Crystallization and preliminary X-ray diffraction data of β-galactosidase from Aspergillus niger

β-Galactosidase from A. niger has been expressed in S. cerevisiae, purified and crystallized in its deglycosylated form. X-ray data have been collected to 1.8 Å resolution.

Abstract

β-Galactosidase from Aspergillus niger (An-β-Gal), belonging to the family 35 glycoside hydrolases, hydrolyzes the β-galactosidase linkages in lactose and other galactosides. It is extensively used in industry owing to its high hydrolytic activity and safety. The enzyme has been expressed in yeasts and purified by immobilized metal-ion affinity chromatography for crystallization experiments. The recombinant An-β-Gal, deglycosylated to avoid heterogeneity of the sample, has a molecular mass of 109 kDa. Rod-shaped crystals grew using PEG 3350 as the main precipitant agent. A diffraction data set was collected to 1.8 Å resolution.

1. Introduction  

The enzyme β-d-galactosidase (EC 3.2.1.23) catalyzes the hydrolysis of terminal nonreducing β-d-galactose residues in β-d-galactosides. It has mainly been used for the hydrolysis of lactose in milk and other dairy products. Furthermore, β-galactosidases have transgalactosylation activities that make them very attractive for the production of prebiotic galactooligosaccharides (GOS). The β-d-galactosidase from the fungus Aspergillus niger (An-β-Gal) is one of the most used enzymes in the food industry. Its high optimal temperature allows its use at up to 323 K (Panesar et al., 2006 ▶), which makes it very valuable for industrial applications such as the synthesis of GOS. Moreover, reported work (Dragosits et al., 2014 ▶) has showed that its enzymatic activity is higher than that corresponding to other β-galactosidases from the Aspergillus genus. It also seems to tolerate fairly high amounts of organic solvents, which is an important trait in some transglycosylation-based applications using antibiotics or PEG (Dragosits et al., 2014 ▶). Furthermore, A. niger is an organism that has been designated GRAS (generally recognized as safe) by the American Food and Drug Administration (Schuster et al., 2002 ▶). Unfortunately, the too acidic optimum pH of An-β-Gal largely limits its applications in milk and neutral sweet cheese whey derived from hard cheese manufacturing (Rubio-Texeira, 2006 ▶).

Despite the wide use of An-β-Gal in the dairy industry, its three-dimensional structure has not been solved. An-β-Gal encoded by the laca gene belongs to family 35 of glycoside hydrolases (GH35), which contains most of the eukaryotic β-galactosidases. The three-dimensional structures of those from Penicillium sp., Trichoderma reesei, A. oryzae and Homo sapiens have previously been reported (Rojas et al., 2004 ▶; Maksimainen et al., 2011 ▶, 2013 ▶; Ohto et al., 2012 ▶).

Knowledge of the molecular structure of An-β-Gal is necessary to fully understand its particular enzymatic activities and to improve its biotechnological potential. In this study, we describe the purification protocol used to overproduce the enzyme in Saccharomyces cerevisiae, the crystallization of its deglycosylated form and a preliminary X-ray crystallographic analysis.

2. Materials and methods  

2.1. Macromolecule production  

The lacA gene was amplified by PCR and cloned by homologous recombination in S. cerevisiae. The 30 first nucleotides of the sequence (signal peptide) were not cloned. The final construct was expressed grown in 400 ml YPHSM medium [1.5%(w/v) glucose, 3%(v/v) glycerol, 1%(w/v) yeast extract and 8%(w/v) peptone] at 303 K and 250 rev min⁻¹ for 72 h in a 2 l Erlenmeyer flask. Cells were collected by centrifugation (11 800g for 10 min at 277 K) and the extracellular medium was filtered through a 0.45 µm disposable syringe filter (Macherey-Nagel). The collected supernatants were applied onto an affinity chromatography system using a HisTrap HP 5 ml column coupled to an ÄKTAprime (GE Healthcare) that had been equilibrated with buffer A (100 mM sodium phosphate buffer, 500 mM NaCl, 25 mM imidazole pH 7). The column was equilibrated in buffer A and after sample injection it was washed with ten column volumes of the same buffer. The protein was then eluted with buffer B (100 mM sodium phosphate buffer, 500 mM NaCl, 500 mM imidazole pH 7). The protein solution was concentrated to 2 ml by ultrafiltration with Amicon Ultra-4 (Millipore). The homogeneity of the purified protein was evaluated by SDS–PAGE (Laemmli, 1970 ▶). Macromolecule-production details are given in Table 1 ▶.

Table 1. An--Gal production information.

