Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Nov 19.
Published in final edited form as: Gynecol Oncol. 2011 May 26;122(2):418–423. doi: 10.1016/j.ygyno.2011.04.051

Modulation of redox signaling promotes apoptosis in epithelial ovarian cancer cells

Zhongliang Jiang a, Nicole M Fletcher a, Rouba Ali-Fehmi b, Michael P Diamond a, Husam M Abu-Soud a, Adnan R Munkarah c, Ghassan M Saed a,*
PMCID: PMC4237166  NIHMSID: NIHMS630336  PMID: 21620448

Abstract

Objective

Epithelial ovarian cancer (EOC) cells are known to be resistant to apoptosis through a mechanism that may involve alteration in their redox balance. NADPH oxidase is a major source of intracellular superoxide, which is converted to the less toxic product by superoxide dismutase (SOD). Superoxide contributes to hypoxia inducible factor (HIF)-1α stabilization. We sought to determine the effects of inhibiting the generation of intracellular reactive oxygen species (ROS) on apoptosis of EOC cells.

Methods

Diphenyleneiodonium (DPI), an irreversible ROS inhibitor, was used to inhibit the generation of ROS in EOC cell lines, SKOV-3 and MDAH-2774, followed by assessment of apoptosis, NADPH oxidase, SOD3 and HIF-1α expression. A combination of immunohistochemistry, immunoprecipitation/western blot, and real-time RT-PCR were utilized to evaluate the expression of these enzymes in EOC cells as well as normal ovarian tissue and ovarian cancer tissue specimens.

Results

DPI treatment significantly induced apoptosis in both EOC cell lines as evident by increased caspase-3 activity and TUNEL assay. Additionally, both EOC cell lines were found to express NADPH oxidase, HIF-1α, and SOD3, which were highly sensitive to DPI treatment. DPI treatment resulted in reduced NADPH oxidase, SOD3 and HIF-1α levels. Furthermore, ovarian cancer tissues were found to manifest higher NADPH oxidase levels as compared to normal ovarian tissues.

Conclusions

These data suggest that lowering oxidative stress, possibly through the inhibition of NADPH oxidase, induces apoptosis in ovarian cancer cells and may serve as a potential target for cancer therapy.

Keywords: NADPH oxidase, Diphenyleneiodonium, Epithelial ovarian cancer, Oxidative stress, Superoxide dismutase, Hypoxia inducible factor-1 alpha

Introduction

Ovarian cancer is the fifth leading cause of cancer death in women, the leading cause of death from gynecologic malignancies, and the second most commonly diagnosed gynecologic malignancy, however the underlying pathophysiology is not clearly understood [1]. Malignant cells are resistant to apoptosis through a mechanism that may involve alterations in their redox balance. Reactive oxygen species (ROS), generated in the mitochondria as a byproduct of oxidative phosphorylation, are continuously generated and eliminated in the biological system and play important roles in a variety of normal biochemical functions and abnormal pathological processes [2–5].

In addition to the ROS produced by the mitochondria, nicotin-amide adenine dinucleotide phosphate (NADPH)-oxidase, a flavoenzyme family member, generates a significant amount of endogenous ROS through the reduction of O2 to superoxide (O2⋅−), hydrogen peroxide (H2O2), and other ROS [6–9]. The NADPH oxidase complex is composed of multiple subunits, including a glycoprotein gp91-phox, which is considered to be directly involved in the generation of O2⋅− [8]. Enzyme systems similar to the phagocyte NADPH oxidase are now known to exist in many other cell types, and are referred to as the NOX family of NADPH oxidases [8–13].

Several antioxidant enzymes, including superoxide dismutases (SOD), catalase, and various peroxidases are effective in removing destructive ROS [14,15]. Superoxide dismutases are key enzymes required for removal of O2⋅−, thorough its conversion to H2O2, which is further eliminated by both catalase and peroxidases [15,16]. Human extracellular Cu/Zn SOD (SOD3), is a unique SOD family member found in the extracellular matrix of tissues and is ideally situated to prevent cell and tissue damage, initiated by extracellularily produced ROS [17]. The loss of endogenous SOD3 activity can exacerbate oxidative stress and pathologic damage as it is a critical endogenous antioxidant enzyme involved in carcinogenesis, cancer proliferation and metastasis [18].

Cancer cells are under intrinsic oxidative stress and manifest significantly increased levels of ROS, and thus express higher levels of SOD, which has been reported to stabilize the HIF-1α protein, enabling HIF-1α to dimerize, forming an active transcription factor [11,19–21]. Since rapidly growing tumors become hypoxic, questions are raised as to what promotes an increase in SOD, and why HIF-1α is stabilized and not degraded, with the increase in ROS under the hypoxic environment in cancer cells [22,23]. Restoration of the ROS balance in cancer cells may provide a potential therapeutic intervention to selectively eliminate cancer cells via apoptosis. Inhibition of NADPH oxidase and other pro-oxidant enzymes has been reported to significantly induce apoptosis of cancer cells [24,25]. Several agents have been utilized to test this hypothesis, however, few have been tested in ovarian cancer [26–28].

