medium, 100 µmol/L acetosyringone; pH5.8) [32]. Tobacco transformation was performed using the leaf disc method as described previously [33]. After growing on the co-cultivation medium (MS medium, 100 µmol/L acetosyringone, 30 g/L sucrose, 6 g/L agar, pH5.8) in darkness at 25°C for 2 days, the leaf discs were transferred to a selective medium (MS medium, 10 mg/L hygromycin, 150 mg/L rifampicin, 30 g/L sucrose, 6 g/L agar, pH5.8) under a photoperiod of 16:8 (light:dark) h at 25°C.
GUS staining assay
Activity of β-glucuronidase (GUS) in transgenic hair roots was determined by a GUS histochemical staining assay [34]. Transgenic hair roots were placed in 1 mM X-gluc (5-bromo-4-choloro-3-indolyl-b-glucuronic acid) solution and incubated at 37°C overnight and was subsequently recorded photographically.
RNA extraction and reverse-transcriptase PCR (RT-PCR)
Total RNA of hair roots was extracted using TRIzol Reagent (Invitrogen, Beijing, China) according to the manufacturer's instructions. First-strand cDNA was synthesized from 1 µg of total RNA using PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). RT-PCR was performed as previously described for genomic PCR using gene-specific primers (Table 1) for different genes. Reaction products were resolved by electrophoresis in 1.5% agarose gel. A pair of specific primers for 18S of N. tabacum [35] were used in a control reaction.
DNA extraction and molecular analysis of transgenic plants
Genomic DNA was extracted from transgenic and untransformed control hair roots using the modified CTAB extraction method as described previously [36]. Putative transgenic hair roots were screened preliminarily to confirm the presence of the transgenes by PCR method [37]. Two gene-specific primers pCa-F and pCa-R (Table 1), which flanked two loxP sites, were designed for detection of transgene excision. PCR was conducted at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 56°C for 30 s, 72°C for 1 min, and a final extension step at 72°C for 10 min. The PCR products were loaded on 1% (w/v) agarose gel and visualized after ethidium bromide staining. The PCR fragment was cloned into pMD19 vector (TaKaRa, Dalian, China) and sequenced by Beijing Genomics Institute.
Results
In vitro assays for recombination activity of split-Cre complementation
To establish a split-Cre complementation system, the coding sequence of Cre recombinase was cleaved into two complementation-competent fragments, named NCre (amino acids residues 1-59) and CCre (amino acids residues 60-343) (Fig. 1A), according to previous reports [20], [21]. These split-Cre- and Cre-genes were cloned into the expression vector pMAL-C2X and pET-28a (Novagen) and recombinase proteins were produced in reticulocyte lysates. Under the induction of isopropyl β-D-thiogalactoside (IPTG), Split-Cre and full-length Cre proteins were purified to detect the recombination activity (Fig. S1). In vitro excision recombination reactions were conducted using linear fragments from ploxP-CCre629 as substrates (Fig. 1B). The substrates were recombined equally well when full-length Cre or both NCre and CCre were supplied (Fig. 1C). Interestingly, successful recombination was also detected in the reaction when CCre protein was used alone. While there was no related reports stating the recombination activity of CCre protein in vitro, and no recombination activity was detected in vivo in previous studies. In contrast, no recombination activity was found when only NCre was added (Fig. 1C), consistent with a previous in vivo study in the brain of transgenic mice [20], [21].
Figure 1. Digram of the split-Cre model and in vitro recombination of Split-Cre protein.

A: Digram of the split-Cre model. The intact Cre was designed to be split at the 60th amino acid residue. Two molecules of split-Cre were named NCre and CCre respectively. B: Structure of the substrate catalyzed by purified protein. C: Recombination assay of Split-Cre protein in vitro . M: DL5000 Marker; Plasmid: 2µl plasmid (90 ng/µl) of pLoxp-Ic-CCre629. The plasmid was respectively digested by HindIII and BamHI (H+B), split protein NCre (NCre), split protein CCre (CCre), combination of split protein NCre and CCre (NCre + CCre), intact protein Cre (Cre) and MBP. Plasmid and MBP were used as negative control, H+B digestions were used as positive control. MBP tag was used to purify fusion proteins.