Primers carry several nucleotides (underlined) of the specific sequence required for homologous recombination with the vector YEpFLAG and a 6His sequence for introduction of a C-terminal tag (shown in italics).

Source organism	A. niger
DNA source	pVK1.1 plasmid
Forward primer	CCAGCATTGCTGCTAAAGAAGAAGGGGTACCTTTGGATAAAAGATCCATTAAGCATCGAATCAAT
Reverse primer	GGATCCATCGATAGATCTCCCGGGCTCGAGCTA ATGATGATGATGATGATGGTATGCACCCTTCCGCTT
Cloning vector	YEpFLAG-1
Expression vector	YEpFLAG-1
Expression host	BJ3505 S. cerevisiae (pep4::HIS3, prb-_1.6R HIS3, lys2-208, trp1-_101, ura 352, gal2, can1)
Complete amino-acid sequence of the construct produced	SIKHRINGFTLTEHSDPAKRELLQKYVTWDDKSLFINGERIMIFSGEFHPFRLPVKELQLDIFQKVKALGFNCVSFYVDWALVEGKPGEYRADGIFDLEPFFDAASEAGIYLLARPGPYINAESSGGGFPGWLQRVNGTLRSSDKAYLDATDNYVSHVAATIAKYQITNGGPIILYQPENEYTSGCCGVEFPDPVYMQYVEDQARNAGVVIPLINNDASASGNNAPGTGKGAVDIYGHDSYPLGFDCANPTVWPSGDLPTNFRTLHLEQSPTTPYAIVEFQGGSYDPWGGPGFAACSELLNNEFERVFYKNDFSFQIAIMNLYMIFGGTNWGNLGYPNGYTSYDYGSAVTESRNITREKYSELKLLGNFAKVSPGYLTASPGNLTTSGYADTTDLTVTPLLGNSTGSFFVVRHSDYSSEESTSYKLRLPTSAGSVTIPQLGGTLTLNGRDSKIHVTDYNVSGTNIIYSTAEVFTWKKFADGKVLVLYGGAGEHHELAISTKSNVTVIEGSESGISSKQTSSSVVVGWDVSTTRRIIQVGDLKILLLDRNSAYNYWVPQLATDGTSPGFSTPEKVASSIIVKAGYLVRTAYLKGSGLYLTADFNATTSVEVIGVPSTAKNLFINGDKTSHTVDKNGIWSATVDYNAPDISLPSLKDLDWKYVDTLPEIQSSYDDSLWPAADLKQTKNTLRSLTTPTSLYSSDYGFHTGYLLYRGHFTATGNESTFAIDTQGGSAFGSSVWLNGTYLGSWTGLYANSDYNATYNLPQLQAGKTYVITVVIDNMGLEENWTVGEDLMKTPRGILNFLLAGRPSSAISWKLTGNLGGEDYEDKVRGPLNEGGLYAERQGFHQPEPPSQNWKSSSPLEGLSEAGIGFYSASFDLDLPKGWDVPLFLNIGNSTTPSPYRVQVYVNGYQYAKYISNIGPQTSFPVPEGILNYRGTNWLAVTLWALDSAGGKLESLELSYTTPVLTALGEVESVDQPKYKKRKGAYHHHHHH

2.2. Crystallization  

Prior to crystallization experiments, glycan chains were removed using endoglycosidase H (Endo H; New England BioLabs) under native conditions. Endo H treatment was carried out for 3 h following the manufacturer’s instructions. An extra purification step using a gel-filtration column (HiLoad 16/60 Superdex 200 prep-grade column, GE Healthcare) was performed after deglycosylation in order to eliminate Endo H contamination from the protein sample. The deglycosylated protein was concentrated to 1.5 mg ml⁻¹ by ultrafiltration using Amicon Ultra-4 (Millipore).

Crystallization conditions were initially explored using commercially available screens. The PACT and JCSG+ Suites from Qiagen were assayed at 291 K. Drops consisting of 0.5 µl precipitant and 0.5 µl pure An-β-Gal (1.5 mg ml⁻¹ in 150 mM NaCl, 50 mM Tris–HCl pH 7.5) were equilibrated against 65 µl reservoir solution in sitting-drop microplates. Crystals grew in several conditions with PEG 3350 as the main precipitant agent. Optimization of the crystallization conditions was performed through further sitting-drop experiments (Table 2 ▶).

Table 2. Crystallization.