In the present study, we investigated whether NADPH oxidase-mediated generation of intracellular reactive ROS lead to anti-apoptotic activity and thus a growth advantage to epithelial ovarian cancer (EOC) cells. Specifically, we have utilized DPI, an irreversible inhibitor of flavoproteins, including NADPH oxidase, to evaluate apoptosis of EOC cells. Additionally, we have evaluated other key players in the regulation of redox homeostasis and apoptosis, including SOD3 and HIF-1α. Identification of targets to specifically induce apoptosis in EOC cells may provide a potential therapeutic target for selective elimination of cancer cells.

Materials and methods

Culture of EOC cell lines

The two human EOC cell lines, SKOV-3 and MDAH-2774, were obtained from ATCC (ATCC, Manassas, VA). Cells were cultured in 75cm2 cell culture flasks (Corning Incorporated, Corning, NY) with McCoy's 5A medium (Invitrogen, Carlsbad, CA) supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin including 10% heat-inactivated FBS at 37 °C in 5% CO2. Culture medium was replaced every two days.

Treatment of human EOC cells

Cells were plated (5×106) in 100 cm2 culture dishes and incubated for 24 hours. Cell were treated with 10 μM DPI (Sigma-Aldrich, Saint Louis, MO) for 0, 0.5, 1, 3, 6, 12, and 24 hours. The dose was selected based on previous studies [26–28]. Cells were harvested at each time point. All experiments were performed in triplicate.

Measurement of caspase-3 activity in EOC cells

A Caspase-3 Colorimetric Activity Assay Kit (Chemicon, Billerica, MA) was utilized per the manufacturer's protocol. Cells (2×106) were harvested and lysed in 300 μl of lysis buffer, and concentrations were equalized for each sample set. Cell lysate (150 μg) was combined with substrate reaction buffer containing 30 μg of caspase-3 substrate, acetyl-DEVD-p-nitroaniline (Ac-DEVD-pNA). This mixture was incubated for 1 hr at 37 °C, and then absorbance was measured with a plate reader (Ultramark, BIO-RAD, Hercules, CA).

Detection of apoptosis in EOC cells

DNA fragmentation was assessed by the in situ Terminal Deoxynucleotidyl Transferase-mediated dUTP-biotin nick end labeling (TUNEL) technique per the DeadEnd Fluorometric TUNEL System (Promega, Madison, WI) manufacturer's protocol. Briefly, the cells were fixed with 4% paraformaldehyde in PBS for 20 min at 4 °C, and subjected to permeabilization for 5 min at room temperature with 0.2% Triton X-100. Next, cells were labeled with the TUNEL reaction mixture for 60 min at 37 °C. The nuclei of these cells were also stained with 4′,6′-diamino-2-phenylindole (DAPI). Fluorescein-labeled DNA, an indication of DNA fragmentation, was analyzed by using an Axiovert 40 CFL immuno-fluorescent microscope (Carl Zeiss Microimaging, Thornwood, NY) and recorded with a microscope-mounted camera (Carl Zeiss).

Real-time reverse transcription polymerase chain reaction (RT-PCR) for and HIF-1α, NADPH oxidase, and SOD3

RNA isolation

Total RNA was extracted from both SKOV-3 and MDAH-2774 cells using an RNeasy Mini Kit (QIAGEN, Valencia, CA) according to the protocol provided by the manufacturer.

Reverse transcription

A 20 μL cDNA reaction volume was prepared with the use of QuantiTect Reverse Transcription Kit (QIAGEN) according to the protocol provided by the manufacturer.

Real-time RT-PCR

Real-time RT-PCR was performed with a QuantiTect SYBR Green RT-PCR kit (QIAGEN) and a Cepheid 1.2f Detection System (Cepheid, Sunnyvale, CA). Each 25-μL reaction included 12.5 μL of 2×QuantiTect SYBR Green RT-PCR master mixes, 1 μL of cDNA template, and 0.2 μM each of target-specific primer were selected with the aid of the software program, Beacon Designer (Premier Biosoft, Palo Alto, CA). Human oligonucleotide primers (HIF-1α, p22-phox, and SOD3) that amplify variable portions of the protein coding regions are listed in Table 1. Standards with known concentrations and lengths (base pairs (bp)) were designed specifically for HIF-1α (100 bp), NADPH oxidase p22-phox subunit (82 bp), and SOD3 (99 bp) using the Beacon Designer software (Premier Biosoft), allowing for construction of a standard curve using a tenfold dilution series. A specific standard for each gene allows for absolute quantification of the gene in number of copies, which can then be expressed per μg of RNA. The conditions for the three-step polymerase chain reaction protocol were as follows: an initial cycle at 95 °C for 900 s (HIF-1α), 1000 s (p22-phox) and 850 s (SOD3) followed by 35 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C (HIF-1α and SOD3) and 54 °C (p22-phox) for 30 s, and extension at 72 °C for 30 s. Finally, a melting curve analysis was performed to demonstrate the specificity of the PCR product as a single peak. A control, which contained all the reaction components except for the template, was included in all experiments.

Table 1.

Sequence of Human Oligonucleotide Primers.