Functional complementation of split-Cre in transgenic tobacco hairy roots
We constructed a series of plant expression vectors for split-Cre complementation system (Fig. 2A). The plant expression vector pCAMBIA1305.1 [38], in which the E. coli gusA gene has been replaced by GUSPlus, served as an empty control. These recombinant plasmids carrying the split-Cre and full-length Cre genes were generated based on the pCAMBIA1305.1 vector. The gene cassette ploxP containing nos terminator sequences flanked by two 34-bp loxP sites in direct orientation, was used as a negative control. pCre and pnCre, containing full-length Cre and NLS-fused Cre driven by the CaMV 35S promoter served as positive controls. The schematic diagrams of all plant binary vectors were showed in Fig. 2A. The gene cassettes pNCre and pnNCre contained NCre and NLS-fused NCre, whereas pCCre and pnCCre contained CCre and NLS-fused CCre, respectively. The gene cassette pCCre-nNCre carried CCre and NLS-fused NCre. In the gene cassette pnCCre-nNCre, a NLS was fused into N terminus of the CCre and NCre genes, respectively.
Figure 2. The in vivo recombination of split-Cre protein and the deletions determined by GUS activity.

A: Digram of plant expression vectors. pCambia refer to vector of pCambia1305.1. B: GUS staining of transgenic hair roots for each transformant. “n” represents nuclear localization signal. The following are all the same.
All of the recombinant plasmids were introduced into tobacco plants by A. rhizogenes-mediated transformation. The hair roots of N. tabacum transformants with hygromycin resistance were subjected to GUS staining assay. To characterize the excision efficiency of each recombination event, we used the GUS-positive ratio to calculate the excision efficiency. Table 2 showed the total number of transgenic events analyzed for each gene cassette and the number of GUS-positive roots. As showed in Fig. 2B, no GUS activity was observed in transgenic lines harboring ploxP, pNCre, pnNCre, pCCre and pnCCre, indicating that each half (NCre and CCre) of split Cre alone, even fused with an extra NLS, did not have any recombinase activity in vivo. In contrast, all transgenic hair roots containing pCCre-nNCre and pnCCre-nNCre displayed blue (Fig. 2B), indicating that recombination activity of Cre is present in these transgenic plants. Transgenic lines harboring the binary vectors pCAMBIA1305.1, pCre and pnCre also showed GUS activity as expected (Fig. 2B). The results demonstrated that recombination activity of intact Cre protein could be reconstituted in vivo when both N- and C-terminal fragments of Cre recombinase were co-expressed, whereas no recombination activity was observed when either NCre or CCre was expressed alone.
Table 2. GUS positive ratio of different transgenic tobacco hair roots.
| Vectors | GUS (+) No. of roots (Blue) | GUS (-) No. Of roots (White) | Total | GUS positive ratio (%) |
| pCAMBIA1305.1 | 121 | 0 | 121 | 100 |
| pCA-Cre | 64 | 66 | 130 | 49.2 |
| pCA-nCre | 77 | 52 | 129 | 59.7 |
| pCA-CCre-nNCre | 63 | 74 | 137 | 46.0 |
| pCA-nCCre-nNCre | 90 | 44 | 134 | 67.2 |
| pCA-LoxP | 0 | 49 | 49 | 0 |
| pCA-NCre | 0 | 53 | 53 | 0 |
| pCA-nNCre | 0 | 46 | 46 | 0 |
| pCA-CCre | 0 | 57 | 57 | 0 |
| pCA-nCCre | 0 | 61 | 61 | 0 |
To determine whether the split-Cre genes were indeed expressed in the hairy roots of transgenic tobacco, we used gene-specific primers to perform RT-PCR analysis. The expected DNA fragments of split-Cre recombinase were detected in these tested transformants containing pnNCre and pnCCre vectors (Fig. 3A). The 18S rRNA complementary primers were used as an internal control. No transcripts were found in wild-type plants. Two specific PCR-amplified products for NCre and CCre were obtained in transgenic lines harboring pCCre-nNCre and pnCCre-nNCre (Fig. 3B), indicating that all the split-Cre genes transformed into transgenic tobacco plants were constitutively expressed, at least on the transcriptional level, resulting in the successful deletion of the transgene fragments flanked by two loxp sites.