Method	Vapour diffusion, sitting drop
Plate type, screening plate type, optimization	Innovaplate SD-2 Maxi 48-well Crystallization Plate
Temperature (K)	291
Protein concentration (mgml1)	1.5
Buffer composition of protein solution	150mM NaCl, 50mM TrisHCl pH 7.5
Composition of reservoir solution	2124%(w/v) PEG 3350, 200mM Li2SO4, 100mM bis-tris pH 5.56.0
Volume and ratio of drop	2l, 1:1 ratio
Volume of reservoir (l)	200

2.3. Data collection and processing  

Crystals were soaked in precipitant solution containing an additional 20%(w/v) glycerol (Garman & Mitchell, 1996 ▶) a few seconds before being flash-cooled to 100 K. Diffraction data were collected using synchrotron radiation. The diffraction data collected were processed with iMosflm (Battye et al., 2011 ▶) and AIMLESS (Evans, 2006 ▶) as distributed in the CCP4 suite (Winn et al., 2011 ▶). Data-collection statistics are summarized in Table 3 ▶.

Table 3. Data collection and processing.

Values in parentheses are for the outer shell.

Diffraction source	ALBA beamline, XALOC
Wavelength ()	0.97947
Temperature (K)	100
Detector	PILATUS
Crystal-to-detector distance (mm)	293.12
Rotation range per image ()	0.2
Total rotation range ()	200
Exposure time per image (s)	0.2
Space group	P212121
a, b, c ()	85.57, 111.42, 126.73
Mosaicity ()	0.52
Resolution range ()	42.791.80 (1.841.80)
Total No. of reflections	1160311 (49134)
No. of unique reflections	173058 (7448)
Completeness (%)	99.9 (99.9)
Multiplicity	6.7 (6.6)
I/(I)	8.8 (4.4)
CC1/2(%)	99.1 (68.5)
R merge † (%)	10.6 (46.5)
Overall B factor from Wilson plot (2)	8.3

^† R _merge = , where I _i(hkl) is the ith measurement of reflection hkl and I(hkl) is the weighted mean of all measurements.

3. Results and discussion  

An-β-Gal is an extracellular highly glycosylated enzyme, its molecular weight decreasing more than 50% after treatment with endoglycosidase H (Endo H; Fig. 1 ▶). Moreover, these glycosylations make the protein very heterogeneous, which usually hinders the crystallization process. To remove this obstacle, the protein sample was treated with Endo H prior to the crystallization step (Lehle et al., 2006 ▶). Endo H cleaves asparagine-linked oligomannoses, generating a truncated sugar moiety with one N-acetylglucosamine residue remaining on the glycosylation site.

Figure 1.

SDS–PAGE analysis of glycosylated (lane 1) and deglycosylated (lane 2) purified An-β-Gal. The glycosylated sample shows a wide smeared pattern with an average molecular weight of 200 kDa. The deglycosylated sample shows a molecular weight of 109 kDa as predicted from the amino-acid sequence.

Initial screenings using the PACT and JCSG+ Suites with the purified deglycosylated An-β-Gal gave needles in some conditions of the JCSG+ Suite, which contain PEG 3350 as the main precipitant agent. Optimization was assayed by sampling protein and precipitant concentration and by varying the pH. The best rod-shaped crystals grew in 21 d from 21–24%(w/v) PEG 3350, 200 mM Li₂SO₄, 100 mM bis-tris pH 5.5–6.0 (Fig. 2 ▶ a).

Figure 2.

(a) Crystals of An-β-Gal grown in 21–24%(w/v) PEG 3350, 200 mM Li₂SO₄, 100 mM bis-tris pH 5.5. (b) X-ray diffraction pattern obtained using a synchrotron source. The outer circle corresponds to 1.8 Å resolution.

A full data set was collected at 100 K on the XALOC beamline at ALBA, Cerdanyola del Vallès, Spain. The crystals belonged to space group P2₁2₁2₁, as observed from the systematic absences, with unit-cell parameters a = 85.57, b = 111.42, c = 126.73 Å, and diffracted to 1.8 Å resolution (Fig. 2 ▶ b, Table 3 ▶). As calculated from its sequence analysis, the molecular mass of the monomer is 109 kDa. The Matthews coefficient value of 2.77 ų Da⁻¹ (Matthews, 1968 ▶), corresponding to 56% solvent content, reveals the presence of one molecule in the asymmetric unit. Structure determination by molecular replacement is in progress using the coordinates from A. oryzae β-galactosidase (PDB entry 4iug; Maksimainen et al., 2013 ▶), which shows 75% sequence identity. It is hoped that analysis of the structure will give insights into the mechanism and specificity of An-β-Gal, which is most useful for biotechnological purposes.