Locus Sense (5′-3′) Antisense (5′-3′) Product Length (bp)
HIF-1α AGCCGAGGAAGAACTATGAAC ACTGAGGTTGGTTACTGTTGG 100
p22-phox GTACTTTGGTGCTTACTC GGAGCCCTTTTTCCTCTT 82
SOD3 GCCTCCATTTGTACCGAAAC AGGGTCTGGGTGGAAAGG 78
Open in a new tab

Measurement of SOD3 protein levels in EOC cells

Immunoprecipitation (IP)/Western blot was utilized as previously described with the following changes [29]. Cells were lysed with lysis buffer and cleared by centrifugation (10 minutes at 1,000 g, 4 °C). Protein concentration of cell lysates was measured with the Pierce BCA Protein Assay Kit (Thermofisher Scientific, Rockford, IL) per the manufacturer's protocol. The same concentration of protein was utilized for each sample. Precleared cell lysates were incubated with anti-SOD3 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour at 4 °C, followed by precipitation with 20 μl of Protein A/G PLUS-Agarose (Santa Cruz Biotechnology) and incubated at 4 °C overnight. Adherent proteins were eluted with 1×protein loading buffer for 5 minutes at 80 °C and analyzed by a Western blot detection kit (Visualizer, Millipore, Temecula, CA). SOD3 bands were scanned and analyzed by NIH Image J 3.0 (.U. S. National Institutes of Health, Bethesda,Maryland).

Measurement of HIF-1α levels in EOC cells

Protein concentration of cell lysates was measured as described above. Cell lysates were prepared from the various treatments of the EOC cell lines, SKOV-3 and MDAH-2774. HIF-1α was measured with an enzyme-linked immunosorbent assay kit (HIF-1α ELISA, R&D Systems, Minneapolis, MN), per the manufacturer's protocol.

Immunohistochemical staining of EOC tissue sections

Twenty benign ovarian tissues specimens, obtained from patients who underwent total abdominal hysterectomy-bilateral salpingooophorectomy for leiomyomas, and 20 invasive EOC cases (two sections per case) were retrieved from archival materials from the Detroit Medical Center/ Karmanos Cancer Center pathology department (Institutional review board number 072206MP2E). Histological diagnoses were as follows: 10 high grade and five low grade serous carcinomas, four grade 1 endometrioid and one grade 1 mucinous cacinomas. The mean age of the 20 patients was 56 (range 35–70). Sections were deparaffinized, hydrated with PBS (pH 7.4), and pretreated with H2O2 (3%) for 10 min to remove endogenous peroxidases and incubated in goat serum for 10 min. A primary antibody for NADPH oxidase (HPA015475, Sigma Aldrich) dilution (1:20) was applied to each section, followed by washing and incubation with the biotinylated secondary antibody for 10 min at room temperature. Detection was performed with AEC and counter-staining with Mayer's hematoxylin followed by mounting.

Ovaries had only surface epithelial inclusion cysts and epithelium was evaluated for expression of NADPH oxidase and was assessed based on the presence of cytoplasmic staining. Scoring was assigned based on the percentage of positive epithelial cells: a zero score assigned for cases with no cytoplasmic staining in any cells; score 1 with b5% of cell staining positive; score 2 with 6-30% and score 3 with N30% of cells staining positive. A gynecologic pathologist reviewed all slides, benign (2–5 slides) and malignant (5–15 slides). The most positive area in every tumor or benign cases was evaluated and only the percentage was evaluated because most of the cases had the same intensity. For statistical analysis, cases with score 0 or 1 were considered as being negative and cases with score 2 or 3 as positive.

Statistical Analysis

Data were analyzed using SPSS 19.0 for windows (SPSS for Windows, Chicago, IL). Data were analyzed using oneway ANOVA (analysis of variance) with Student Neuman-Kuels post-hoc comparisons. Significance values of p<0.05 were considered statistically significant for all analyses.

Results

DPI treated EOC cells exhibited increased caspase-3 activity and apoptosis

Caspase-3 activity significantly increased, in a time dependent fashion, in SKOV-3 cells, from 7.62 to 20.9, 20.3, 22.0, 24.5, 39.4, and 54.3 μM and in MDAH-2774 cells from 6.61 to 19.0, 20.4, 23.1, 25.6, 39.3, and 53.1 μM at the 0.5, 1, 3, 6, 12, and 24 hour time points, respectively (pb0.05 as compared to control, Fig. 1A).

Fig. 1.

Fig. 1

Open in a new tab

(A) Caspase-3 activity and (B) apoptosis in EOC cells. (A) Caspase-3 activity was measured in cell lysates from SKOV-3 and MDAH-2774 before and after DPI treatment (10 μM) at various time points. (B) The amount of DNA fragmentation (apoptosis) was assessed by TUNEL assay in MDAH-2774 and SKOV-3, before and after DPI treatment (10 μM, 12 and 24 hrs) as compared to control cells. Nuclei were stained with DAPI (blue) and apoptotic cells were visualized (60x) with fluorescein-12-dUTP (green). Results are representative of the mean of three independent experiments. (* All p<0.05 as compared to their control).

These results were confirmed by TUNEL staining, an indicator of the degree of DNA fragmentation, which is representative of apoptosis. Nuclei were stained with DAPI (blue) and apoptotic cells were visualized (60x) with fluorescein-12-dUTP (green). There was a significant increase in TUNEL staining (green) as compared to controls, in both EOC cell lines (Fig. 1B).

