Skip to main content
NCBI home page
Journal of the American Society of Nephrology : JASN logoLink to Journal of the American Society of Nephrology : JASN
. 2014 Apr 10;25(11):2539–2545. doi: 10.1681/ASN.2013121327

osr1 Is Required for Podocyte Development Downstream of wt1a

Ritu Tomar *, Sudha P Mudumana *, Narendra Pathak *, Neil A Hukriede †, Iain A Drummond *,‡,✉
PMCID: PMC4214536  PMID: 24722440

Abstract

Odd-skipped related 1 (Osr1) encodes a zinc finger transcription factor required for kidney development. Osr1 deficiency in mice results in metanephric kidney agenesis, whereas knockdown or mutation studies in zebrafish revealed that pronephric nephrons require osr1 for proximal tubule and podocyte development. osr1-deficient pronephric podocyte progenitors express the Wilms’ tumor suppressor wt1a but do not undergo glomerular morphogenesis or express the foot process junctional markers nephrin and podocin. The function of osr1 in podocyte differentiation remains unclear, however. Here, we found by double fluorescence in situ hybridization that podocyte progenitors coexpress osr1 and wt1a. Knockdown of wt1a disrupted podocyte differentiation and prevented expression of osr1. Blocking retinoic acid signaling, which regulates wt1a, also prevented osr1 expression in podocyte progenitors. Furthermore, unlike the osr1-deficient proximal tubule phenotype, which can be rescued by manipulation of endoderm development, podocyte differentiation was not affected by altered endoderm development, as assessed by nephrin and podocin expression in double osr1/sox32-deficient embryos. These results suggest a different, possibly cell- autonomous requirement for osr1 in podocyte differentiation downstream of wt1a. Indeed, osr1-deficient embryos did not exhibit podocyte progenitor expression of the transcription factor lhx1a, and forced expression of activated forms of the lhx1a gene product rescued nephrin expression in osr1-deficient podocytes. Our results place osr1 in a framework of transcriptional regulators that control the expression of podocin and nephrin and thereby mediate podocyte differentiation.

The major function of the kidney is to filter blood and maintain tissue fluid homeostasis. Podocytes are terminally differentiated cells of the glomerulus that surround blood capillaries with interdigitating foot processes to form specialized intercellular junctions called slit diaphragms that prevent loss of macromolecules from blood into the urinary space.1,2 Mutations in genes encoding podocyte slit diaphragm proteins, such as nephrin, podocin, CD2AP, protocadherin FAT, and P-cadherin, result in effacement of foot processes, proteinuria, and kidney failure.3–9 Thus, differentiated podocytes have an essential role in maintaining the integrity of the glomerular blood filtration barrier, and loss of podocyte differentiation by injury or congenital defect results in kidney disease. However, the pathways leading to podocyte differentiation are not well understood.

Odd skipped related 1 (osr1) is one of the earliest genes expressed in the intermediate mesoderm and plays an essential role in kidney and heart organogenesis.10 Osr1 belongs to the Odd skipped family of genes, which encode evolutionarily conserved zinc-finger transcription factors required for embryonic development.11,12 In Drosophila, the odd skipped gene, odd, was first identified as a pair rule gene on the basis of the finding that mutations at this locus cause loss of portions of the odd-numbered segments in the embryo.11 odd was shown to be required for leg development and also for malpighian tubule development, the renal organs of Drosophila.11,13 Homologs of odd have been cloned in mice and humans. The mice osr homolog Osr1 is first expressed in the early intermediate mesoderm, which gives rise to all renal structures, and later is expressed in developing limb and branchial arches of embryo.10,12 Homozygous Osr1 null mutants fail to form intermediate mesoderm and die in utero with cardiac defects and renal agenesis.10 In humans, mutations in OSR1 have yet to be associated with kidney agenesis; however, a variant OSR1 allele, which disturbs OSR1 mRNA expression in renal progenitor cells, has been associated with reduction of newborn kidney size and function.14 The zebrafish odd homolog osr1 is first expressed in the early mesendoderm and later in a broad domain of lateral plate/intermediate mesoderm.15 Knockdown experiments in zebrafish have also revealed a role for osr1 in pronephric development. osr1-deficient embryos display loss of proximal tubule and a stage-specific arrest of glomerular morphogenesis. osr1 plays an indirect role in proximal tubule development by repressing endoderm differentiation, which, in turn, favors proximal tubule formation.15 However, it is not known how osr1 functions in podocyte differentiation.