Figure 3. Analysis of CCre and NCre transcription in transgenic hairy roots. Semi-quantitative RT-PCR analysis of the transcription level of CCre or NCre in transformants carrying pnCCre or pnNCre (A) and pCCre-nNCre or pnCCre-nNCre (B).
Tobacco 18S was used as an internal control. Total RNA was isolated from roots. Numbers represent the different lines of each recombinant.
Molecular characterization of site-specific DNA excision in transgenic hairy roots
The transgene excision from hairy roots of transgenic tobacco was confirmed by PCR analysis. The genomic DNA samples extracted from different transgenic lines were used as templates for detecting the excision events. Transgenic lines carrying pCre, pnCre, pCCre-nNCre and pnCCre-nNCre vectors showed visible post-excision signals (369 bp amplification fragments) (Fig. 4B), compared to the pre-excision signals in transgenic lines pCre and pnCre (664 bp amplification fragments) and in transgenic lines pCCre-nNCre and pnCCre-nNCre (862 bp amplification fragments), respectively. No excision events were observed in transgenic lines harboring pNCre, pnNCre, pCCre, pnCCre and ploxP vectors (Fig. 4A).
Figure 4. The recombinant splite-Cre excises DNA fragment between two Loxp sties in vivo. Vallidation of the non-excision (A) and excision (B) of DNA fragment in hairy roots.
The amplified fragments of non-excision was 862 bp and 664bp for pNCre, pnNCre and pCCre, pnCCre, respectively. The amplified fragments of post-excision was 369 bp, while the pre-excision was 862 bp and 664 bp for pCCre-nNCre, pnCCre-nNCre and pCre, pnCre, respectively. M: DL2000 Marker; P, pre-excision signal; E, post-excision signal. pCambia and ploxP were used as control. C: Schematic illustration of deletion in pCCre-nNCre and the sequencing result after deletion of DNA fragment.
Furthermore, DNA sequencing analysis revealed that the 369-bp amplification products consisted of a single loxP site and the junction T-DNA sequences located outside two loxP repeats (Fig. 4C). This result further confirmed that excision events did occur in transgenic lines pCCre-nNCre and pnCCre-nNCre, thus demonstrating that split-Cre fragments can rebuild recombination activity in vivo when co-expressed in plants.
Determination of excision efficiency in the transgenic events
To examine the excision efficiency of each recombinant, we analyzed the GUS positive ratio in transgenic hair roots. As shown in Fig. 5, transgenic plants containing pCAMBIA1305.1 showed strong GUS activity, whereas for transgenic lines hosting ploxP (no recombinase gene included), or pNCre, pnNCre, pCCre and pnCCre, in which each half (NCre and CCre) of split Cre was contained alone, we observed a negative GUS staining as expected. In contrast, transgenic plants hosting pCCre-nNCre (both the NCre and CCre genes expressed simultaneously) had average GUS-positive ratio of 46.0% based on a total of 137 independent transgenic events. The similar GUS-positive ratio (49.2%) was obtained in transgenic plants hosting pCre (containing the intact Cre gene). Furthermore, we found that a higher GUS positive ratio was generated in transgenic plants harboring pnCre (59.7%) and pnCCre-nNCre (67.2%) (Fig. 5), in which the nuclear localization signal (NLS) of the simian virus 40 large T antigen (SV40) was fused at the amino terminus of Cre recombinase, indicating that the NLS sequence can improve the localization of Cre recombinase to the nucleus, resulting in increasing excision efficiency by building the Cre cassette. The results demonstrated that co-expression of NCre and CCre leads to the efficient reconstitution of Cre recombinase from two inactive precursor fragments in transgenic plants.
Figure 5. Excision ratio in the transgenic hairy roots determined by GUS staining.

The ratio of GUS-positive roots was used to calculate the excision efficiencies for each transgenic line. pCAMBIA1305.1 was used as a positive control, while ploxP as a negative one. WT also used as a negative control here. All data is presented as mean of three replicates with error bars indicating ± SD.
Discussion
The Cre/loxP recombination system has been intensively used in genetic analysis of animals and higher plants [1], [5]-[11]. One main challenge for this system is to control the expression of Cre gene in spatially and temporally desirable manners. To regulate Cre activity, in general, its expression is under the control of a cell-type specific promoter [7], [8]. However, the expression pattern of a single promoter activity is often insufficient to achieve accurate results. To overcome this limitation, split-Cre systems based on the structure of Cre recombinase have been reported previously [19], [22]. In these systems, Cre protein was generally cleaved into two complementation-competent fragments at the breakpoints in the N-terminal domain and each of these split-Cre proteins expressed alone had no enzymatic activity. But the inactive Cre moieties readily reconstituted into a functional enzyme with recombination activity when co-expressed in transgenic animals [20], [21]. In this study, the split-Cre proteins were reassembled in transgenic plants when co-expressed (Fig. 2 and 4) and the recombination efficiency was comparable to that of intact Cre recombinase (Fig. 5). However, no Cre recombination activity was detected when either NCre or CCre gene was expressed alone (Fig. 5).
The Cre/loxP system contains two elements: the Cre recombinase and two consensus sequences (loxP sites) [39]. Previous studies have reported that the C-terminal domain of the Cre recombinase harbors the active site, consisting of the conserved catalytic residues Arg173, His289, Arg292 and Trp315 [19], [40]. Furthermore, using chimeras of the Flp and Cre recombinases, Shaikh and Sadowski (2000) [41] demonstrated that the C-terminal domain of the Cre recombinase determined their mode of cleavage. In the present study, in vitro assays showed that NCre protein (aa 1-59) used alone was unable to catalyze DNA recombination (Fig. 1). In contrast, surprisingly, site-specific recombination events were observed when only CCre protein (the amino acid 60–343) was expressed. Previous work has shown that although a C-terminal peptide of Cre recombinase with 25 kDa still binds the loxP sites, but it is not able to catalyze the site-specific recombination [42]. Therefore, we speculated that, when lacking the small N-terminal of Cre recombinase, the presence of C-terminal domain of Cre proteins with more than 25 kDa did not affect the in vitro enzymatic activity of recombination.
The Cre recombinase catalyzed the site-specific recombination at two loxP sites which were located in the genomes, therefore, it has to be imported into the nucleus. Since the 38 kDa Cre protein is smaller than the ∼50 kDa upper size limit imposed by the nuclear pore on passive diffusion of macromolecules into the nucleus [43], it is hypothesized that Cre proteins enter into the nucleus by passive diffusion through the nuclear pore [44]. However, it has been reported that even small nuclear proteins of eukaryotes are more easy to gain entry to the nucleus when carrying specific nuclear localization signals (NLSs) [45]. Previous studies have demonstrated that fusing NLS sequences can effectively increase Cre recombinase activity [18], [46]. In this study, we determined the effect of NLS on the recombination activity in the split-Cre proteins. An NLS sequence from the SV40 virus was fused into the N-terminals of the NCre and CCre genes (Fig. 2). The NLS-NCre and NLS-CCre had no recombination activity in transgenic plants (Fig. 5). However, the in vivo recombination of the NLS-NCre and NLS-CCre proteins had higher activity compared to the wild-type Cre.
Concluding Remarks
This study provides an alternative strategy for regulation of gene expression by site-specific recombination using the split-Cre recombinase complementation approach in plants. This system has wide application prospects in plant functional genomics and genetic engineering. In general, most of plant genes are expressed in different tissues and developmental stages. The split-Cre recombinase system allows spatial and temporal regulation of recombination through cell-specific gene genetic targeting by the simultaneous activity of two promoters in plants. In addition, a potential application of the split-Cre recombinase system is to control transgenes (i.e. selectable markers and novel trait genes) activation or removal them from transgenic plants, producing trait- or marker transgene-free transgenic crops.
Supporting Information
Prokaryotic expression and purification of split- and full-length Cre protein. M, Protein marker. Lane 1:Induced NCre; Lane 2: Non-induced NCre; Lane 3: Induced CCre; Lane 4: Non-induced CCre; Lanes 5-6: Induced and Non-induced MBP protein as control; Lanes 7–9: Purified protein of NCre、 CCre and MBP; Lanes 10–11: Induced and Non-induced Cre; Lane 12: Purified Cre.
(TIF)
Acknowledgments
The authors thank Professor Guoliang Wang (Hunan Agricultural University, Changsha 410128, China) for providing the plant binary vector pCXSN.
Data Availability
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work was supported by the National Natural Science Foundation of China (31370672, 31171620), the National Key Project for Research on Transgenic Plant (2011ZX08010-003), 100 Talents Programme of The Chinese Academy of Sciences, the Natural Science Foundation Project of CQ CSTC (CSTC2013JJB8007), the program for New Century Excellent Talents in University (NCET-11-0700), the Fundamental Research Funds for the Central Universities (XDJK2014a005). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Sauer B, Henderson N (1988) Site-Specific DNA Recombination in Mammalian-Cells by the Cre Recombinase of Bacteriophage-P1. Proceedings of the National Academy of Sciences of the United States of America 85: 5166–5170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Sternberg N (1981) Bacteriophage-P1 Site-Specific Recombination.3. Strand Exchange during Recombination at Lox Sites. Journal of Molecular Biology 150: 603–608. [DOI] [PubMed] [Google Scholar]
- 3. Delneri D, Tomlin GC, Wixon JL, Hutter A, Sefton M, et al. (2000) Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene 252: 127–135. [DOI] [PubMed] [Google Scholar]
- 4.Gueldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH (2002) A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Research 30. [DOI] [PMC free article] [PubMed]
- 5. Srivastava V, Ow DW (2003) Rare instances of Cre-mediated deletion product maintained in transgenic wheat. Plant Molecular Biology 52: 661–668. [DOI] [PubMed] [Google Scholar]
- 6. Sreekala C, Wu L, Gu K, Wang D, Tian D, et al. (2005) Excision of a selectable marker in transgenic rice (Oryza sativa L.) using a chemically regulated Cre/loxP system. Plant Cell Reports 24: 86–94. [DOI] [PubMed] [Google Scholar]
- 7. Luo KM, Duan H, Zhao DG, Zheng XL, Deng W, et al. (2007) 'GM-gene-deletor': fused loxP-FRT recognition sequences dramatically improve the efficiency of FLP or CRE recombinase on transgene excision from pollen and seed of tobacco plants. Plant Biotechnology Journal 5: 263–274. [DOI] [PubMed] [Google Scholar]
- 8. Bai XQ, Wang QY, Chu CC (2008) Excision of a selective marker in transgenic rice using a novel Cre/loxP system controlled by a floral specific promoter. Transgenic Research 17: 1035–1043. [DOI] [PubMed] [Google Scholar]
- 9. Schwenk F, Baron U, Rajewsky K (1995) A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic Acids Research 23: 5080–5081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Hayashi S, McMahon AP (2002) Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: A tool for temporally regulated gene activation/inactivation in the mouse. Developmental Biology 244: 305–318. [DOI] [PubMed] [Google Scholar]
- 11. Pan XF, Wan HY, Chia W, Tong Y, Gong ZY (2005) Demonstration of site-directed recombination in transgenic zebrafish using the Cre/loxP system. Transgenic Research 14: 217–223. [DOI] [PubMed] [Google Scholar]
- 12. Miller AJ, Dudley SD, Tsao JL, Shibata D, Liskay RM (2008) Tractable Cre-lox system for stochastic alteration of genes in mice. Nature Methods 5: 227–229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Mantamadiotis T, Lemberger T, Bleckmann SC, Kern H, Kretz O, et al. (2002) Disruption of CREB function in brain leads to neurodegeneration. Nature Genetics 31: 47–54. [DOI] [PubMed] [Google Scholar]