DPI treated EOC cells had reduced levels of NADPH oxidase mRNA

Real-time RT-PCR was utilized to determine the mRNA level of the NADPH oxidase p22-phox subunit, a representative O2 sensing subunit of NADPH oxidase, in EOC cells treated with and without DPI for 0.5 hours. NADPH oxidase was significantly decreased by 51.6% in SKOV-3 cells, and by 40.1% in MDAH-2774 cells (p<0.05 as compared to control, Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Real-time RT-PCR for NADPH oxidase in EOC cells. Expression of the NADPH oxidase subunit p22-phox mRNA levels in SKOV-3 and MDAH-2774 before and after DPI treatment (10 μM, 0.5 hrs) was measured using real-time RT-PCR. Results are representative of the mean of three independent experiments. (* All p<0.05 as compared to their control).

EOC tissues expressed higher levels of NADPH oxidase

NADPH oxidase expression was upregulated in 65% of EOC tissue sections, tested by immunohistochemistry as compared to 20% detectable expression for NADPH oxidase in normal ovarian epithelial tissue (surface epithelial inclusion cysts) (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Immunohistochemical staining of EOC tissue sections. Normal and EOC tissue section were stained with a primary antibody for NADPH oxidase, followed by biotinylated secondary antibody. Detection was performed with AEC and counter-staining was done with Mayer's hematoxylin followed by mounting and imaging (20x). The expression of NADPH oxidase was assessed based on the presence of cytoplasmic staining.

DPI treated EOC cells had reduced levels of HIF-1α

DPI treatment significantly reduced HIF-1α mRNA levels, in SKOV-3 cells, from 428.2 to 368.2, 318.6, 268.8, 261.3, and 206.8 pg/μg RNA at the 0.5, 3, 6, 12, and 24 hour time points, and in MDAH-2774 cells from 421.3 to 356.9, 356.1, 327.4, 260.3, 240.0 and 223.1 pg/μg RNA, at the 0.5, 1, 3, 6, 12, and 24 hour time points, respectively (p<0.05 as compared to control, Fig. 4A). There was no statistical change in HIF-1α mRNA levels at the 1 hour time point in SKOV-3 cells.

Fig. 4.

Fig. 4

Open in a new tab

HIF-1α levels in EOC cells. (A) HIF-1α mRNA levels in SKOV-3 and MDAH-2774 before and after DPI treatment (10 μM), at various time points, were measured using real-time RT-PCR. (B) ELISA was performed at different time points for cell lysates from SKOV-3 and MDAH-2774 before and after DPI treatment (10 μM) at various time points. Results are representative of the mean of three independent experiments. Results are representative of the mean of three independent experiments. (* All p<0.05 as compared to their control).

HIF-1α protein levels, in SKOV-3 cells, were significantly reduced from 1699 to 828.0, 377.2, 311.0, 291.1, 224.6, and 44.27 pg/ml total protein and in MDAH-2774 cells from 1872 to 658.1, 332.4, 257.5, 111.8, 106.1, and 22.96 pg/ml total protein at the 0.5, 1, 3, 6, 12, and 24 hour time points, respectively (p<0.05 as compared to control, Fig. 4B).

DPI treated EOC cells had reduced levels of SOD3

DPI treatment significantly reduced SOD3 mRNA levels, in a time dependent fashion, from 31.1 to 19.5, 24.6, 15.7, 9.23, 4.63, and 3.41 fg/μg RNA at the 0.5, 1, 3, 6, 12, and 24 hour time points, respectively, in SOKV-3 cells (p<0.05 as compared to control, Fig. 5A). Similarly, SOD3 mRNA levels were significantly reduced from 26.1 to 19.69, 16.0, 11.7, 8.63, and 6.68 fg/μg RNA at the 0.5, 3, 6, 12, and 24 hour time points, respectively, in MDAH-2774 cells (p<0.05 as compared to control, Fig. 5A). There was no significant change in SOD3 mRNA levels at the 1 hour time point in MDAH-2774 cells.

Fig. 5.

Fig. 5

Open in a new tab

SOD3 levels in EOC cells. (A) SOD3 mRNA levels in SKOV-3 and MDAH-2774 before and after DPI treatment (10 μM), at various time points, were measured using real-time RT-PCR. (B) IP/Western blot was utilized to detect SOD3 protein levels in EOC cells. Cell lysates from SKOV-3 and MDAH-2774 before and after DPI treatment (10 μM), at various time points, were precipitated with anti-SOD3 antibody and fractionated with SDS-PAGE. Membrane was probed with anti-SOD3 antibody. Immunoprecipitation of SOD3 exposed to SOD3 antibody are as follows: Lanes 1 & 8; control, Lanes 2 & 9; 0.5 hr, Lanes 3 & 10; 1 hr, Lanes 4 & 11; 3 hr, Lanes 5 & 12; 6 hr, Lanes 6 & 13; 12 hr, and Lanes 7 & 14; 24 hr. (C): IP/Western blot results were scanned and analyzed by NIH image J 3.0. Results are representative of the mean of three independent experiments. (* All p<0.05 as compared to their control).