In the current work we have investigated the role of osr1 in podocyte differentiation and provide evidence that osr1 regulates podocyte differentiation by acting downstream of wt1a, most likely in a cell autonomous manner. Significantly, we find that the transcription factor lhx1a is required downstream of osr1 for nephrin expression and podocyte differentiation. Our results place osr1 in a network of transcriptional regulators (RA → wt1a → osr1 → lhx1a → [podocin/nephrin]) that mediate podocyte differentiation.

Results

osr1 and wt1a Are Coexpressed in Zebrafish Podocyte Progenitor Cells

We have shown previously that osr1-deficient embryos fail to form a functional pronephric glomerulus and do not express markers of the differentiated glomerular podocytes podocin and nephrin.15 To assess how osr1 might fit in the sequence of events leading to podocyte differentiation, we compared expression of osr1 with expression of known podocyte markers. The Wilms’ tumor suppressor wt1a marks podocyte differentiation and is first expressed in bilateral clusters of cells in the anterior intermediate mesoderm, adjacent to somites 1–316 (Figure 1A). At the same stage of development, whole-mount in situ hybridization revealed that osr1 is expressed in similar cells as wt1a (Figure 1A). Histologic sections further suggested that osr1 (Figure 1B) and wt1a (Figure 1C) were coexpressed in anterior intermediate mesoderm. Double fluorescent in situ hybridization in conjunction with confocal microscopy confirmed that wt1a and osr1 were coexpressed in podocyte progenitors (Figure 1, D–I). These results suggest that defects in kidney glomerular differentiation in osr1-deficient embryos may be due to an early, cell-autonomous requirement for osr1 in podocyte progenitors.

Figure 1.

Figure 1.

Open in a new tab

osr1 and wt1a are coexpressed in podocyte progenitors. (A) Expression of wt1a and osr1 in anterior intermediate mesoderm in a zebrafish embryo at 16 high-power field. Dashed lines (b, c) denote planes of section in B and C. (B and C) Cross-sections of embryos showing the expression domains of wt1a (B) and osr1 (C) in anterior intermediate mesoderm (arrowheads). (D and E) Wt1a and osr1 have overlapping expression domains in presumptive podocyte progenitors in the anterior intermediate mesoderm. Dual color fluorescent in situ hybridization of wt1a (green; D and G) and osr1 (red; E and H) respectively at 16 high-power fields. Wt1a is expressed in intermediate mesoderm (dotted box g and white arrowheads in D) in the same cells as osr1 (dotted box h in E). (F) Merge of E and F showing coexpression of wt1a and osr1 (dotted box, white arrowheads) in anterior intermediate mesoderm. (G–I) Magnified views of single 6-µm confocal sections of boxed regions in D–F show wt1a expression (G), osr1 expression (H), and coexpression of wt1a and osr1 (I) in cells of anterior mesoderm. Dotted lines represent the scale of a single cell in G–I; scale bar in I=10 µm. Nuclei are stained with 4′,6-diamidino-2-phenylindole (blue).

osr1 Is Required for Podocyte Development Downstream of wt1a

Coexpression of wt1a and osr1 in podocyte progenitors and loss of podocyte marker expression in both osr1- and wt1a-deficient embryos15,17 suggested that these two transcription factors could act together or sequentially in podocyte differentiation. osr1 is not required for expression of wt1a,15 but it is not known whether expression of wt1a is required for osr1 expression in podocyte progenitors. Morpholino knockdown of both wt1a and its paralog wt1b (Figure 2, A–C) caused loss of expression of podocyte markers, podocin (Figure 2, D and E) and nephrin (Figure 2, F and G), consistent with the known requirement for wt1 in podocyte development.18 Significantly, wt1a/b knockdown also eliminated osr1 expression, specifically in podocyte progenitors, but not in endoderm (Figure 3, A–D). wt1a is a retinoic acid–regulated gene, and inhibition of local generation of retinoic acid, using retinoic acid–synthesizing (RALDH) enzymes inhibitor diethylaminobenzaldehyde (DEAB), blocks expression of wt1a.19 Here we show that DEAB treatment also prevented expression of osr1 (Figure 3, E and F), consistent with a requirement for wt1a in osr1 expression. Together, these results suggest a sequential induction of wt1a by retinoic acid and subsequent wt1a-dependent induction of osr1 in podocyte progenitors, ultimately leading to podocyte differentiation and expression of the structural genes nephrin and podocin.

Figure 2.

Figure 2.