- 14. Kellendonk C, Opherk C, Anlag K, Schutz G, Tronche F (2000) Hepatocyte-specific expression of Cre recombinase. Genesis 26: 151–153. [DOI] [PubMed] [Google Scholar]
- 15. Tsien JZ, Chen DF, Gerber D, Tom C, Mercer EH, et al. (1996) Subregion- and cell type-restricted gene knockout in mouse brain. Cell 87: 1317–1326. [DOI] [PubMed] [Google Scholar]
- 16. Han XZ, Han FY, Ren XS, Si J, Li CQ, et al. (2013) Ssp DnaE split-intein mediated split-Cre reconstitution in tobacco. Plant Cell Tissue and Organ Culture 113: 529–542. [Google Scholar]
- 17. Gu W, Schneider JW, Condorelli G, Kaushal S, Mahdavi V, et al. (1993) Interaction of Myogenic Factors and the Retinoblastoma Protein Mediates Muscle-Cell Commitment and Differentiation. Cell 72: 309–324. [DOI] [PubMed] [Google Scholar]
- 18. Kellendonk C, Tronche F, Monaghan AP, Angrand PO, Stewart F, et al. (1996) Regulation of cre recombinase activity by the synthetic steroid RU 486. Nucleic Acids Research 24: 1404–1411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Guo F, Gopaul DN, VanDuyne GD (1997) Structure of Cre recombinase complexed with DNA in a site-specific recombination synapse. Nature 389: 40–46. [DOI] [PubMed] [Google Scholar]
- 20.Hirrlinger J, Scheller A, Hirrlinger PG, Kellert B, Tang WN, et al.. (2009) Split-Cre Complementation Indicates Coincident Activity of Different Genes In Vivo. Plos One 4. [DOI] [PMC free article] [PubMed]
- 21. Hirrlinger J, Requardt RP, Winkler U, Wilhelm F, Schulze C, et al. (2009) Split-CreERT2: temporal control of DNA recombination mediated by split-Cre protein fragment complementation. Plos One 4: e8354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Jullien N, Sampieri F, Enjalbert A, Herman JP (2003) Regulation of Cre recombinase by ligand-induced complementation of inactive fragments. Nucleic Acids Research 31. [DOI] [PMC free article] [PubMed]
- 23.Xu YW, Xu G, Liu BD, Gu GQ (2007) Cre reconstitution allows for DNA recombination selectively in dual-marker-expressing cells in transgenic mice. Nucleic Acids Research 35. [DOI] [PMC free article] [PubMed]
- 24. Casanova E, Lemberger T, Fehsenfeld S, Mantamadiotis T, Schutz G (2003) alpha complementation in the Cre recombinase enzyme. Genesis 37: 25–29. [DOI] [PubMed] [Google Scholar]
- 25. Seidi A, Mie M, Kobatake E (2007) Novel recombination system using Cre recombinase alpha complementation. Biotechnology Letters 29: 1315–1322. [DOI] [PubMed] [Google Scholar]
- 26. Maruo T, Ebihara T, Satou E, Kondo S, Okabe S (2008) Cre complementation with variable dimerizers for inducible expression in neurons. Neuroscience Research 61: S279–S279. [PubMed] [Google Scholar]
- 27. Chen SB, Songkumarn P, Liu JL, Wang GL (2009) A Versatile Zero Background T-Vector System for Gene Cloning and Functional Genomics. Plant Physiology 150: 1111–1121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chen H, Nelson RS, Sherwood JL (1994) Enhanced Recovery of Transformants of Agrobacterium-Tumefaciens after Freeze-Thaw Transformation and Drug Selection. Biotechniques16: : 664–&. [PubMed] [Google Scholar]
- 29. Wu Y, Zhou Y, Song J, Hu X, Ding Y, et al. (2008) Using green and red fluorescent proteins to teach protein expression, purification, and crystallization. Biochemistry and Molecular Biology Education 36: 43–54. [DOI] [PubMed] [Google Scholar]
- 30. Roodveldt C, Tawfik DS (2005) Directed evolution of phosphotriesterase from Pseudomonas diminuta for heterologous expression in Escherichia coli results in stabilization of the metal-free state. Protein Engineering Design & Selection 18: 51–58. [DOI] [PubMed] [Google Scholar]
- 31. Chen C, Dale MC, Okos MR (1990) Minimal Nutritional-Requirements for Immobilized Yeast. Biotechnology and Bioengineering 36: 993–1001. [DOI] [PubMed] [Google Scholar]
- 32. Murashige T, Skoog F (1962) A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiologia Plantarum 15: 473–497. [Google Scholar]
- 33. Fraley RT, Rogers SG, Horsch RB (1986) Genetic-Transformation in Higher-Plants. Crc Critical Reviews in Plant Sciences 4: 1–46. [Google Scholar]
- 34.Jefferson RA, Kavanagh TA, Bevan MW (1987) Beta-Glucuronidase (Gus) as a Sensitive and Versatile Gene Fusion Marker in Plants. Journal of Cellular Biochemistry: 57–57. [DOI] [PMC free article] [PubMed]
- 35. Kenton A, Khashoggi A, Parokonny A, Bennett MD, Lichtenstein C (1995) Chromosomal Location of Endogenous Geminivirus-Related DNA-Sequences in Nicotiana-Tabacum-L. Chromosome Research 3: 346–350. [DOI] [PubMed] [Google Scholar]
- 36. Porebski S, Bailey LG, Baum BR (1997) Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15: 8–15. [Google Scholar]
- 37. Luo KM, Zheng XL, Chen YQ, Xiao YH, Zhao DG, et al. (2006) The maize Knotted1 gene is an effective positive selectable marker gene for Agrobacterium-mediated tobacco transformation. Plant Cell Reports 25: 403–409. [DOI] [PubMed] [Google Scholar]
- 38. Yang SM, Tang F, Gao MQ, Krishnan HB, Zhu HY (2010) R gene-controlled host specificity in the legume-rhizobia symbiosis. Proceedings of the National Academy of Sciences of the United States of America 107: 18735–18740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Abremski K, Hoess R, Sternberg N (1983) Studies on the Properties of P1 Site-Specific Recombination - Evidence for Topologically Unlinked Products Following Recombination. Cell 32: 1301–1311. [DOI] [PubMed] [Google Scholar]
- 40. Van Duyne GD (2001) A structural view of Cre-loxP site-specific recombination. Annual Review of Biophysics and Biomolecular Structure 30: 87–104. [DOI] [PubMed] [Google Scholar]
- 41. Shaikh AC, Sadowski PD (2000) Chimeras of the Flp and Cre recombinases: Tests of the mode of cleavage by Flp and Cre. Journal of Molecular Biology 302: 27–48. [DOI] [PubMed] [Google Scholar]
- 42. Hoess R, Abremski K, Irwin S, Kendall M, Mack A (1990) DNA Specificity of the Cre Recombinase Resides in the 25 Kda Carboxyl Domain of the Protein. Journal of Molecular Biology 216: 873–882. [DOI] [PubMed] [Google Scholar]
- 43. Peters R (1983) Nuclear-Envelope Permeability Measured by Fluorescence Microphotolysis of Single Liver-Cell Nuclei. Journal of Biological Chemistry 258: 1427–1429. [PubMed] [Google Scholar]
- 44. Sauer B (1987) Functional Expression of the Cre-Lox Site-Specific Recombination System in the Yeast Saccharomyces-Cerevisiae. Molecular and Cellular Biology 7: 2087–2096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Dingwall C, Laskey RA (1991) Nuclear Targeting Sequences - a Consensus. Trends in Biochemical Sciences 16: 478–481. [DOI] [PubMed] [Google Scholar]
- 46. Gu H, Zou YR, Rajewsky K (2013) Independent Control of Immunoglobulin Switch Recombination at Individual Switch Regions Evidenced through Cre-loxP-Mediated Gene Targeting. Journal of Immunology 191: 7–16. [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Prokaryotic expression and purification of split- and full-length Cre protein. M, Protein marker. Lane 1:Induced NCre; Lane 2: Non-induced NCre; Lane 3: Induced CCre; Lane 4: Non-induced CCre; Lanes 5-6: Induced and Non-induced MBP protein as control; Lanes 7–9: Purified protein of NCre、 CCre and MBP; Lanes 10–11: Induced and Non-induced Cre; Lane 12: Purified Cre.
(TIF)
Data Availability Statement
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files.