SOD3 protein levels, in SOKV-3 cells, were reduced from 251.6 to 223.2, 215.7, 181.6, and 149.0 at the 3, 6, 12, and 24 hour time points, respectively (p<0.05 as compared to control, Figs. 5B and C) and in MDAH-2774 cells from 254.4 to 237.9, 230.4, 208.5, 188.4, and 170.1 at the 1, 3, 6, 12, and 24 hour time points, respectively (p<0.05 as compared to control, Figs. 5B and C). There was no significant change in SOD3 protein levels at the 0.5 hour time point in both SKOV-3 and MDAH-2774 cells and at the 1 hour time point in SKOV-3 cells. Results were expressed as relative levels as compared to their control.

Discussion

In this study we sought to determine the effects of inhibiting the generation of ROS by DPI, a well-characterized, potent inhibitor of flavoenzymes including NADPH oxidase, on apoptosis of EOC cells, and whether these effects are associated with SOD3 and HIF-1α expression [30,31]. Diphenyleneiodonium has been used to inhibit ROS production mediated by NADPH oxidase in various cell types [21,31,32]. Our immunohistochemical results showed that NADPH oxidase is over-expressed in EOC tissues as compared to normal ovarian tissues (Fig. 3). Consistent with this observation, we demonstrated EOC cells to have elevated NADPH oxidase, which was reduced by DPI (Fig. 2). These findings are supported by the fact that increased NADPH oxidase levels promote the tumorigenic potential of NIH3T3 mouse fibroblasts as well as the DU-145 prostate epithelial cells [30].

Inhibition of NADPH oxidase has been reported to significantly limit the conversion of molecular O2 to O2⋅−, H2O2 and other ROS [24,25]. Growing evidence suggests that cancer cells exhibit increased intrinsic ROS stress, due in part to oncogenic stimulation, increased metabolic activity, and mitochondrial malfunction [2,3]. Further support for this increase in ROS is demonstrated by a cross-talk between mitochondria and the O2⋅− generating NADPH oxidase in ovarian tumors [33]. The mitochondria controls NADPH oxidase redox signaling, therefore loss of this control contributes to tumorigenesis [33]. In agreement with a previous study, we have shown that inhibition of NADPH oxidase-dependent ROS generation with DPI induced apoptosis in EOC cells, suggesting that the ROS produced by NADPH oxidase, at least in part, exert an anti-apoptotic function [34]. This anti-apoptotic mechanism involves induced inhibition of phosphorylation of AKT and subsequent suppression of AKT-mediated phosphorylation of ASK1 on Ser-83 [34–36]. Furthermore, the anticancer drug paclitaxel-induced apoptosis of ovarian cancer cells is mediated by negative regulation of AKT–ASK1 phosphorylation signaling whereas AKT activation by H2O2 confers protection against apoptosis [34–36].

In addition, we have shown that DPI treatment significantly reduced SOD3 and HIF-1α mRNA levels as early as 30 minutes after treatment, with significant further reduction over the following 24 hours in EOC cells (Figs. 4 and 5). A parallel reduction in protein levels, although not with equivalent magnitude, was also observed for both SOD3 and HIF-1α as determined by IP/Western blot and ELISA (Figs. 4 and 5). This may be a consequence of post-translation modifications, which may result in increased stability and/or lower degradation of the proteins. These findings demonstrated that inhibition of NADPH oxidase attenuates the expression of both SOD3 and HIF-1α, at the mRNA and protein levels. Moreover, our results showed that the inhibition of NADPH oxidase significantly induced apoptosis of EOC cells, as assessed by both caspase-3 activity and TUNEL assays (Fig. 1). Therefore, there appears to be a strong association between the inhibition of NADPH oxidase and the subsequent reduction in SOD3 and HIF-1α levels and increase in apoptosis of EOC cells.

The correlation between HIF-1α and cellular apoptosis has previously been demonstrated in lung and hepatoma cancer cells [25,37]. Apoptosis can regulate HIF-1α through the modulation of the ratio of pro-apoptotic Bcl-2 and anti-apoptotic Bcl-2 family proteins [38]. Anti-apoptotic Bcl-2 and Bcl-xL levels were increased and proapoptotic BAX and BAK levels were decreased with the over-expression of HIF-1α [38]. Also, it has been reported that inhibition of HIF-1α by rapamycin resulted in an increase in apoptosis of cancer cells, and decrease in the expression of apoptosis inhibitor Bcl-2 in ovarian cancer xenografts and that rapamycin enhanced cell death through the inhibition of cell survival signals in a number of cell lines [39].

Most of the generated O2⋅− undergoes a nonenzymatic or SOD-catalyzed reaction, generating H2O2 as an end product [40–42]. Hydrogen peroxide is freely diffusible through biological membranes, and its overproduction is extremely destructive to cells and tissues, yet it is physiologically important among ROS given its relative long half-life in the intracellular space, and that it is the precursor of the more toxic hydroxyl radicals [41–43]. It has been reported that increased SOD3 expression in ovarian cancer is a cellular response to intrinsic ROS stress [44]. However, the role of SOD3 in tumorigenesis is somewhat controversial. It has been recently demonstrated, in mice, that subcutaneous inoculation of the SOD3 gene significantly suppressed lung cancer metastasis and that over-expression of SOD3 resulted in in vivo inhibition of growth of B16-F1 melanoma tumors [45,46]. In contrast, inhibition of SOD has been shown to selectively induce apoptosis of leukemia and ovarian cancer cells, confirming our findings from the present study [5].