Open in a new tab

wt1a/b knockdown results in loss of podocyte nephrin and podocin expression. (A) wt1a and wt1b gene structure and position of a single morpholino oligo that targets exon 8 splice donor (MOexon8d) (red) in both wt1 paralogs. (B and C) RT-PCR analysis of (MOexon8d) induced mis-splicing of both wt1a and wt1b reveals exon skipping in wt1a (B; arrowhead denotes PCR product lacking exon 8) and intron inclusion in wt1b (C; arrowhead denotes PCR product including intron 8). (D and E) Expression of podocin (arrowheads) in control and wt1ex8d morphants at 48 high-power fields (hpf). podocin expression is lost in wt1ex8d MO injected embryos. (F and G) Expression of slc4a2a (proximal tubules) and nephrin (podocytes) in control embryos (F) and wt1ex8d MO-injected embryos (G) at 48 hpf. nephrin expression (G) is lost (white arrowhead) in wt1ex8d MO-injected embryos. UTR, untranslated region.

Figure 3.

Figure 3.

Open in a new tab

wt1a/b knockdown results in loss of osr1 expression in podocyte progenitors. (A and B) Expression of osr1 in intermediate mesoderm podocyte progenitors in control (A) and wt1a/b morphants (B) at 18 high-power fields. osr1 expression is absent from podocyte progenitors (white arrowheads) but persists in endoderm of wt1a/b morphants. (C and D) Cross-sections of A and B at the level indicated (dotted lines in A and B) show that expression of osr1 is absent in podocyte progenitors (black arrowheads) in wt1a/b morphants but persists in endoderm (white arrowhead). (E) osr1 expression in podocyte progenitors in control embryos treated with DMSO. (F) Loss of osr1 expression in podocyte progenitors of embryos treated with the differential expression of retinoic acid–synthesizing inhibitor 4-diethylaminobenzaldehyde.

osr1 Regulates Zebrafish Podocyte and Kidney Tubule Development by Distinct Mechanisms

Previously we found that osr1-deficient embryos lack kidney proximal tubules and show expanded vascular development. Loss of proximal tubules is caused indirectly by an early effect of osr1 deficiency that expands endoderm development.15 We therefore tested whether podocyte differentiation and glomerular morphogenesis might similarly be inhibited by endoderm signals, using sox32 morpholino knockdown to prevent endoderm expansion in osr1-deficient embryos. At 48 high-power fields, wt1a marks podocytes that form a compact glomerular structure at the embryo midline in wild-type embryos (Figure 4A). Glomerular morphogenesis is blocked in osr1 morphants where wt1a-positive podocytes persist as scattered, lateral groups of cells (Figure 4B). In contrast to its effect of restoring proximal tubule development in osr1-deficient embryos (Figure 4, D–F),15 sox32 knockdown did not restore midline glomerular morphogenesis (Figure 4C). Similarly, sox32 knockdown did not restore nephrin (Figure 4, G–I) or podocin (Figure 4, J–L) expression in osr1-deficient embryos, indicating that the function of osr1 in podocytes is distinct from its role in proximal tubule development. These results suggest that osr1 may regulate podocyte development cell autonomously, as part of a transcriptional cascade.

Figure 4.

Figure 4.

Open in a new tab

osr1 is required downstream of wt1 for glomerular development. (A–C) Expression of wt1a in control, osr1 morphants, and osr1/sox32 double morphants, respectively, at 48 high-power fields. wt1a-expressing podocyte progenitors coalesce at midline in control embryos (A) but not in osr1 morphants (B) or osr1/sox32 double morphants (C). (D–F) Expression of slc4a2a and nephrin in control (D), osr1 morphants (E), and osr1/sox32 double morphants (F) at 48 high-power fields. osr1 knockdown resulted in loss of nephrin expression and absence of proximal tubules (E). Double knockdown of osr1/ sox32 rescued proximal tubules but not nephrin expression (F). (G–I) nephrin expression in control (G), osr1 morphants (H), and osr1/sox32 double morphants (I). nephrin expression is lost in osr1 morphants (H) and not restored in osr1/ sox32 double morphants (I). (J–L) podocin expression in control (J), osr1 morphants (K), and osr1/sox32 double morphants (L). podocin expression is lost in osr1 morphants (K) and not restored in osr1/sox32 double morphants (L).