High expression levels of SOD3 was reported to significantly induce the expression of HIF-1α in tumors, under hypoxic conditions, and thus demonstrates a relationship between SOD3 and HIF-1α pathways [39]. The mechanism by which SOD3 upregulates HIF-1α is not well understood, but there is substantial evidence to suggest that this mechanism is modulated, in part, by the steady-state level of O2⋅− and the stabilization of HIF-1α [47]. Therefore, reduction of O2⋅− levels via inhibition of NADPH oxidase may result in lowering SOD3 levels, leading to the destabilization of HIF-1α, subsequently increasing apoptosis.

Collectively, based on previously discussed published reports and the results from this study, we conclude that lowering oxidative stress, possibly through the inhibition of NADPH oxidase-generated O2⋅−, induces apoptosis in ovarian cancer cells and may serve as a potential target for cancer therapy.

Footnotes

Conflict of interest statement

Zhongliang Jiang – None

Nicole M. Fletcher – None

Rouba Ali-Fehmi – None

Michael P. Diamond – Consultant for the following: Omrix, Genzyme, Neomend, Baxter, EMD Serono, Snaofi-Aventis, Half Medical, ZSX Medical, and Auzogyn. Board Member for the following: Advanced Reproductive Care, American Society for Reproductive Medicine. Research Grants for the following: Boehringher Ingelheim BirSante, Johnson and Johnson, Interlace Medical, Glaxo-Smith Klein, Neurocrine Biosciences. Stocks for the following: Neomend. Speaker Bureau: Boehringher Ingelheim.

Husam M. Abu-Soud – None

Adnan R. Munkarah – None

Ghassan M. Saed – None

References

  • 1.Jemal A, Siegel R, Ward E, Murray T, Xu J, Smigal C, et al. Cancer statistics, 2006. CA Cancer J Clin. 2006;56(2):106–30. doi: 10.3322/canjclin.56.2.106. [DOI] [PubMed] [Google Scholar]
  • 2.Trachootham D, Alexandre J, Huang P. Targeting cancer cells by ROS-mediated mechanisms: a radical therapeutic approach? Nat Rev Drug Discov. 2009;8(7):579–91. doi: 10.1038/nrd2803. [DOI] [PubMed] [Google Scholar]
  • 3.Pelicano H, Carney D, Huang P. ROS stress in cancer cells and therapeutic implications. Drug Resist Updat. 2004;7(2):97–110. doi: 10.1016/j.drup.2004.01.004. [DOI] [PubMed] [Google Scholar]
  • 4.Starkov AA, Fiskum G, Chinopoulos C, Lorenzo BJ, Browne SE, Patel MS, et al. Mitochondrial alpha-ketoglutarate dehydrogenase complex generates reactive oxygen species. J Neurosci. 2004;24(36):7779–88. doi: 10.1523/JNEUROSCI.1899-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hileman EO, Liu J, Albitar M, Keating MJ, Huang P. Intrinsic oxidative stress in cancer cells: a biochemical basis for therapeutic selectivity. Cancer Chemother Pharmacol. 2004;53(3):209–19. doi: 10.1007/s00280-003-0726-5. [DOI] [PubMed] [Google Scholar]
  • 6.Cheng G, Cao Z, Xu X, van Meir EG, Lambeth JD. Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5. Gene. 2001;269(1–2):131–40. doi: 10.1016/s0378-1119(01)00449-8. [DOI] [PubMed] [Google Scholar]
  • 7.Ushio-Fukai M, Alexander RW. Reactive oxygen species as mediators of angiogenesis signaling: role of NAD(P)H oxidase. Mol Cell Biochem. 2004;264(1–2):85–97. doi: 10.1023/b:mcbi.0000044378.09409.b5. [DOI] [PubMed] [Google Scholar]
  • 8.Bedard K, Krause KH. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev. 2007;87(1):245–313. doi: 10.1152/physrev.00044.2005. [DOI] [PubMed] [Google Scholar]
  • 9.Dong J, Sulik KK, Chen SY. The role of NOX enzymes in ethanol-induced oxidative stress and apoptosis in mouse embryos. Toxicol Lett. 2010;193(1):94–100. doi: 10.1016/j.toxlet.2009.12.012. (PMCID: 2822117) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Meier B, Cross AR, Hancock JT, Kaup FJ, Jones OT. Identification of a superoxide-generating NADPH oxidase system in human fibroblasts. Biochem J. 1991;275(Pt 1):241–5. doi: 10.1042/bj2750241. (PMCID: 1150038) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Szatrowski TP, Nathan CF. Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res. 1991;51(3):794–8. [PubMed] [Google Scholar]
  • 12.Griendling KK, Minieri CA, Ollerenshaw JD, Alexander RW. Angiotensin II stimulates NADH and NADPH oxidase activity in cultured vascular smooth muscle cells. Circ Res. 1994;74(6):1141–8. doi: 10.1161/01.res.74.6.1141. [DOI] [PubMed] [Google Scholar]
  • 13.Lambeth JD. NOX enzymes and the biology of reactive oxygen. Nat Rev Immunol. 2004;4(3):181–9. doi: 10.1038/nri1312. [DOI] [PubMed] [Google Scholar]
  • 14.Fletcher NM, Jiang ZL, Diamond MP, Abu-Soud HM, Saed GM. Hypoxia-generated superoxide induces the development of the adhesion phenotype. Free Radic Biol Med. 2008;45(4):530–6. doi: 10.1016/j.freeradbiomed.2008.05.002. (PMCID: 2574925) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fridovich I. The biology of oxygen radicals. Science. 1978;201(4359):875–80. doi: 10.1126/science.210504. [DOI] [PubMed] [Google Scholar]
  • 16.Carlsson LM, Jonsson J, Edlund T, Marklund SL. Mice lacking extracellular superoxide dismutase are more sensitive to hyperoxia. Proc Natl Acad Sci U S A. 1995;92(14):6264–8. doi: 10.1073/pnas.92.14.6264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chaiswing L, Zhong W, Cullen JJ, Oberley LW, Oberley TD. Extracellular redox state regulates features associated with prostate cancer cell invasion. Cancer Res. 2008;68(14):5820–6. doi: 10.1158/0008-5472.CAN-08-0162. [DOI] [PubMed] [Google Scholar]
  • 18.Semenza GL. Hypoxia-inducible factor 1: control of oxygen homeostasis in health and disease. Pediatr Res. 2001;49(5):614–7. doi: 10.1203/00006450-200105000-00002. [DOI] [PubMed] [Google Scholar]
  • 19.Takeya R, Sumimoto H. Molecular mechanism for activation of superoxide-producing NADPH oxidases. Mol Cells. 2003;16(3):271–7. [PubMed] [Google Scholar]
  • 20.Chandel NS, Maltepe E, Goldwasser E, Mathieu CE, Simon MC, Schumacker PT. Mitochondrial reactive oxygen species trigger hypoxia-induced transcription. Proc Natl Acad Sci U S A. 1998;95(20):11715–20. doi: 10.1073/pnas.95.20.11715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Suliman HB, Ali M, Piantadosi CA. Superoxide dismutase-3 promotes full expression of the EPO response to hypoxia. Blood. 2004;104(1):43–50. doi: 10.1182/blood-2003-07-2240. [DOI] [PubMed] [Google Scholar]
  • 22.Cross AR, Jones OT. The effect of the inhibitor diphenylene iodonium on the superoxide-generating system of neutrophils. Specific labelling of a component polypeptide of the oxidase. Biochem J. 1986;237(1):111–6. doi: 10.1042/bj2370111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Saed GM, Zhao M, Diamond MP, Abu-Soud HM. Regulation of inducible nitric oxide synthase in post-operative adhesions. Hum Reprod. 2006;21(6):1605–11. doi: 10.1093/humrep/dei500. [DOI] [PubMed] [Google Scholar]
  • 24.Boveris A, Chance B. The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem J. 1973;134(3):707–16. doi: 10.1042/bj1340707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Volm M, Koomagi R. Hypoxia-inducible factor (HIF-1) and its relationship to apoptosis and proliferation in lung cancer. Anticancer Res. 2000;20(3A):1527–33. [PubMed] [Google Scholar]
  • 26.Brault S, Gobeil F, Jr, Fortier A, Honore JC, Joyal JS, Sapieha PS, et al. Lysophosphatidic acid induces endothelial cell death by modulating the redox environment. Am J Physiol Regul Integr Comp Physiol. 2007;292(3):R1174–83. doi: 10.1152/ajpregu.00619.2006. [DOI] [PubMed] [Google Scholar]