lhx1a Acts Downstream of osr1 to Regulate Podocyte Cell Differentiation

The LIM homeodomain transcription factor Lhx1a is required for podocyte differentiation during mouse kidney development.20 In zebrafish, lhx1a is expressed transiently in early podocyte progenitors, subsequent to wt1a and osr1 expression and before expression of podocin and nephrin (Figure 5A).21 Interestingly, we found that osr1 knockdown completely eliminated lhx1a expression specifically in the presumptive anterior pronephric region of intermediate mesoderm in 15 high-power fields embryos (Figure 5B; n=15/15), while lhx1a expression in the tail bud of osr1 morphants remained unaltered (data not shown). We therefore tested whether lhx1a might act downstream of osr1 specifically in podocyte development by assaying whether expression of an activated form of Lhx1a (Ldb1-Lhx1; denoted LL-CA)22 could rescue podocyte differentiation in osr1 morphants. The Lim homeodomain of Lhx1a interacts with the LIM binding protein, Ldb, and this interaction triggers Lhx1a activation.22 We expressed a constitutively active Ldb1-Lhx1 protein (LL-CA), which is a fusion of the Ldb1 dimerization domain with the linker, C-terminal and homeodomain of zebrafish Lhx1a.22 High doses of LL-CA mRNA (320 pg) caused early embryonic lethality associated with failed gastrulation cell movements, consistent with the known role for Lhx1a in gastrulation.23 An optimized injection dose (100 pg) allowed for 20% survival of embryos to 3 days post fertilization (n=11/50), allowing us to test whether activated Lhx1a could restore nephrin expression in osr1 morphants. Compared with osr1 morphants alone that never showed differentiated podocytes marked by nephrin expression (Figure 5D; 0%, n=0/30), 40% of surviving osr1 morphants coinjected with activated LL-CA mRNA showed rescue of nephrin expression in podocytes (Figure 5E; n=4/10). This partial rescue of podocyte differentiation (nephrin expression) suggests that lhx1a is required downstream of osr1 in podocyte development. Taken together, our results indicate that osr1 is part of an essential transcriptional cascade driving podocyte differentiation and glomerular morphogenesis.

Figure 5.

Figure 5.

Open in a new tab

osr1 acts via lhx1a to regulate nephrin expression. (A and B) Expression of lhx1a in podocyte progenitors in the anterior intermediate mesoderm in control (A) and osr1 morphants (B; arrows). Lhx1a expression is lost in osr1 morphants. (C) nephrin expression in control, (D) in osr1 morphants alone, (E) in osr1 morphants with forced expression of the activated lhx1a construct LL-CA. nephrin expression is lost in osr1 morphants and restored upon forced expression of activated lhx1a.

Discussion

Podocytes are complex cells whose differentiation depends on the interplay of multiple transcription factors, including Wt1a, Foxc1/2, Hey1, Notch, Lmx1b, MafB, and GA-binding protein.24–27 However, the network of the transcription factors that govern podocyte differentiation remains incomplete. Our findings show that osr1 is coexpressed with wt1a in podocyte progenitors, pointing to a novel role for osr1 in early podocyte differentiation. In the mouse, Osr1 is expressed early in the intermediate mesoderm and later in metanephric cap mesenchyme.28 The kidney agenesis phenotype observed in Osr1 knockout mice points to a role for Osr1 in maintaining the self-renewing, proliferative metanephric nephron stem cell population.10 In the absence of data on Osr1 conditional knockouts, it is not known whether Osr1 may have additional roles later in kidney morphogenesis and cell type differentiation. In zebrafish, the pronephros develops directly from intermediate mesoderm,29 bypassing a requirement for a self-renewing kidney mesenchyme and allowing for direct examination of the roles of kidney transcription factors in renal cell type differentiation.

Coexpression of osr1 with wt1a in the zebrafish intermediate mesoderm raises the possibility that these two transcription factors could be working synergistically or sequentially for podocyte differentiation. Our previous studies showed that wt1a expression is not dependent on osr1.15 Conversely, here we show that osr1 expression is absent in wt1a morphants, demonstrating that osr1 is downstream of wt1a and regulated directly or indirectly by wt1a in podocyte progenitors. osr1 expression was also absent in DEAB-treated embryos, suggesting a role for retinoic acid (RA) in osr1 expression. Early specification of renal progenitor cells is known to require RA signals from the axial/paraxial mesoderm.30–36 Consistent with this, the kidney progenitor cell field is expanded upon ectopic application of RA, and renal progenitor specification is inhibited by blocking the RA pathway.19,36,37 Regulatory elements in the wt1a locus contain retinoic acid responsive cis-elements, emphasizing a direct role for retinoic acid signaling in wt1a expression.38 Additionally, it has been shown that RA-deficient embryos fail to express wt1a in the intermediate mesoderm, whereas RA-treated embryos show increased wt1a expression.19 Given these findings, loss of osr1 expression in DEAB treated embryos is probably due to loss of wt1a expression, although it remains possible that RA signaling could also have a direct role in osr1 expression.

Loss of osr1 function blocked expression of the podocyte terminal differentiation markers nephrin and podocin. In screening candidate transcription factors that might act as mediators of osr1 in podocyte terminal differentiation, we found that lhx1a expression was also lost in osr1 morphants. Lhx1a (lim1) is a LIM homeo-domain–containing transcription factor involved in protein-protein interactions as opposed to DNA binding.21,39,40 In mice, Lhx1a acts cell autonomously at multiple stages of metanephric kidney development. In chimeric Lhx1a-deficient embryos, it was shown that Lhx1a null cells could not contribute to tissue that later formed glomerular podocytes.20 Our finding that lhx1a expression is lost in the intermediate mesoderm of osr1-deficient embryos places lhx1a downstream of osr1. Further, our finding that ectopic expression of an activated lhx1a fusion protein at least partially rescued podocyte differentiation in osr1 morphants indicates that lhx1a is a downstream mediator of osr1 in podocyte differentiation.

In summary, our results demonstrate that osr1 is not required for initial specification of podocytes but rather acts after wt1a as an effector of podocyte differentiation. Alternatively, it remains possible that wt1a may be required for activation of osr1 and then both work synergistically to activate downstream target genes required for podocyte differentiation. Further studies examining direct binding of transcription factors to osr1 regulatory elements will be required to establish the hierarchy of regulators responsible for podocyte differentiation. Moreover, further studies on deletion of Osr1 at later stages of mice kidney development using Osr1 conditional knockout mice41 will provide more insight into molecular pathways required for glomerular morphogenesis.

Concise Methods

Zebrafish Embryos

Wild-type zebrafish were maintained according to established protocols.42 The embryos for experiments were collected from crosses of wild-type Tü/AB adults, grown at 28°C and fixed at the indicated developmental stages.

Whole-Mount In Situ Hybridization

The plasmid constructs used in this work to synthesize antisense RNA probes for wt1a,34 Osr1,15 podocin,2 nephrin,2 slc4a2a,43 and lhx1a have been previously described. For rescue experiments, synthetic capped active lhx1a-ldb1 mRNAs was synthesized from Not1 linearized pCS2+_LLCA plasmid using SP6 polymerase mMessage Machine kit (Ambion).22 Whole-mount in situ hybridization was performed on embryos of different stages using antisense RNA probes labeled with digoxigenin or fluorescein (Boehringer Ingelheim, Mannheim, Germany) as described previously.44 Stained embryos were fixed, cleared with dimethylformamide transferred into PBS:glycerol (1:1), and photographed on a Leica MZ12 or Nikon E800 microscope equipped with Spot Image digital camera. Double fluorescent in situ hybridization was performed as described previously (S. Holley, Yale University, New Haven, CT, personal communication).45,46 Stained embryos were dehydrated in methanol, cleared with 2:1 benzyl benzoate:benzyl alcohol, and examined with a Zeiss LSM5 Pascal-confocal microscope. All images were processed using Adobe Photoshop software.

Morpholino Design, Microinjections, and Molecular Analysis

Morpholino oligonucleotides were designed to target the splice donor site of exon8 of the wt1a gene, which targeted both zebrafish wt1 paralogs and resulted in skipping of exon8 in wt1a mRNA and inclusion of intron8 in wt1b mRNA. osr1 morpholinos oligonucleotides targeted the splice donor site of exon2 as described previously.15

The following morpholino oligonucleotides were used in this study: (1) osr1ex2d: ATCTCATCCTTACCTGTGGTCTCTC and (2) wt1exon8d: TTACGCACTTGTTTTACCTGTATGT

Morpholino oligonucleotides were diluted in 100 mM KCl, 10 mM HEPES, and 0.1% phenol red (Sigma-Aldrich), and 4.6 nl was injected to each embryo using a Nanoject2000 Microinjector (World Precision Instruments, Sarasota, FL). Injection concentration used in the study is 0.5 mM for wt1exon8d morpholino and 0.2 mM for Osr1ex2d. Efficiency of morpholino splicing was confirmed by RT-PCR. In RA inhibitor experiments, DEAB was dissolved in DMSO and applied to embryos at 5 µM at the shield stage.

Histology

For histologic analysis after in situ hybridization of embryos, embryos were fixed in 4% P paraformaldehyde FA in PBS at 4°C overnight followed by dehydration in an ethanol:PBS series. Dehydrated embryos were embedded in JB-4 glycolmethacrylate resin (Polysciences, Warrington, PA) and sectioned to a thickness of 5 μm using a LEICA RM 2165 rotary microtome.

Disclosures

None.

Acknowledgments

The authors acknowledge the support of the Massachusetts General Hospital fish facility staff and technical support from Ms. Yan Liu. This work was supported by the National Institutes of Health grant R01-DK071041 to I.A.D., 2R01-DK069403 to N.A.H., K01-DK078741 to N.P., and the American Heart Association postdoctoral fellowship 0625923T to S.P.M.

Footnotes

Published online ahead of print. Publication date available at www.jasn.org.

References

  • 1.Pavenstädt H, Kriz W, Kretzler M: Cell biology of the glomerular podocyte. Physiol Rev 83: 253–307, 2003 [DOI] [PubMed] [Google Scholar]
  • 2.Kramer-Zucker AG, Wiessner S, Jensen AM, Drummond IA: Organization of the pronephric filtration apparatus in zebrafish requires Nephrin, Podocin and the FERM domain protein Mosaic eyes. Dev Biol 285: 316–329, 2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ciani L, Patel A, Allen ND, ffrench-Constant C: Mice lacking the giant protocadherin mFAT1 exhibit renal slit junction abnormalities and a partially penetrant cyclopia and anophthalmia phenotype. Mol Cell Biol 23: 3575–3582, 2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Roselli S, Moutkine I, Gribouval O, Benmerah A, Antignac C: Plasma membrane targeting of podocin through the classical exocytic pathway: Effect of NPHS2 mutations. Traffic 5: 37–44, 2004 [DOI] [PubMed] [Google Scholar]
  • 5.Roselli S, Heidet L, Sich M, Henger A, Kretzler M, Gubler MC, Antignac C: Early glomerular filtration defect and severe renal disease in podocin-deficient mice. Mol Cell Biol 24: 550–560, 2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Huber TB, Simons M, Hartleben B, Sernetz L, Schmidts M, Gundlach E, Saleem MA, Walz G, Benzing T: Molecular basis of the functional podocin-nephrin complex: Mutations in the NPHS2 gene disrupt nephrin targeting to lipid raft microdomains. Hum Mol Genet 12: 3397–3405, 2003 [DOI] [PubMed] [Google Scholar]
  • 7.Putaala H, Soininen R, Kilpeläinen P, Wartiovaara J, Tryggvason K: The murine nephrin gene is specifically expressed in kidney, brain and pancreas: Inactivation of the gene leads to massive proteinuria and neonatal death. Hum Mol Genet 10: 1–8, 2001 [DOI] [PubMed] [Google Scholar]
  • 8.Kestilä M, Lenkkeri U, Männikkö M, Lamerdin J, McCready P, Putaala H, Ruotsalainen V, Morita T, Nissinen M, Herva R, Kashtan CE, Peltonen L, Holmberg C, Olsen A, Tryggvason K: Positionally cloned gene for a novel glomerular protein—nephrin—is mutated in congenital nephrotic syndrome. Mol Cell 1: 575–582, 1998 [DOI] [PubMed] [Google Scholar]
  • 9.Shih NY, Li J, Karpitskii V, Nguyen A, Dustin ML, Kanagawa O, Miner JH, Shaw AS: Congenital nephrotic syndrome in mice lacking CD2-associated protein. Science 286: 312–315, 1999 [DOI] [PubMed] [Google Scholar]
  • 10.Wang Q, Lan Y, Cho ES, Maltby KM, Jiang R: Odd-skipped related 1 (Odd 1) is an essential regulator of heart and urogenital development. Dev Biol 288: 582–594, 2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hart MC, Wang L, Coulter DE: Comparison of the structure and expression of odd-skipped and two related genes that encode a new family of zinc finger proteins in Drosophila. Genetics 144: 171–182, 1996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.So PL, Danielian PS: Cloning and expression analysis of a mouse gene related to Drosophila odd-skipped. Mech Dev 84: 157–160, 1999 [DOI] [PubMed] [Google Scholar]
  • 13.Tena JJ, Neto A, de la Calle-Mustienes E, Bras-Pereira C, Casares F, Gómez-Skarmeta JL: Odd-skipped genes encode repressors that control kidney development. Dev Biol 301: 518–531, 2007 [DOI] [PubMed] [Google Scholar]
  • 14.Zhang Z, Iglesias D, Eliopoulos N, El Kares R, Chu L, Romagnani P, Goodyer P: A variant OSR1 allele which disturbs OSR1 mRNA expression in renal progenitor cells is associated with reduction of newborn kidney size and function. Hum Mol Genet 20: 4167–4174, 2011 [DOI] [PubMed] [Google Scholar]
  • 15.Mudumana SP, Hentschel D, Liu Y, Vasilyev A, Drummond IA: odd skipped related1 reveals a novel role for endoderm in regulating kidney versus vascular cell fate. Development 135: 3355–3367, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bollig F, Mehringer R, Perner B, Hartung C, Schäfer M, Schartl M, Volff JN, Winkler C, Englert C: Identification and comparative expression analysis of a second wt1 gene in zebrafish. Dev Dyn 235: 554–561, 2006 [DOI] [PubMed] [Google Scholar]
  • 17.Perner B, Englert C, Bollig F: The Wilms tumor genes wt1a and wt1b control different steps during formation of the zebrafish pronephros. Dev Biol 309: 87–96, 2007 [DOI] [PubMed] [Google Scholar]
  • 18.Guo JK, Menke AL, Gubler MC, Clarke AR, Harrison D, Hammes A, Hastie ND, Schedl A: WT1 is a key regulator of podocyte function: Reduced expression levels cause crescentic glomerulonephritis and mesangial sclerosis. Hum Mol Genet 11: 651–659, 2002 [DOI] [PubMed] [Google Scholar]
  • 19.Wingert RA, Selleck R, Yu J, Song H-D, Chen Z, Song A, Zhou Y, Thisse B, Thisse C, McMahon AP, Davidson AJ: The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephros. PLoS Genet 3: 1922–1938, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kobayashi A, Kwan KM, Carroll TJ, McMahon AP, Mendelsohn CL, Behringer RR: Distinct and sequential tissue-specific activities of the LIM-class homeobox gene Lim1 for tubular morphogenesis during kidney development. Development 132: 2809–2823, 2005 [DOI] [PubMed] [Google Scholar]
  • 21.Toyama R, Dawid IB: lim6, a novel LIM homeobox gene in the zebrafish: Comparison of its expression pattern with lim1. Dev Dyn 209: 406–417, 1997 [DOI] [PubMed] [Google Scholar]
  • 22.Cirio MC, Hui Z, Haldin CE, Cosentino CC, Stuckenholz C, Chen X, Hong SK, Dawid IB, Hukriede NA: Lhx1 is required for specification of the renal progenitor cell field. PLoS ONE 6: e18858, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hukriede NA, Tsang TE, Habas R, Khoo PL, Steiner K, Weeks DL, Tam PP, Dawid IB: Conserved requirement of Lim1 function for cell movements during gastrulation. Dev Cell 4: 83–94, 2003 [DOI] [PubMed] [Google Scholar]
  • 24.O’Brien LL, Grimaldi M, Kostun Z, Wingert RA, Selleck R, Davidson AJ: Wt1a, Foxc1a, and the Notch mediator Rbpj physically interact and regulate the formation of podocytes in zebrafish. Dev Biol 358: 318–330, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.White JT, Zhang B, Cerqueira DM, Tran U, Wessely O: Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus. Development 137: 1863–1873, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sadl V, Jin F, Yu J, Cui S, Holmyard D, Quaggin S, Barsh G, Cordes S: The mouse Kreisler (Krml1/MafB) segmentation gene is required for differentiation of glomerular visceral epithelial cells. Dev Biol 249: 16–29, 2002 [DOI] [PubMed] [Google Scholar]
  • 27.Ristola M, Arpiainen S, Shimokawa T, Ra C, Tienari J, Saleem MA, Holthofer H, Lehtonen S: Regulation of nephrin gene by the Ets transcription factor, GA-binding protein. Nephrol Dial Transplant 28: 846–855, 2013 [DOI] [PubMed] [Google Scholar]
  • 28.James RG, Kamei CN, Wang Q, Jiang R, Schultheiss TM: Odd-skipped related 1 is required for development of the metanephric kidney and regulates formation and differentiation of kidney precursor cells. Development 133: 2995–3004, 2006 [DOI] [PubMed] [Google Scholar]
  • 29.Drummond IA, Davidson AJ: Zebrafish kidney development. Methods Cell Biol 100: 233–260, 2010 [DOI] [PubMed] [Google Scholar]
  • 30.James RG, Schultheiss TM: Patterning of the avian intermediate mesoderm by lateral plate and axial tissues. Dev Biol 253: 109–124, 2003 [DOI] [PubMed] [Google Scholar]
  • 31.Guillaume R, Bressan M, Herzlinger D: Paraxial mesoderm contributes stromal cells to the developing kidney. Dev Biol 329: 169–175, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Mauch TJ, Yang G, Wright M, Smith D, Schoenwolf GC: Signals from trunk paraxial mesoderm induce pronephros formation in chick intermediate mesoderm. Dev Biol 220: 62–75, 2000 [DOI] [PubMed] [Google Scholar]
  • 33.Herzlinger D: Inductive interactions during kidney development. Semin Nephrol 15: 255–262, 1995 [PubMed] [Google Scholar]
  • 34.Serluca FC, Fishman MC: Pre-pattern in the pronephric kidney field of zebrafish. Development 128: 2233–2241, 2001 [DOI] [PubMed] [Google Scholar]
  • 35.Mendelsohn C, Lohnes D, Décimo D, Lufkin T, LeMeur M, Chambon P, Mark M: Function of the retinoic acid receptors (RARs) during development (II). Multiple abnormalities at various stages of organogenesis in RAR double mutants. Development 120: 2749–2771, 1994 [DOI] [PubMed] [Google Scholar]
  • 36.Cartry J, Nichane M, Ribes V, Colas A, Riou JF, Pieler T, Dollé P, Bellefroid EJ, Umbhauer M: Retinoic acid signalling is required for specification of pronephric cell fate. Dev Biol 299: 35–51, 2006 [DOI] [PubMed] [Google Scholar]
  • 37.Wingert RA, Davidson AJ: The zebrafish pronephros: A model to study nephron segmentation. Kidney Int 73: 1120–1127, 2008 [DOI] [PubMed] [Google Scholar]
  • 38.Bollig F, Perner B, Besenbeck B, Köthe S, Ebert C, Taudien S, Englert C: A highly conserved retinoic acid responsive element controls wt1a expression in the zebrafish pronephros. Development 136: 2883–2892, 2009 [DOI] [PubMed] [Google Scholar]
  • 39.Toyama R, O’Connell ML, Wright CV, Kuehn MR, Dawid IB: Nodal induces ectopic goosecoid and lim1 expression and axis duplication in zebrafish. Development 121: 383–391, 1995 [DOI] [PubMed] [Google Scholar]
  • 40.Dawid IB, Toyama R, Taira M: LIM domain proteins. C R Acad Sci III 318: 295–306, 1995 [PubMed] [Google Scholar]
  • 41.Lan Y, Liu H, Ovitt CE, Jiang R: Generation of Osr1 conditional mutant mice. Genesis 49: 419–422, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Westerfield M: The Zebrafish Book, Eugene, OR, University of Oregon Press, 1995 [Google Scholar]
  • 43.Shmukler BE, Kurschat CE, Ackermann GE, Jiang L, Zhou Y, Barut B, Stuart-Tilley AK, Zhao J, Zon LI, Drummond IA, Vandorpe DH, Paw BH, Alper SL: Zebrafish slc4a2/ae2 anion exchanger: cDNA cloning, mapping, functional characterization, and localization. Am J Physiol Renal Physiol 289: F835–F849, 2005 [DOI] [PubMed] [Google Scholar]
  • 44.Thisse B, Heyer V, Lux A, Alunni V, Degrave A, Seiliez I, Kirchner J, Parkhill JP, Thisse C: Spatial and temporal expression of the zebrafish genome by large-scale in situ hybridization screening. Methods Cell Biol 77: 505–519, 2004 [DOI] [PubMed] [Google Scholar]
  • 45.Jülich D, Hwee Lim C, Round J, Nicolaije C, Schroeder J, Davies A, Geisler R, Lewis J, Jiang YJ, Holley SA, Tübingen 2000 Screen Consortium : Beamter/deltaC and the role of Notch ligands in the zebrafish somite segmentation, hindbrain neurogenesis and hypochord differentiation. Dev Biol 286: 391–404, 2005 [DOI] [PubMed] [Google Scholar]
  • 46.Liu Y, Pathak N, Kramer-Zucker A, Drummond IA: Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros. Development 134: 1111–1122, 2007 [DOI] [PubMed] [Google Scholar]

Articles from Journal of the American Society of Nephrology : JASN are provided here courtesy of American Society of Nephrology

RESOURCES