  • 27.O'Donnell BV, Tew DG, Jones OT, England PJ. Studies on the inhibitory mechanism of iodonium compounds with special reference to neutrophil NADPH oxidase. Biochem J. 1993;290(Pt 1):41–9. doi: 10.1042/bj2900041. (PMCID: 1132380) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Park SE, Song JD, Kim KM, Park YM, Kim ND, Yoo YH, et al. Diphenyleneiodonium induces ROS-independent p53 expression and apoptosis in human RPE cells. FEBS Lett. 2007;581(2):180–6. doi: 10.1016/j.febslet.2006.12.006. [DOI] [PubMed] [Google Scholar]
  • 29.Suh YA, Arnold RS, Lassegue B, Shi J, Xu X, Sorescu D, et al. Cell transformation by the superoxide-generating oxidase Mox1. Nature. 1999;401(6748):79–82. doi: 10.1038/43459. [DOI] [PubMed] [Google Scholar]
  • 30.Arbiser JL, Petros J, Klafter R, Govindajaran B, McLaughlin ER, Brown LF, et al. Reactive oxygen generated by Nox1 triggers the angiogenic switch. Proc Natl Acad Sci U S A. 2002;99(2):715–20. doi: 10.1073/pnas.022630199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tanaka M, Kogawa K, Nakamura K, Nishihori Y, Kuribayashi K, Hagiwara S, et al. Anti-metastatic gene therapy utilizing subcutaneous inoculation of EC-SOD gene transduced autologous fibroblast suppressed lung metastasis of Meth-A cells and 3LL cells in mice. Gene Ther. 2001;8(2):149–56. doi: 10.1038/sj.gt.3301362. [DOI] [PubMed] [Google Scholar]
  • 32.Wheeler MD, Smutney OM, Samulski RJ. Secretion of extracellular superoxide dismutase from muscle transduced with recombinant adenovirus inhibits the growth of B16 melanomas in mice. Mol Cancer Res. 2003;1(12):871–81. [PubMed] [Google Scholar]
  • 33.Desouki MM, Kulawiec M, Bansal S, Das GM, Singh KK. Cross talk between mitochondria and superoxide generating NADPH oxidase in breast and ovarian tumors. Cancer Biol Ther. 2005;4(12):1367–73. doi: 10.4161/cbt.4.12.2233. [DOI] [PubMed] [Google Scholar]
  • 34.Mochizuki T, Furuta S, Mitsushita J, Shang WH, Ito M, Yokoo Y, et al. Inhibition of NADPH oxidase 4 activates apoptosis via the AKT/apoptosis signal-regulating kinase 1 pathway in pancreatic cancer PANC-1 cells. Oncogene. 2006;25(26):3699–707. doi: 10.1038/sj.onc.1209406. [DOI] [PubMed] [Google Scholar]
  • 35.Mabuchi S, Ohmichi M, Kimura A, Nishio Y, Arimoto-Ishida E, Yada-Hashimoto N, et al. Estrogen inhibits paclitaxel-induced apoptosis via the phosphorylation of apoptosis signal-regulating kinase 1 in human ovarian cancer cell lines. Endocrinology. 2004;145(1):49–58. doi: 10.1210/en.2003-0792. [DOI] [PubMed] [Google Scholar]
  • 36.Wang X, McCullough KD, Franke TF, Holbrook NJ. Epidermal growth factor receptor-dependent Akt activation by oxidative stress enhances cell survival. J Biol Chem. 2000;275(19):14624–31. doi: 10.1074/jbc.275.19.14624. [DOI] [PubMed] [Google Scholar]
  • 37.Piret JP, Mottet D, Raes M, Michiels C. CoCl2, a chemical inducer of hypoxiainducible factor-1, and hypoxia reduce apoptotic cell death in hepatoma cell line HepG2. Ann N Y Acad Sci. 2002;973:443–7. doi: 10.1111/j.1749-6632.2002.tb04680.x. [DOI] [PubMed] [Google Scholar]
  • 38.Li Y, Trush MA. Diphenyleneiodonium, an NAD(P)H oxidase inhibitor, also potently inhibits mitochondrial reactive oxygen species production. Biochem Biophys Res Commun. 1998;253(2):295–9. doi: 10.1006/bbrc.1998.9729. [DOI] [PubMed] [Google Scholar]
  • 39.Shi Y, Frankel A, Radvanyi LG, Penn LZ, Miller RG, Mills GB. Rapamycin enhances apoptosis andincreases sensitivity to cisplatin in vitro. Cancer Res. 1995;55(9):1982–8. [PubMed] [Google Scholar]
  • 40.Scaife RM. Selective and irreversible cell cycle inhibition by diphenyleneiodonium. Mol Cancer Ther. 2005;4(6):876–84. doi: 10.1158/1535-7163.MCT-05-0009. [DOI] [PubMed] [Google Scholar]
  • 41.Goud AP, Goud PT, Diamond MP, Gonik B, Abu-Soud HM. Reactive oxygen species and oocyte aging: role of superoxide, hydrogen peroxide, and hypochlorous acid. Free Radic Biol Med. 2008;44(7):1295–304. doi: 10.1016/j.freeradbiomed.2007.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.McCord JM, Fridovich I. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J Biol Chem. 1969;244(22):6049–55. [PubMed] [Google Scholar]
  • 43.Schallreuter KU, Moore J, Wood JM, Beazley WD, Gaze DC, Tobin DJ, et al. In vivo and in vitro evidence for hydrogen peroxide (H2O2) accumulation in the epidermis of patients with vitiligo and its successful removal by a UVB-activated pseudocatalase. J Investig Dermatol Symp Proc. 1999;4(1):91–6. doi: 10.1038/sj.jidsp.5640189. [DOI] [PubMed] [Google Scholar]
  • 44.Hu Y, Rosen DG, Zhou Y, Feng L, Yang G, Liu J, et al. Mitochondrial manganesesuperoxide dismutase expression in ovarian cancer: role in cell proliferation and response to oxidative stress. J Biol Chem. 2005;280(47):39485–92. doi: 10.1074/jbc.M503296200. [DOI] [PubMed] [Google Scholar]
  • 45.Calastretti A, Bevilacqua A, Ceriani C, Vigano S, Zancai P, Capaccioli S, et al. Damaged microtubules can inactivate BCL-2 by means of the mTOR kinase. Oncogene. 2001;20(43):6172–80. doi: 10.1038/sj.onc.1204751. [DOI] [PubMed] [Google Scholar]
  • 46.Jiang H, Feng Y. Hypoxia-inducible factor 1alpha (HIF-1alpha) correlated with tumor growth and apoptosis in ovarian cancer. Int J Gynecol Cancer. 2006;16(Suppl 1):405–12. doi: 10.1111/j.1525-1438.2006.00310.x. [DOI] [PubMed] [Google Scholar]
  • 47.Kaewpila S, Venkataraman S, Buettner GR, Oberley LW. Manganese superoxide dismutase modulates hypoxia-inducible factor-1 alpha induction via superoxide. Cancer Res. 2008;68(8):2781–8. doi: 10.1158/0008-5472.CAN-07-2635. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES