Manganese regulation of virulence factors and oxidative stress resistance in Neisseria gonorrhoeae

Abstract

Neisseria gonorrhoeae has evolved a complex and novel network of oxidative stress responses, including defense mechanisms that are dependent on manganese (Mn). We performed systematic analyses at the transcriptomic and proteomic (1D SDS-PAGE and Isotope-Coded Affinity Tag [ICAT]) levels to investigate the global expression changes that take place in a high Mn environment, which results in a Mn-dependent oxidative stress resistance phenotype. These studies revealed that 97 proteins are regulated at the post-transcriptional level under conditions of increased Mn concentration, including proteins involved in virulence (eg. Pilin, a key adhesin), oxidative stress defence (eg. superoxide dismutase), cellular metabolism, protein synthesis, RNA processing and cell division. Mn regulation of inorganic pyrophosphatase (Ppa) indicated the potential involvement of phosphate metabolism in the Mn-dependent oxidative stress defense. A detailed analysis of the role of Ppa and polyphosphate kinase (Ppk) in the gonococcal oxidative stress response revealed that ppk and ppa mutant strains showed increased resistance to oxidative stress. Investigation of these mutants grown with high Mn suggests that phosphate and pyrophosphate are involved in Mn-dependent oxidative stress resistance.

1. Introduction

Neisseria gonorrhoeae, the causative agent of the sexually transmitted infection, gonorrhea, is a facultative aerobe and a host-adapted pathogen that is frequently associated with inflamed urogenital tissues and activated polymorphonuclear leukocytes (PMNs) [1, 2]. Hence, N. gonorrhoeae is routinely exposed to substantial amounts of superoxide anion (O₂.⁻), hydrogen peroxide (H₂O₂) and other reactive oxygen species (ROS), as well as reactive nitrogen species (RNS) [reviewed in 3, 4]. Oxidative stress, resulting from the action of ROS and RNS, causes damage to DNA, proteins and lipids [5-7]. The observation that N. gonorrhoeae can be isolated from PMN-laden purulent exudates, and can survive in PMNs [8] indicates that this bacterium has highly efficient defence systems to respond to oxidative stress, as previously reviewed [9].

Previous studies have shown that accumulation of manganese (Mn), via the ATP binding cassette (ABC)-type Mn transporter MntABC, protects N. gonorrhoeae from O₂.⁻ and H₂O₂ killing by a mechanism that is independent of superoxide dismutase (SOD) [10] and catalase [11], respectively. The increased resistance seen to oxidative challenge was Mn-specific; no increased resistance was seen when N. gonorrhoeae was grown with media supplemented with Co(II), Mg(II) or Zn(II) [10]. MntABC expression in N. gonorrhoeae is regulated by PerR, a transcriptional repressor from the Fur family [12]. Both mntC and perR mutants have reduced intracellular survival in a human cervical epithelial cell model [12]. Streptococcus pneumoniae has a similar Mn transport system, PsaBCA, which also plays a role in resistance to O₂.⁻ and H₂O₂, as well as in systemic virulence [13, 14].

Mn is now recognised as a key ion in the regulation of metabolism and stress responses and can play a variety of roles in cellular processes in many bacteria. As a consequence, this ion has a maior effect on virulence in several bacterial pathogens [reviewed in 15, 16]. Mn concentrations vary up to 1000 fold between different sites in the human body [16-18], providing a potential signal for N. gonorrhoeae to adapt to microenvironments within the host. Indeed, Mn regulates multiple genes in S. pneumoniae via the regulator PsaR, with Mn concentrations signalling expression of virulence factors within different host sites [19, 20]. Mn availability also affects the expression of Streptococcus mutans virulence genes differentially during planktonic or biofilm culture [21]. To investigate the precise nature of the oxidative stress resistant phenotype observed in N. gonorrhoeae grown with a Mn(II) supplement [10], we have used DNA microarray analysis and a shotgun proteomic approach that involved one dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (1D SDS-PAGE) coupled with one dimensional liquid chromatography – tandem mass spectrometry (1D LC -MS/MS) as well as isotope coded affinity tag (ICAT) studies coupled with MS/MS. The results of these studies provide new insights into the effect of Mn on the proteome of N. gonorrhoeae and the role of this ion in the oxidative stress response.

2. Experimental Procedures

2.1 Bacterial strains and culture conditions

N. gonorrhoeae strain 1291 was supplied by Dr. Michael Apicella (University of Iowa, USA). Bacteria were grown on brain heart infusion (BHI) agar or broth (Accumedia) supplemented with 10% (v/v) levinthal's base [22] and 1% (v/v) isovitalex (Becton Dickinson) at 37 °C in 5% CO₂. N. gonorrhoeae was grown on BHI agar from freezer stocks for about 22 hr and approximately ten colonies were passed in supplemented BHI broth. After 18 hr, cell density was measured and diluted to optical density at 600 nm (OD₆₀₀) ~0.5. Then, 500 l of this culture was inoculated into 5 ml of fresh BHI broth ±40 M manganese sulfate (MnSO₄) and grown in a flask on a shaking incubator for approximately 5 hr to mid-log phase (OD₆₀₀ ~ 0.5).

E.coli DH5α was cultured at 37 °C in Luria-Bertani (LB) broth or on LB-1.5% bacteriological agar (Difco) plates [23]. Ampicillin (Amp) and kanamycin (Kan) were used at a final concentration of 100 μg/ml and 50 μg/ml, respectively.

2.2 Subcellular fractionation

N. gonorrhoeae was grown as described above to mid-log phase. Cultures were harvested by centrifugati on at 6,000 rpm for 10 min at 4 °C. The cell pellet was washed with phosphate buffered saline (PBS) twice and heat killed at 56 °C for at least 30 min. Cells were sonicated for 30 sec at setting 4 in a microson ultrasonic cell disrupter (Misonix Incorporated, New York, USA) followed by cooling on ice for 30 sec; this was repeated three times. Cells were centrifuged at 5,000 rpm for 10 min to remove debris. The supernatant represented the whole-cell extract. A portion of the whole-cell extract was subjected to further sonication and centrifuged at 100,000 g for 60 min; the supernatant contained the cytoplasmic proteins. The pellet was resuspended in 10 mM Tris pH 8.0, 1% sarcosyl (N-lauroylsarcosine sodium salt) and sonicated as described above. This extract was centrifuged at 100,000 g for 60 min; the supernatant contained the cytoplasmic membrane proteins. The pellet containing the outer membrane was resuspended in 100 μl H₂0.

2.3 SDS-PAGE

The protein concentration was measured using the Bradford method [24]. An appropriate amount of total cell protein was loaded onto a SDS-PAGE gel with a 5% (v/v) acrylamide stacking gel and a 10, 12.5 or 18% (v/v) resolving gel according to Laemmli [25]. Low Molecular Weight Protein Standard (Amersham) or Protein Molecular Weight Marker (Fermentas) was used for protein standards. After electrophoresis, the gel was fixed by 10% (v/v) methanol and 7% (v/v) glacial acetic acid for 30 min and then stained by SYPRO® Ruby Protein Gel stain (Sigma) in the dark overnight. The gel was then destained by 10% (v/v) methanol and 7% (v/v) glacial acetic acid for 30 min and washed with distilled water for 10 min.

2.4 N-terminal protein sequence analysis

For the analysis of N-terminal amino acid sequences, proteins were subjected to SDS-PAGE using the Tris-Tricine system described by Schagger and von Jagow [26]. After electrophoresis, proteins were blotted onto Polyscreen polyvinylidene difluoride (PVDF) Transfer Membrane (NEN Life Science Products, Boston, USA) using CAPS buffer (10 mM 3-[cylcohexylamino]-1-propanesulfonic acid, pH 11) by the method of Towbin et al. [27]. The PVDF membrane was soaked in MilliQ water for 10 min with shaking and stained with 0.1% (w/v) Coomassie Blue R250, 50% (v/v) methanol, 10% (v/v) acetic acid for 5 min. The membrane was destained by 50% (v/v) methanol, 10% (v/v) acetic acid and rinsed in MilliQ water. The desired protein band was cut out and the N-terminal sequence of the protein was determined using a PE Biosystems 492cLC protein sequencer. “NGOxxxx” Gene ID refers to the annotation of the N. gonorrhoeae FA1090 genome strain (http://cmr.jcvi.org/tigr-scripts/CMR/GenomePage.cgi?org=ntng03).

2.5 Immunoblotting

Overnight cultures of N. gonorrhoeae were harvested from agar plates into an appropriate volume of PBS and were heat killed at 56 °C for 1 hr. Then, cell suspensions were boiled for 5 min and their protein concentrations were measured by absorbance at 280 nm. 500 μg of total cell protein was loaded onto an SDS-PAGE gel with a 5% (v/v) acrylamide stacking gel and a 12% (v/v) resolving gel [25]. The protein standard used was BenchMark™ Prestained Protein Ladder (Invitrogen). Usually, two gels were run simultaneously, one for Coomassie staining and the other for immunoblotting. Following electrophoresis, polyacrylamide gels were transferred onto nitrocellulose membrane (Bio-Rad) for 1 hr at 15 V according to Towbin et al. [27]. The immunological detection was performed by blocking in 5% (w/v) skim milk, followed by incubation with primary antibody (1/100 dilution of pilin specific SM1 [28]) for 1 hr, then secondary antibody (1/7,500 dilution of anti-mouse alkaline phosphatase conjugate; Sigma) for 1 hr and then detection of bound antibody as previously described [29].

2.6 In-gel tryptic digestion

The protein bands on 1D gels were manually excised from the gel and cut into pieces. The gel pieces were reduced with 50 mM 1,4-dithioerythreitol (DTE) (Fluka) in 25 mM ammonium bicarbonate, pH 8.5, at 37 °C for 1 hr, and subsequently alkylated with 100 mM iodoacetamide (IAA) (Fluka) in 25 mM ammonium bicarbonate, pH 8.5, at room temperature for 1 hr. The pieces were then washed twice with 50% acetonitrile (ACN) in 25 mM ammonium bicarbonate, pH 8.5 for 15 min each, dehydrated with 100% ACN for 5 min, dried and then rehydrated with a total of 22.5 ng of sequencing grade modified trypsin (Promega, Madison, WI, USA) in 25 mM ammonium bicarbonate, pH 8.5, at 37 °C for 16 hr. Following digestion, tryptic peptides were extracted twice with 50% ACN containing 5% formic acid for 15 min each with moderate sonication. The extracted solutions were pooled and evaporated to dryness under a vacuum, then the samples were analysed by the nanoLC-MS/MS system (Micromass/Waters).

2.7 ICAT

Triplicate cultures (biological replicates) of N. gonorrhoeae strain 1291 wild type were grown to exponential phase (OD₆₀₀ ~ 0.5) in the presence and absence of 40 M MnSO₄ (as described above). 500 g of total protein extracts were quantified by Cleavable ICAT Reagent Kit for Protein Labelling (Applied Biosystem, Foster City, CA, USA). This was performed according to the manufacturer's instructions. The sample was analysed by the nanoLC-MS/MS system and the data was analysed by the Micromass ProteinLynx™ Global Server (PGS) 2.0 data processing software (Micromass/Waters).

2.8 1D LC-nanoESI-MS/MS analysis for protein identification

Direct 1D LC-nano electrospray ionization (ESI)-MS/MS analyses were performed on an integrated nanoLC-MS/MS system (Mircomass) comprising a 3-pumping Micromass/Waters CapLC™ system with an autosampler, a stream select module configured for precolumn plus analytical capillary column, and a Micromass Q-Tof Ultima™ API mass spectrometer fitted with nano-LC sprayer, operated under MassLynx™ 4.0 control. Injected samples were first trapped and desalted isocratically on a C18 pre-column (5μm, 150μm ID. × 15 mm; produced in Facilities for Proteomics Research, Academia Sinica, Taiwan) for 2 min with 0.1% formic acid delivered by the auxiliary pump at 15 l/min after which the peptides were eluted from the precolumn and separated on an analytical C18 capillary column (5μm, 75 μm ID. × 25 mm) connected inline to the mass spectrometer, at 300 nl/min using a 50 and 240 min gradient of 5% to 80% ACN in 0.1% formic acid for in-gel digestion and ICAT samples, respectively.

The online nanoESI-MS survey scan and data dependent acquisition of collision-induced dissociation (CID) MS/MS were fully automated and synchronized with the nanoLC runs under the full software control of MassLynx™ 4.0. Prior to online analysis, the nanoLC sprayer and Z-spray source parameters were tuned and optimized with a 50 fmol/ l solution of glufibrinopeptide B in 50% ACN/0.1% formic acid, directly infused at 300 nl/min. Argon maintained at ~ 4.0×10⁻⁵ mbar was used as the collision gas for CID MS/MS. Calibration was performed using the product ions generated from fragmentation of the doubly charged molecular ion of glufibrinopeptide B at m/z 785.8. For routine protein identification analysis, the 1 sec survey scans were acquired over the mass range m/z 400 –2000 and a maximum of 3 concurrent MS/MS acquisitions would be triggered for 2+, 3+ and 4+ charged precursors detected at an intensity above the predefined threshold (20 counts/s). MS/MS acquisition is completed and switched back to survey scan when each of the precursor intensity falls below a predefined threshold (3 counts/s) or after a maximum of 6 sec acquisition.

After data acquisition, the individual MS/MS spectra acquired for each of the precursors within a single LC run were combined, smoothed, deisotoped (fast option, inclusive of simple transformation of multiply charged peaks) and centroided using the Micromass ProteinLynx™ Global Server (PGS) 2.0 data processing software and output as a single Mascot-searchable peak list (.pkl) file.

2.9 Protein identification and quantification

The peak list files from 1D LC-nanoESI-MS/MS were used to query the National Center for Biotechnology Information (NCBI) database using the Mascot 2.0 program (Matrix Science Ltd) with the following parameters: peptide mass tolerance, 50 ppm; MS/MS ion mass tolerance, 0.25 Da; allow up to one missed cleavage; variable modifications considered were methionine oxidation and cysteine carboxyamidomethylation. Only significant hits as defined by Mascot probability analysis were considered initially. In addition, a minimum total score of 20 comprising at least a peptide match of ion score more than 20 was arbitrarily set as the threshold for acceptance. In the case of data from 1D SDS-PAGE where the same protein may be found in more than one band, the total score for a particular protein hit comprises the best scoring peptide matches from all bands where the same protein hit was found.

2.10 Microarray analysis

Triplicate cultures (biological replicates) of N. gonorrhoeae strain 1291 wild type were grown to exponential phase (OD₆₀₀ ~ 0.5) in the presence and absence of 40 M MnSO₄ (as described above). Approximately 100 g of total RNA was prepared from each sample using the RNeasy Maxi Kit according to the manufacturer's instructions (Qiagen). The triplicate samples were pooled and the integrity and concentration of RNA was determined via micro-fluidic analysis on a bio-analyser (Agilent Technologies).

All microarray analysis was performed on N. gonorrhoeae/meningitidis genome arrays (The J. Craig Venter Institute (JCVI), formerly TIGR; http://pfgrc.jcvi.org/index.php/microarray/available_microarrays.html). Each microarray consists of 6,389 70mer oligonucleotides representing open reading frames (ORFs) from N. gonorrhoeae strains FA1090 and ATCC 700825 (reference strain), and N. meningitidis strains Z2491 (serogroup A) and MC58 (serogroup B). Methods and analysis were performed as previously described [30]. 5 g of each total RNA sample was labelled using random hexamers and direct incorporation of fluorescent Cy3- or Cy5-labelled nucleotides. The hybridisations were performed in triplicate and incorporated a dye-swap to account for dye bias. After 16 hr of hybridisation, the arrays were washed and scanned on an Agilent G2565BA microarray scanner at a 5 micron resolution. The resulting images of the hybridisations were analysed using Imagene 5.5 (BioDiscovery Inc.) and the mean foreground, mean background and spot/signal quality were determined.

All primary data was imported into an in-house installation of the comprehensive microarray relational database, BASE (http://kidney.scgap.org/base) (login: Wu 2006, password: Manganese; see experiment Wu 2006, N. gonorrhoeae vs manganese). After print-tip intensity independent Lowess normalisation, differential expression was defined using a robust statistical method rather than simple fold change. All genes were ranked using the B statistic method where both fold change and variance of signals in replicates is used to determine the likelihood that genes are truly differentially expressed. A threshold in the B statistic of 0.0 was adopted as genes with a B score >0 have a >50% probability of being truly differentially expressed [31]. The ranked B-scores for all genes in each experiment are also maintained in BASE.

2.11 Quantitative real-time PCR

Total RNA was isolated using the RNeasy kit (Qiagen) as described above. The equivalent of 1 g of the total RNA preparation was treated with RQ1 RNase-free DNase (Promega). RNA was reverse transcribed using random primers and the TaqMan® RT-PCR kit (PE Applied Biosystems) as recommended by the manufacturer. Primers were designed using Primer Express 1.0 software (ABI Prism; PE Biosystems). All quantitative Real-Time PCR (qRT-PCR) reactions were performed in triplicate in a 25 l mixture containing cDNA (5 l of 1/5 dilution), 1X SYBR Green buffer (PE Applied Biosystems) and approximately 2 M of each primer (see Error! Reference source not found. for primer sequences). 16S rRNA was used as the standard control in each quantitative PCR. Amplification and detection of specific products were performed with the ABI Prism 7700 sequence detection system (PE Applied Biosystems) with the following cycle profile: 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 sec and 60 °C for 1 min. Data was analysed with ABI Prism 7700 v1.7 analysis software. Relative gene expression between the N. gonorrhoeae wild type strain grown in the presence and absence of Mn was determined using the 2ΔΔCT relative quantification method. P values for statistical significance were determined using Students t-tests.

2.12 Cloning and mutagenesis of the ppk and ppa genes of N. gonorrhoeae

The “NGO” gene designations used below were obtained from the annotated N. gonorrhoeae strain FA1090 genome (http://cmr.jcvi.org/tigr-scripts/CMR/GenomePage.cgi?org=ntng03). Knockout constructs of the ppk (NGO0003) and ppa (NGO0223) genes were constructed via the insertion of a kanamycin-resistance cassette (pUC4Kan: Amersham Biosciences) into suitable, unique, restriction sites within the coding region of each gene, as described by Tseng et al. [10]. The ppk gene was amplified from N. gonorrhoeae strain 1291 chromosomal DNA using the primers, Ppk-for and Ppk-rev (see Error! Reference source not found, for the primer sequences) and cloned into pGEM®-T Easy (Promega). The central 801 bp portion of the ppk gene was then deleted by digestion with StuI and XcmI and replaced with a HincII DNA fragment containing the kanamycin-resistance cassette from plasmid pUC4kan. The ppa gene, plus the region 400 bp up- and downstream of this gene, was amplified using the primers, ppa-KO-F and ppa-KO-R, and cloned into pGEM®-T Easy. The kanamycin-resistance cassette was cloned into the PflMI restriction endonuclease site located within ppa. Mutant strains were generated by digesting pGEMppk::kan with NotI and pGEMppa::kan with AlUI followed by transforming these linearised fragments into N. gonorrhoeae strain 1291. Recombinant strains were selected by growth on BHI agar containing kanamycin (100 g/ml) as described by Jennings et al. [32]. Previous work has demonstrated that the pUC4kan kanamycin cassette has no promoter nor terminator that is active in Neisseria and will neither affect transcription nor have a polar effect on expression of adjacent genes [32, 33].

2.13 SOD assay

Cell free extracts of N. gonorrhoeae strains were prepared by resuspending an equal amount of cells (as determined by equal optical density of samples at 600 nm) in PBS, followed by three cycles of freezing and thawing. Cell debris was removed by centrifugation at 13,000 rpm for 20 min, and the supernatant was collected. Protein concentration of samples, approximated by absorbance at 280 nm, was used to normalise samples. The SOD assay was performed as described by Crapo et al. [34]. A 500 μl mixture was prepared containing 50 μl of 0.1 mM cytochrome c (Sigma), 250 μl of 0.1 mM xanthine and 190 μl of potassium buffer (+/− the sample) and the reaction was initiated by adding 10 μl of 175 mU/ml xanthine oxidase. The rate of increase in absorbance at 550 nm was recorded. A unit is defined as the quantity of SOD required to produce 50% inhibition of the rate of reduction of cytochrome c under the specified conditions. P values for statistical significance were determined using Students t-tests.

2.14 Pyrophosphatase assay

Samples were prepared as described above for the SOD assay. The pyrophosphatase assay is based on the method described by Heinonen and Lahti [35]. The assay mixture was prepared containing 500 l of 50 mM Tris-HCl, pH 8 and 1 mM MgCl₂, 20 l 1.7 mM Na-pyrophosphate, and 50 l of cell free extract. The reaction was incubated at 37 °C for 30 min then stopped with 100 μl of 100 mM citric acid. 120 l of the assay mix was then mixed with 1 ml of detection solution (1 volume of 10 mM ammonium-molybdate, 1 volume of 5 N sulfuric acid, 2 volumes of acetone). The amount of phosphomolybdate was determined by measuring the absorbance at 420 nm. P values for statistical significance were determined using Students t-tests.

2.15 Oxidative stress killing assays

Paraquat (PQ) [36], xanthine/xanthine oxidase (X/XO) [37] and H₂O₂ [38] killing assays were performed using the established methods described by Tseng et al. [10]. Briefly, cells from agar plates were harvested, resuspended in PBS, and 10⁵ to 10⁷ cells were added to a solution of BHI broth to a final volume of 100 l. The killing assay was started by the addition of a final concentration of either 10 mM PQ (Sigma), 4.3 mM xanthine and 300mU/ml xanthine oxidase (Sigma), or 40 mM H₂O₂ (Riedel-de Haen). Cultures were incubated at 37 °C/5%CO₂. At various time points, samples were taken, serially diluted, plated onto BHI agar and incubated at 37 °C in 5% CO₂to determine colony forming units (CFU). Experiments were done in triplicate and repeated on at least three occasions, with representative results shown. P-values were performed using student's t-test. Differences seen between strains and growth conditions were considered significant if the P-value was ≤ 0.05. Safety considerations: Paraquat is very toxic by inhalation, ingestion and if absorbed through skin.

2.16 Assay for the survival of N. gonorrhoeae in primary human cervical epithelial cells

Primary human cervical epithelial (pex) cells were procured and maintained as described previously [39]. Confluent cell monolayers were challenged with the wild type or mutant gonococci at a multiplicity of infection of 100. Association, invasion, and survival assays were performed as we have described previously using a modified gentamicin-survival assay [30]. Association is defined as the number of extra- and intracellular bacteria associated with pex cells at 90 min post-infection following extensive rinsing of the cell monolayer. Invasion is defined as the number of gonococci that survive gentamicin treatment (100 g ml⁻¹; 30 min) subsequent to a 90 min challenge of pex cells. The ability of gonococci to survive within pex cells was determined by rinsing and then re-incubating (37 °C, 5% CO₂) the infected pex cell monolayers in antibiotic-free medium for an additional 1 h (i.e., survival 1h) or 2 h (i.e., survival 2h) time period following gentamicin treatment. At each time point, viable gonococci were enumerated by counting CFUs obtained from plating serial dilutions of the pex cell lysates. Percent association, invasion, or survival was determined as a function of the original inoculum and the mean number of CFUs calculated for each condition assayed. P-values were determined using a Kruskal-Wallis non-parametric analysis of variance.

3 Results

3.1 The effect of Mn on the transcriptome and proteome of N. gonorrhoeae Microarray analysis of Mn-dependent regulation

To examine the effect of Mn on transcription in N. gonorrhoeae, gene expression in N. gonorrhoeae strain 1291 was investigated using N. gonorrhoeae / N. meningitidis genome microarrays (JCVI). Total RNA was isolated from wild type strain cultures that had been grown to exponential phase in the presence or absence of added Mn (±40 M MnSO₄). N. gonorrhoeae strain 1291 grows at an equal rate in media ± 40 M MnSO₄ (data not shown). Growth in the presence of higher Mn did not result in a significant change in the expression level of any gene within N. gonorrhoeae, as determined using a cut-off of 1.5 fold change in expression and a threshold in the B statistic of > 0 (See Experimental procedures). Results from the microarray analysis were confirmed using quantitative real time (qRT)-PCR on a selection of genes (see footnotes of Tables 2 and 3 for details). This result suggested that the Mn-dependent resistance to oxidative stress that is seen in N. gonorrhoeae may be mediated by post-transcriptional mechanisms.

Table 2.

1D SDS-PAGE analyses comparing the cell fractions of N. gonorrhoeae strain 1291 grown in the absence and presence of 40 M Mn(II)

Gene Numbera	Protein Name	Gene Name	Classb	Theoretical Mr (Da)
Proteins with increased expression in the presence of Mn
Soluble fractions:
NGO0335	polyribonucleotide nucleoti dyltransferase/Phosphorylase	pnp	A	76448
NGO0199	transcription termination factor rho	rho	A	47308
NGO1974	elongation factor EF-Tu (elongation factor TS)	tSf / EF-Tu	B	30345
NGO1843	translation elongation factor EF-G	fusA	B	77167
NGO1824	30S ribosomal protein S5	rpsE	B	18231
NGO2025	30S ribosomal protein S9	rpsI	B	14363
NGO1838	50S ribosomal protein L3	rpIC	B	22663
NGO1837	50S ribosomal protein L4	rpID	B	23288
NGO0584	50S ribosomal protein L9	rpII	B	15687
NGO1853	50S ribosomal protein L10	rpIJ	B	17589
NGO1855	50S ribosomal protein L11	rpIK	B	14942
NGO0298	50S ribosomal protein L20	rpIT	B	13664
NGO0710	A/G-specific adenine glycosylase	mutY	E	39542
NGO0398	adenylosuccinate synthetase	purA	F	45970
NGO0353	uracil phosphoribosyltransferase	upp	F	22863
NGO1241	histidinol-phosphate aminotransferase	hisC	G	39245
NGO1358	glutamate dehydrogenase	gdhA	G	48462
NGO0040	glutamate 1-semialdehyde 2,1-aminotransferase	hemL/ gsa	H	44999
NGO1931	glyceraldehyde 3-phosphate dehydrogenase C	gapC	I	35748
NGO1082	isocitrate dehydrogenase	idh	I	79943
NGO0921	succinate dehydrogenase flavoprotein subunit	dhsA/sdhA	I	64441
NGO0687	ferredoxin--NADP reductase	fenR	I	29317
NGO0829	chaperone protein	hscA	J	66413
NGO2095	heat shock protein, 60 kD subunit (GroEL)	groEL	J	57342
NGO0450	iron-superoxide dismutase* ~	sodB	K	17395
NGO0794	bacterioferritin A	bfrA	L	17962
NGO0832	oxidoreductase, short chain reductase family	N/A	M	25965
NGO1709	conserved hypothetical protein	N/A	N	21913
NGO1583	conserved hypothetical protein	N/A	N	40892
NGO0361	conserved hypothetical protein (possible hemY)	N/A	N	45187
NGO0571	conserved hypothetical protein (possible MP)	N/A	N	65933
NGO0156	conserved hypothetica, possible lipid A synthesis	N/A	N	30975
NGO1043	conserved hypothetical protein	N/A	N	11395
NGO1635	hypothetical protein	N/A	P	17060
Membrane fractions:
NGO0096	PilO / pilus assembly protein	pilO	O	23330
NGO1673	type IV pilus assembly protein (PilF)	pilF	O	61882
NGO1806	UDP-N-acetylglucosamine acyltransferase	lpxA	O	28157
NGO1067 /NGO1972	MafA adhesin - Neisseria specific	mafA	O	34738
NGO0994	H.8 OMP (azurin-like protein, Laz)	azu / laz/ H.8	O	18516
NGO1812	Neisseria-specific major OMP porin P.IB	pIB	O	37174
NGO1780	probable outer membrane lipoprotein	omlA	O	13904
NG1577	OMP PIII, Omp3 (OMP class 4, RmpM)	omp3	O	25525
NGO2147	ATP synthase delta chain	atpH	I	19482
NGO1363	multidrug efflux pump channel protein	mtrE	Q	50401
NGO1765	probable glycosyltransferase	pglA	B	41995
NGO2057	Integral MP	N/A	M	30694
NGO1800	conserved hypothetical protein (possible integral MP)	N/A	N	48088
Proteins with decreased expression in the presence of Mn
Soluble fractions:
NGO0002	DNA polymerase III, beta subunit	dnaN	E	40857
NGO0259	ribonuclease III	rnc	A	26934
NGO1858	translation elongation factor Tu, TufA	tufA	B	42926
NGO1832	30S ribosomal protein S3	rpsC	B	25811
NGO1844	30S ribosomal protein S7	rpsG	B	17629
NGO1826	30S ribosomal protein S8	rpsH	B	14108
NGO1854	50S ribosomal protein L1	rplA	B	24107
NGO1829	50S ribosomal protein L14	rplN	B	13387
NGO1823	50S ribosomal protein L15	rplO	B	14938
NGO18311	50S ribosomal protein L16	rl16	B	14776
NGO18241	50S ribosomal protein L18	rl18	B	12781
NGO0171	50S ribosomal protein L19	rl19	B	13751
NGO1676	50S ribosomal protein L21	rplU	B	11431
NGO1828	50S ribosomal protein L24	rplX	B	11591
NGO0442	50S ribosomal protein L25	rplY	B	20939
NGO1454	lysyl-tRNA synthetase (LysRS)	lysS	B	57370
NGO0799	inosine-5′-monophosphate dehydrogenase	imdH	F	52429
NGO1667	2,3,4,5-tetrahydropyridine-2-carboxylate N-succinyltransferase, DapD	dapD	G	29291
NGO1238	ATP phosphoribosyltransferase	hisG	G	26232
NGO1134	GTP cyclohydrolase II	gch2	H	22098
NGO1310	guanylate kinase / GMP kinase	Gmk/kguA	F	23412
NGO1668	glucose-6-phosphate isomerase	pgi	I	60308
NGO0918	citrate synthase	cisY/gltA	I	48110
NGO0912	succinyl-CoA synthetase, alpha subunit	sucD	I	30536
NGO1743	NADH dehydrogenase I chain I	nuol	I	18790
NGO0116	protein-export protein subunit SecB	secB	C	16317
NGO2141	chromosome segregation protein SpoOJ (ParB family)	spooJ/parB	D	31518
NGO1815	septum site-determining protein	minD	D	29581
NGO1422	heat shock protein/ HSP-70 cofactor; nucleotide exchange factor	grpE	J	21335
NGO1901	heat shock protein HSP-40/chaperone DnaJ	dnaJ	J	40590
NGO1378	transport protein, ExbB	exbB	L	25836
NGO0425	RdgC homolog / phosphatase	rdgC	Q	23134
NGO0561	conserved hypothetical protein	N/A	N	57081
NGO0905	conserved hypothetical protein	N/A	N	25780
NGO1280	conserved hypothetical protein	N/A	N	53783
NGO1709	conserved hypothetical protein	N/A	N	21913
NGO1655	Neisseria-specific protein, uncharacterized	N/A	N	28555
NGO0387	conserved hypothetical protein	N/A	N	28733
NGO1656	possible cell-binding factor (possible protein export)	N/A	M	31514
NGO1873	conserved hypothetical protein	N/A	N	45436
Membrane fractions:
NGO2061	pilin (fimbrial protein)	pilE	O	10386
NGO0055	pilus-associated protein, PilC1	pilC1	O	115036
NGO0094	pilus secretion protein; OMP-molecular complex, type II secretion pathway D protein	pilQ	O	77943
NGO0070	OMP opacity protein B, opaB	P.II / opaB	O	29630
NGO1076	OMP opacity protein (Opa protein)	opaH /opaK	O	28339
NGO0915	dihydrolipoamide dehydrogenase E3 component	dldH	I	50068
NGO2150	ATP synthase beta chain (ATPase beta-subunit)	atpD	I	50413
NGO1495	transferrin binding protein A	tbp-1/ tbpA	L	101940
NGO2059	peptide methionine sulfoxide reductase, PilB	msrAB /pilB	Q	58047
NGO2118	conserved hypothetical protein (possible MSD element in ABC transport system)	N/A	N	19526
NGO0284	Neisseria-specific protein, uncharacterized	N/A	R	15725

^a"NGO" gene designations were obtained from the annotated N. gonorrhoeae strain FA1090 genome (http://cmr.jcvi.org/tigr-scripts/CMR/GenomePage.cgi?org=ntng03).

^bFunctional classifications as defined by the JCVI website (http://cmr.jcvi.org/tigrscripts/CMR/shared/RoleList.cgi) are included solely as a reference-point for this large group of proteins. A: Transcription; B: Translation; C: Cellular processes; Protein and peptide secretion; D: Cellular processes; Cell division; E: Replication; DNA replication, restriction, modification, recombination, and repair; F: Purines, pyrimidines, nucleosides, and nucleotides; G: Amino acid biosynthesis; H: Biosynthesis of cofactors, prosthetic groups, and carriers; I: Energy metabolism; J: Cellular processes; Chaperones; K: Cellular processes; Detoxification; L: Transport and binding proteins; M: Unassigned; N: Unknown; O: Cell envelope; P: Hypothetical; Q: Other categories; R: Neisseria -specific protein

^*Using a biochemical assay for SOD activity it was found that cells grown on Mn had approximately 2.5 fold higher SOD activity than cells grown in the absence of added Mn (P=0.01 using a student's t-test).

^~qRT-PCR was used to confirm microarray results. The ratio of transcription of these genes, wild type:wild type plus Mn, was below 1.5 fold (P >0.4).

N/A: Not available. OMP: outer membrane protein. MP: membrane protein.

Table 3.

Differentially expressed proteins in N. gonorrhoeae strain 1291 grown in the absence and presence of 40 M Mn from ICAT. The proteins listed are either down- or up- regulated by Mn

Gene Numbera	Protein Name	Gene Name	Classb	Light/High area Ratioc
Increased expression in the presence of Mn
Soluble fractions:
NGO0794	Bacteriofemtin §	bfrA	L	0.5
Reduced expression in the presence of Mn
Soluble fractions:
NGO1845	30S ribosomal protein S12	rplS	B	2.1±0.56
NGO1835	50S ribosomal protein L2	rplB	B	1.57
NGO1858	translation elongation factor Tu, TufA §	tufA	B	2.1±0.44
NGO1227	Cytosol leucyl aminopeptidase, LAP (aminopeptidase A)	ampA/pepA /lap	B	1.9
NGO0564	dihydrolipoamide S-acetyltransferase complex, E2 component of pyruvate dehydrogenase	aceF	I	1.810.45
NGO0249	acetyl-CoA carboxylase, beta subunit	accD	S	2.75
NGO0200	phosphoenolpyruvate (PEP) synthase ~	ppsA	T	2.2±1.05
NGO0223	inorganic pyrophosphatase* ~	ppa	T	4.7±2.82
NGO1521	acetate kinase	ackA	T	4.1±2.84
NGO0926	peroxiredoxin 2 family protein/glutaredoxin	prx	K	4.0±1.26
NGO2095	heat shock protein , 60 kD subunit	groEL	J	3.6±2.33
NGO1046	endopeptidase Clp ATP-binding chain B / heat shock protein F84.1	clpB	Q	4.2±3.67
NGO0186	zinc binding alcohol dehydrogenase	aid	M	2.9±1.83
Membrane fractions:
NGO0346	pilus retraction, twitching motility protein	pilT	O	1.91±1.30
NGO0562	pyruvate E3 component, lipoamide dehydrogenase / glycine cleavage L protein (OMP P64k or PM 6) §	ipdA/dldH	T	3.06±2.15
NGO0177	two-component system transcriptional response regulator OmpR	ompR/cpxR	U	3.20

^a"NGO" gene designations were obtained from the annotated N. gonorrhoeae strain FA1090 genome (http://cmr.jcvi.org/tigr-scripts/CMR/GenomePage.cgi?org=ntng03).

^bSee the functional classification in Table 2.

^cThe cutoff of the ICAT experiment is 1.5-fold. The ratio is the mean of three independent ICAT experiments ± standard deviation.

^§The proteins were also seen to have different expression in response to Mn by 1D SDS-PAGE.

^*Using a biochemical assay for Ppa activity it was found that cells grown on Mn had approximately 1.9 fold less activity than cells grown in the absence of added Mn (P= 0.019 using a student's t-test).

^~qRT-PCR was used to confirm microarray results. The ratio of transcription of these genes, wild type:wild type plus Mn, was below 1.5 fold (P>0.4).

1D SDS-PAGE analysis of the effect of Mn on protein expression in N. gonorrhoeae

To investigate this possibility of Mn-dependent post-transcriptional regulation, we conducted a detailed analysis of the effect of Mn on the proteome of N. gonorrhoeae. A shotgun proteomic approach was used which involved two separate methods to identify Mn-regulated proteins, (1) 1D SDS-PAGE coupled with 1D LC-MS/MS and (2) ICAT studies coupled with MS/MS. This shotgun approach was used rather than 2D-gel based proteome profiling as the development of methods and instrumentation for automated data-dependent ESI MS/MS, in conjunction with nanoLC and database searching, has significantly increased the sensitivity and speed for the identification of gel-separated proteins [40, 41]. For 1D SDS-PAGE analysis, cells grown to exponential phase in the presence or absence of added Mn (under the same conditions used for the transcriptomic studies described above) were fractionated into different cell compartments and visualised on 1D gels with varying percentage polyacrylamide and size in order to reduce the complexity of the whole-cell sample. A total of 97 proteins were identified by LC-ESI-MS/MS as having a different level of expression between samples grown in the presence and absence of Mn (Error! Reference source not found.; representative gels are shown in Figure 1). 1D SDS-PAGE is a semi-quantitative method, therefore Error! Reference source not found. only includes proteins that have obviously altered expression (i.e. present versus absent) in the presence of low or high Mn and does not include quantitative information, unlike the ICAT results, which quantitatively identify differentially regulated proteins. In the presence of Mn, 47 proteins showed an increased level of expression. These proteins were found both in the soluble fraction and the membrane fractions and had diverse roles in metabolism, biosynthesis of cellular compounds, protein synthesis, stress defences and virulence (Error! Reference source not found.). The levels of expression of bacterioferritin (Bfr) [42], azurin (Laz) [43] (Figure 1A) and iron-superoxide dismutase (SodB) [44] were higher with increased Mn. These proteins are all associated with defense against oxidative stress. However, decreased levels of MsrAB, an outer membrane methionine sulfoxide reductase involved in protection from O₂.⁻ and H₂O₂ [45], were seen. Several proteins showing increased expression in the presence of Mn in the membrane fractions were potential virulence factors, including the major gonococcal outer membrane protein (OMP) Porin IB, and the adhesin MafA (Figure 1B).

Figure 1.

Representative 1D SDS-PAGE analyses comparing the soluble fractions of N. gonorrhoeae strain 1291 grown in the absence (−) and presence (+) of 40 M Mn(II) on (A) 1D 12.5% 7 cm, (B) 10% 18 cm gels. Total: total cell lysates; soluble: cytoplasmic and periplasmic proteins. CM: cytoplasmic membrane proteins; OM: outer membrane proteins. The numbers and protein names indicate examples of proteins showing differences in expression level between the control and Mn-treated sample.

A total of 50 proteins showed decreased expression in the presence of Mn (Error! Reference source not found.). Again, Mn-regulated proteins in the soluble fraction can be classified into several functional categories including metabolism, biosynthesis, protein synthesis, RNA processing, cell defence, cell division and transport. Several proteins in the membrane fraction that are decreased in the presence of Mn are involved in pilus biogenesis (Error! Reference source not found., Figure 1 and Figure 2), including PilE (structural subunit protein pilin), PilC1 (involved in pilus assembly and biogenesis) and PilQ (involved in translocation of pili to the cell surface) [46]. However, it is interesting to note that PilO, which functions in competence for transformation [47], was increased in the presence of Mn (Error! Reference source not found.). Other decreased OMPs include virulence factors, such as transferrin-binding protein A [48] and Opa [49, 50]. The cytoplasmic stress protein DnaJ [51] was also decreased in the presence of Mn. This stress protein was present in the outer membrane (OM) preparation indicating contamination of this fraction from the cytoplasmic fraction. Ribosomal proteins decreased in the presence of Mn were also present in the cytoplasmic membrane fractions instead of the cytoplasmic fraction. Cell fractions were primarily used to enable easier separation and identification of proteins, so cross fraction contamination was not considered to be a significant issue. However, these ribosomal proteins are often highly abundant and may obscure other membrane proteins in SDS-PAGE analysis [52]. These 1D SDS-PAGE results indicate that Mn is an important global regulator in N. gonorrhoeae and led to further quantitative investigation.

Figure 2.

(A) Coomassie stained SDS-PAGE, (B) Western blot and (C) Northern blot of Mn(II) regulated proteins in N. gonorrhoeae. Panel A, N. gonorrhoeae wild type (WT) cells were grown on BHI agar ±40 M MnSO₄. Identical loadings of total cell protein were run on a 12% SDS-PAGE gel and Coomassie stained. A band of 17.3 kDa (calc.) is indicated that displayed a four-fold decrease in the presence of 40 M Mn (determined by densitometry in several independent experiments). Panel B, Western blot analysis of whole cells of N. gonorrhoeae strain 1291. Samples were run on a 12% SDS-PAGE gel, transferred to nitrocellulose and probed with the pilin specific probe, SM1. Panel C, Northern blot analysis of RNA isolated from N. gonorrhoeae strain 1291 WT grown on BHI agar ± 40 μM MnSO₄, probed with a pilE specific probe (amplified by the PilEsignalF and PilEsignalR primers, see Table 1).

ICAT analysis of Mn-dependent regulation in N. gonorrhoeae

For quantitative proteomics, a combination of ICAT and MS-MS was employed. ICAT is currently one of the most widely adopted isotopic labeling approaches [53, 54]. The ICAT proteomic analysis revealed that the level of bacterioferritin was increased by greater than 1.5 fold by Mn. On the other hand, 16 proteins were decreased by greater than 1.5 fold in the presence of added Mn, including PilT (involved in pili retraction), peroxiredoxin (Prx; involved in peroxide reduction), OMP P64k (M_r=64 kDa), OmpR (M_r=25 kDa) and pyrophosphatase (Ppa), (Error! Reference source not found.). OMP P64k is present in the majority of the meningococcal strains [55], elicits bactericidal antibodies in animal models and has been considered as a potential vaccine candidate [56]. Of particular interest is Ppa, which hydrolyses pyrophosphate (PPi) to orthophosphate (Pi), since PPi can stabilise Mn(III) ions [57].

3.2 Post-transcriptional Mn-dependent regulation of pilin, superoxide dismutase and pyrophosphatase

The proteomic and genomic analyses described above show that the level of several proteins in N. gonorrhoeae is affected by the concentration of Mn present in the growth media, but that transcription of the genes encoding these proteins is unaltered under the same conditions. To further investigate this finding and to confirm that Mn-dependent regulation of protein levels is post-transcriptional, three of the Mn-regulated proteins, Pilin, Ppa and SOD, were further examined.

Pilin expression is down-regulated by Mn

Our preliminary investigations of the Mn-dependent response of N. gonorrhoeae involved an examination of protein expression in wild type strain 1291 cells grown on medium ± 40 μM Mn(II) by analysing polypeptide profiles in whole cell lysates after 1D SDS-PAGE and Coomassie staining. The most striking observation was a decrease in the level of a 17.3 kDa protein in the presence of high Mn(II) (4-fold by densitometry, Figure 2A). N-terminal amino acid sequencing of this polypeptide was performed and it was determined to be identical to the N-terminal sequence of the pili subunit protein, pilin, which is encoded by pilE(NGO2061). Pili are long polymeric proteins that protrude from the bacterial surface and have a crucial role in both bacterial colonization and adherence to host cells [58, 59].

We further investigated pilin expression by western blot analysis using a pilin-specific monoclonal antibody, SM1, in the wild type strain 1291 grown under different conditions. The western blot shows that N. gonorrhoeae wild type has decreased pilin production when grown on Mn-supplemented medium (Figure 2B), which is in agreement with the Coomassie stained SDS-PAGE results described above (Figure 2A). Addition of EDTA to growth media caused induction of pilin production, presumably by chelating Mn(II) and preventing Mn(II)-dependent suppression of expression (Figure 2B).

The level of pilE transcription in northern blot analysis was similar between N. gonorrhoeae 1291 grown with and without Mn(II) supplementation (Figure 2C), indicating that Mn(II) regulation of pilin expression is post-transcriptional.

SOD activity is increased in the presence of Mn

SOD is a major component of the oxidative defence response of the majority of organisms and catalyses the disproportionation of superoxide to hydrogen peroxide and water [60, 61]. 1D SDS-PAGE analysis revealed that addition of Mn to growth media resulted in an increased level of SodB (Error! Reference source not found.). Using a biochemical assay for SOD activity it was found that cells grown on Mn had an average of 2.5 fold higher SOD activity than cells grown in the absence of added Mn (P-value = 0.01; data not shown). Expression of the sodB gene was not significantly altered between cultures grown in the presence versus the absence of Mn (qRT-PCR; 1.21 fold, P-value = 0.53), indicating that the difference in activity is a result of Mn-dependent post-transcriptional regulation.

Pyrophosphatase activity is reduced in the presence of Mn

Soluble inorganic pyrophosphatases hydrolyse inorganic pyrophosphate (PPi) into two molecules of orthophosphate (Pi), thus making it possible for many biosynthetic reactions to proceed [62]. ICAT analysis revealed that addition of Mn to growth media resulted in a 4.7 ± 2.82 fold decrease in the level of Ppa (Error! Reference source not found.). Using a biochemical assay for Ppa activity it was found that cells grown on Mn had approximately 2 fold less activity than cells grown in the absence of added Mn (P= 0.019; data not shown). In addition to the decreased Ppa protein level seen in the ICAT result, growth in the presence of high Mn levels could result in this decrease in Ppa activity via displacement of Mg by Mn at the active site. The majority of Ppa proteins have higher activity when cofactored with Mg than Mn [63], however some Ppa proteins have a unique requirement for Mn [64]. No significant difference was seen in expression of the ppa gene between cultures grown in the presence versus absence of Mn (qRT-PCR: 1.29 fold, P-value = 0.47), indicating that the difference in activity is a result of Mn-dependent post-transcriptional regulation.

3.3 Ppa and Ppk of N. gonorrhoeae

Interestingly, both ICAT and enzymatic assay demonstrated that in the presence of Mn(II), the level of expression of pyrophosphatase (Ppa) decreased. These results are consistent with previous studies that have outlined the relationships between Mn, PPi, polyphosphate (polyP) and oxidative stress. In lactic acid bacteria, high concentrations of Mn(II) (about 30 mM) accumulate within the cytoplasm, chelated by polyP, providing a SOD-independent mechanism of resistance to oxidative stress [65, 66]. PolyP, a polymer of large numbers (>100) of orthophosphate (Pi), can chelate Mn(II) and is linked to the various functions in several pathogens [67]. PolyP is synthesised from Pi by polyphosphate kinase (Ppk), and hydrolysed to Pi by exopolyphosphatase (Ppx). PPi can also stabilize Mn(III) ions [57], preventing spontaneous dismutation to Mn(II) and Mn(IV). PPi is hydrolysed to Pi by pyrophosphatase (Ppa). It is established that the pathogenic Neisseria can accumulate up to 10% of their phosphate as polyP. In E. coli, ppk mutants that lack Ppk activity and are unable to synthesize polyP from Pi, are sensitive to oxidative, osmotic and heat stresses and have decreased survival in stationary phase [68]. Some of the properties of a N. gonorrhoeae mutant lacking the ppk gene have been described [69], although the affect of Ppk on resistance to oxidative stress was not reported.

To determine whether PP_i or polyP or are involved in the oxidative stress response, in particular the Mn-dependent oxidative stress response of N. gonorrhoeae, mutant strains lacking the genes encoding ppk or ppa were generated. In E. coli and Vibrio cholerae, the ppk and ppx genes are adjacent and form an operon [70]. However, in N. gonorrhoeae ppk (NGO0003) is flanked by the dnaN gene at its 3’ end and by two genes encoding hypothetical proteins at the 5’ end. Thus, it appears that ppk is probably monocistronic. The ppa gene (NGO0223) is flanked by an uncharacterised gene at its 3’ end and the ntpA (nucleoside triphosphate pyrophosphohydrolase) gene at its 5’ end. Kornberg and coworkers have shown that a number of bacteria contain a second ppk gene that encodes an enzyme (Ppk2) with distinct biochemical properties, including preference for GTP over ATP as a substrate [71]. In their search of incomplete microbial genomes these researchers established that N. gonorrhoeae possessed a single ppk gene encoding the enzyme that is the homologue of PPK1. Our more recent search of the annotated N. gonorrhoeae genome (http://cmr.jcvi.org/tigr-scripts/CMR/GenomePage.cgi?org=ntng03) confirmed the presence of a single ppk gene (NGO0003).

Tinsley and Gotschlich [69] have shown that a ppk mutant of N. gonorrhoeae was defective in growth on a defined medium. Using the richer growth medium, BHI broth, we observed no significant differences in growth rate and growth yield between wild type and the ppk mutant (data not shown). As a consequence, we were able to comparatively analyse differences between these strains with confidence that our data were not the result of differences in growth rate. However, the ppa strain did have a slightly increased lag phase with respect to the wild type strain (data not shown).

Oxidative stress response of N. gonorrhoeae ppk and ppa mutant strains

To determine whether Ppk and Ppa contribute to the defence of gonococci against oxidative stress, we compared the survival capability of wild type strain 1291 and ppk and ppa mutant cells after exposure to H₂O₂ as well as to two generators of O₂.⁻: PQ, which generates O₂.⁻ inside the cell, and X/XO, which generates O₂.⁻ and H₂O₂ external to the cell, as described previously [10].

As mentioned above, we have previously observed that accumulation of Mn(II) by N. gonorrhoeae cells correlates with resistance to oxidative killing [10], and Figure 3 and 4 show that there was a significant increase in survival of wild type cells grown in the presence of Mn compared to cells grown without Mn supplementation in all assays.

Figure 3.

(A) Paraquat, (B) xanthine-xanthine oxidase and (C) hydrogen peroxide oxidative stress killing assays of N. gonorrhoeae strain 1291 (wild type) and the ppk mutant strains grown on BHI agar or BHI plus 100 M Mn (Mn). Experiments were performed in triplicate. Error bars indicate ±1 standard deviation of the mean. P values were determined using Students t-tests. Mn protected the wild type cells in all assays; PQ (on average approximately 2000-fold higher survival at 60 min), X/XO (approximately 6000-fold at 60 min) and H₂O₂ (approximately 5-fold at 60 min; P <0.05 at the final time point for all assays). The ppk mutant was slightly more resistant than the wild type to PQ with increased survival seen in the absence of Mn (2.1-fold at 30 min, P=0.016; equal at 60 min, P=0.37) and the presence of Mn (2.2-fold at 30 min, P=0.011; equal at 60 min, P=0.069). The ppk mutant was significantly more resistant to H₂O₂ than was the wild type with increased survival seen in both the absence (25-fold at 60 min, P=0.00005) and the presence of Mn (21-fold at 60 min, P=0.0004). Mn protected the ppk mutant in all assays; PQ (>3000-fold at 60 min, P=0.014), X/XO (>4000-fold at 60 min, P=0.041) and H₂O₂ (6-fold at 60 min, P=0.001).

Figure 4.

(A) Paraquat, (B) xanthine-xanthine oxidase and (C) hydrogen peroxide oxidative stress killing assays of N. gonorrhoeae strain 1291 (wild type) and the ppa mutant strain. Experiments were performed in triplicate. Error bars indicate ±1 standard deviation of the mean. P values were determined using Students t-tests. The ppa mutant was more resistant than was the wild type strain to killing by PQ in the absence of Mn (>5000-fold at 60 min, P=0.001) and in the presence of Mn (8-fold at 60 min, P=0.004). Increased resistance was also seen in the ppa mutant in the X/XO assay in the absence of Mn (>1300-fold at 60 min, P=0.016) and presence of Mn (5-fold increase in survival at 60 min, P=0.011), and the H₂O₂ assay in the absence of Mn (2.4-fold at 60 min, P=0.0043) and presence of Mn (4.2-fold at 30 min, P=0.008; >5000-fold increase at 60 min, P=0.05). Growth of the ppa mutant in the presence of Mn did not provide protection (with respect to the ppa mutant on unsuplemented media) in the PQ assay (3-fold at 60 min, P= 0.001) or the X/XO assay (4.5-fold at 60 min, P=0.011) and the difference seen in the H₂O₂ assay is not significant as judged by a P-value > 0.5 (5-fold at 30 min, P=0.008; 4-fold at 60 min, P=0.055).

The ppk mutant was slightly more resistant than the wild type to PQ (Figure 3A) with increased survival seen in the absence and the presence of Mn. The ppk mutant behaved like the wild type in the X/XO assay (Figure 3B) but was significantly more resistant to H₂O₂ (Figure 3C) than was the wild type with increased survival seen in both the absence and the presence of Mn. The ppk mutant grown on Mn also exhibited enhanced survival compared to the ppk mutant cells grown on medium without Mn-supplementation in all assays (Figure 3A-C).

The ppa mutant was more resistant than was the wild type strain to killing by PQ (Figure 4A) with an increase in survival seen in both the absence and presence of Mn. Increased resistance was also seen in the ppa mutant in the X/XO assay (Figure 4B) and H₂O₂ assay (Figure 4C) in both the absence and presence of Mn. However, growth of the ppa mutant in the presence of Mn did not provide protection against ROS to the extent typically seen for the wild type in the PQ assay or the X/XO assay and the difference seen in the H₂O₂ assay is not significant as judged by a P-value > 0.5 (Figure 4A-C). This decreased Mn-mediated protection against ROS in ppa suggests that the protection of cells against oxidative stress by Mn may involve Mn-PP_i complexes.

Survival of ppk and ppa mutant gonococci in primary cervical cells

N. gonorrhoeae adherence to and invasion of epithelial cells is a complex process that is mediated by several factors [72, 73]. We evaluated the ability of wild type and ppk and ppa mutant gonococci to associate with, to invade, and to survive within pex cells, using a modified gentamicin-survival assay as we have described previously [12, 30]. Figure 5 demonstrates that the wild type gonococci and the ppk and ppa mutants exhibited a similar degree of association with pex cells (P-values ≥ 0.67, as determined using a Kruskal-Wallis non-parametric analysis of variance). However, both of these mutant gonococcus strains exhibited a distinct phenotype in their ability to invade and to survive within pex cells upon comparison to the wild type bacteria. Consistent with our previous studies, the wild type gonococci were able to invade and survive one-hour post gentamicin treatment of pex. At two hours following gentamicin treatment the number of viable wild type gonococci had more than doubled, presumably indicating growth within pex cells.

Figure 5.

Gonococcal association with and intracellular survival within primary human cervical epithelial (pex) cells. The histogram shows the mean percent association, invasion and survival as a function of the original inoculum of the N. gonorrhoeae wild type strain (WT), and the ppk and ppa mutant strains. Data, determined from the number of colony forming units formed upon plating of the cervical cell lysates, were obtained from three experiments performed in triplicate. Y-error bars show +/− 1 variance. P-values were determined using a Kruskal-Wallis non-parametric analysis of variance.

Although the ppk mutant gonococci were not significantly impaired in their ability to invade pex cells when compared to the wild type (96% invasion relative to the wild type, P=0.67), they had decreased survival within pex cells relative to the wild type at the one-hour post gentamicin treatment time point (75%, P-value= 0.0001). At the two-hours post gentamicin treatment the number of viable ppk gonococci was further decreased both with respect to the previous time point (55%) and the wild type strain (16%, P-value= 0.0001), suggesting a role for polyP synthesis in the intracellular survival of gonococci.

The ppa mutant displayed an increased invasive phenotype relative to the wild type strain (126%, P=0.0001) but showed decreased intracellular survival relative to the wild type by one-hour post gentamicin treatment (69%, P=0.0001). However, by two-hours post gentamicin treatment the number of viable ppa mutant gonococci had increased with respect to the previous time point (141%), but still had decreased survival with respect to the wild type (38%, P-value= 0.0001).

4. Discussion

Over the last decade Mn has emerged as a trace element of significance in bacterial physiology and virulence, where it can function as a regulator of gene expression and as a modulator of metabolism [15, 74]. It has also been reported that Mn levels vary from nM to μM concentrations within the human host [17, 18], indicating that Mn could be an important environmental signal for human pathogens. Our previous studies have confirmed a key role of Mn in defence against ROS [10]; however, the mechanism has not been fully resolved. In order to investigate the regulatory and ROS defence roles of Mn in N. gonorrhoeae, we used a combined transcriptomic and proteomic approach.

4.1 Mn-dependent protection against oxidative stress

Our proteomic study showed that several oxidative stress defences proteins of N. gonorrhoeae were present at higher levels under high Mn conditions. These proteins included, SodB, bacterioferritin and Laz (Tables 2 and 3). SodB is a Fe-dependent enzyme that detoxifies superoxide, while bacterioferritin is an iron storage protein that can also contribute towards protection against oxidative stress [42]. These data indicate that a higher level of Mn may enable higher levels of iron acquisition, which otherwise would be disadvantageous to the cell due to Fenton chemistry [75], and this results in higher levels of these two iron-dependent proteins. Similarly, the Laz protein is a copper-binding protein found in the outer membrane and although its precise function is not known, it is involved in protection of gonococcus against peroxide killing [43]. Again, the increased level of this protein may be the result of increased copper acquisition which is facilitated by higher levels of Mn. MsrAB, a methionine sulfoxide reductase that is involved in protection from hydrogen peroxide and superoxide [45, 76], was also decreased (Table 2). This may reflect a decreased requirement for this outer membrane protein under high Mn conditions where other oxidative stress defenses become more prominent.

Mn(II) and Mn(III) can scavenge ROS non-enzymatically [77 , 78] and N. gonorrhoeae, like many lactic acid bacteria [65, 66, 77, 79, 80], may use accumulated intracellular Mn as a defence against ROS independently of SodB [10] or catalase [11]. Mn complexes, including Mn(II)-PPi and Mn(II)-polyP, have been shown to be potential non-enzymatic antioxidants [81]. Ppa had reduced expression under conditions on high Mn ( Error! Reference source not found.), which would result in increased levels of PPi that would be available to form Mn(II)-PPi complexes for antioxidant activity. PPi is generated in cells either as a metabolic byproduct of numerous biochemical and biosynthetic reactions [82] or directly by pyrophosphohydrolysis of the phosphodiesterase I bond in purine and pyrimidine nucleoside triphosphates by members of the phosphodiesterase nucleotide pyrophosphatase (PDNP) family [83]. It is established that the pathogenic Neisseria can accumulate up to 10% of their phosphate as polyP. Although most of this polyP is intracellular, there is evidence that polyP is also loosely associated with the extracellular surface where it forms a capsule-like structure around the gonococcus [84]. To investigate the role of PPi and polyP in oxidative stress, oxidative killing assays were performed using ppk and ppa mutant strains. The ppk and ppa mutations cause cells to be more resistant to oxidative killing. The level of Mn-mediated protection against ROS seen in the ppa mutant strain was drastically reduced with respect to the wild type strain (Figure 4). These data suggest that the protection of cells against oxidative stress by Mn may be due to Mn(II)-PPi complex rather than Mn(II)-polyP complex formation. However, since some Mn(II)-dependent protection was maintained in the ppa mutant strain, the Mn(II)-dependent effect is unlikely to completely depend on PPi. Also, since Mn provides protection in the ppk mutant against ROS to a similar extent as that seen in the wild type strain, it can be concluded that Mn is not directly dependent upon polyP for its antioxidant action. Therefore, unlike the situation in L. plantarum [66] Mn(II)-polyP complexes do not have a direct role in ROS quenching within N. gonorrhoeae.

The role of polyP and PPi in invasion of and survival in primary cervical epithelial cells was also investigated. Whereas the ppk and ppa mutations did not affect the association of gonococci with pex cells, we did observe increased invasion by the ppa mutant. Both mutant strains had decreased survival in the pex cells relative to the wild type. These data show that polyP and pyrophosphate metabolisms in N. gonorrhoeae have a significant influence on invasion of and survival within cervical epithelial cells. This may be linked to defense against with oxidative stress and varying Mn levels during gonococcal adherence to and invasion of target cells, as outlined in the section above.

4.2 Mn regulation of pili and other virulence factors

Mn is involved in virulence in Salmonella enterica serovar Typhimurium [15, 74] and S. pneumoniae [19, 85] and regulates the expression of several virulence factors in N. gonorrhoeae (Tables 2 and 3). It has also been reported that Mn levels vary from nM to M concentrations within the human host [17, 18]. Thus, differences in Mn concentration between host microenvironments may provide a signal for expression of certain virulence factors at sites of gonococcal infection. Indeed, it has recently been shown that S. pneumoniae uses Mn as a signal for the expression of virulence factors within different host sites, and that the disruption of this Mn-dependent regulation reduces virulence in an animal model [19, 20]. Pilin (PilE) levels of N. gonorrhoeae, as well as several pili associated proteins (PilC1, PilT, PilQ), were reduced in the presence of increased Mn concentrations (Table 2 and 3 Error! Reference source not found.). PilC1 is involved in pilus assembly, PilQ is involved in translocation of pili to the cell surface and PilT is required for pilus retraction [46]. Pili of pathogenic Neisseria spp. are typical of a family of adhesins, type IV fimbriae, found in a wide range of Gram-negative pathogens. These long polymeric proteins protrude from the bacterial surface and have a crucial role in both colonization of the host and adhesion to host cells [58, 59] and only piliated bacteria are recovered from gonorrhoea patients [86]. Piliation increases the ability of gonococci to adhere to numerous cell types including human amniotic cells [87], sperm [88, 89], erythrocytes [90, 91], buccal epithelial cells, neutrophils [91], vaginal epithelial cells [92] and non-ciliated cells in fallopian-tube organ cultures [93]. Pili are also required for CR3-mediated endocytosis of primary cervical epithelial (pex) cells [72]. Although pili are critical in mediating adhesion to host cells, it is also generally believed that these adhesins are not expressed upon the invasion of a host cell [73, 94]. Environmental factors causing pilus release are not known. In light of the role pili plays in gonococcal virulence, Mn-dependent regulation of pilin suggests that Mn may play an important role in pathogenicity of N. gonorrhoeae and our data show that this effect is exerted at the post-transcriptional level.

Mn is also linked with regulation of other known and potential virulence factors of N. gonorrhoeae, including Porin and the adhesin MafA (increased expression in the presence of Mn) as well as Opa, OMP P64K, OmpR and transferrin binding protein A (decreased expression in the presence of Mn) (Table 2 and 3). Although development of a vaccine against N. gonorrhoeae has been hampered by the variability of antigens between gonococcal strains, research has focused on pilin, porin and transferrin binding proteins [95, 96]. Understanding of Mn-dependent regulation of these proteins may aid in future vaccine development.

4.3 Mn regulation of carbon metabolism

Many of the Mn-dependent changes in protein levels observed in this study relate to enzymes involved in intermediary carbon metabolism. Mn has previously been linked to cell metabolism, with higher Mn levels being correlated with slow growing or stationary phase bacterial cells [15]. Kehres and Maguire [15] reviewed several Mn regulated enzymes that are involved in intermediary carbon metabolism and described a possible network of co-regulated enzymes involved in phosphoenolpyruvate (PEP) and pyruvate metabolism. N. gonorrhoeaemetabolises glucose via the Entner-Douderoff (ED) pathway and the citric acid cycle (CAC) [97, 98], and the ED pathway results in the formation of glyceraldehyde 3-phosphate (GAP) and pyruvate as primary C3 products [97, 98].

Changes to the levels of proteins involved in carbon metabolism may be related to the effect of Mn on the redox environment of the cell that is described above, e.g. the sensitivity of GAP dehydrogenase (GAPDH) to inactivation by oxidative stress [99]. Conversely, it would be expected that under conditions of low Mn levels, GAPDH would be lowered and the activity of the enzymes involved in pyruvate and PEP production, via this branch of the ED pathway, would also be lowered. Restriction of production of pyruvate from GAP would mean that the pyruvate produced directly from the ED Pathway would take on greater importance for production of carbon intermediates. PEP production is critical and it is notable that under low Mn conditions there is a higher level of PEP synthase (Error! Reference source not found.). Another consequence of a decreased GAPDH activity, which would be observed under conditions of low Mn, would be an elevation of the level of this intermediate, GAP. C3 sugars (i.e. GAP) cannot cyclise to prevent further oxidation of a carbon atom to form dicarbonyls which are highly reactive and toxic species [100, 101]. Thus, it is critical to remove accumulating GAP and it is postulated that this function is taken by the zinc-dependent alcohol dehydrogenase which would use NADH to produce glycerol-3-phosphate. Perhaps, this also explains why acetyl-CoA carboxylase is co-ordinately regulated ( Error! Reference source not found.) so that production of fatty acyl-CoA intermediates can be used along with glycerol-3-phophate in phospholipid synthesis. It is notable that acetate kinase levels also increase under conditions of low Mn (Table 3) and this provides for increased production of acetyl-P which in turn can lead to formation of acetyl-CoA.

4.4 Mechanism of Mn-dependent post-transcriptional regulation

While the mechanism of Mn-dependent post-transcriptional regulation in N. gonorrhoeae has not been determined in this study, there are several ways Mn could regulate the levels of the proteins listed in Tables 2 and 3. Changes in the Mn concentration could result in: (1) Modification of activity of the Mn-dependent ppGpp hydrolase (SpoT), which is involved in controlling the level of ppGpp in response to changes in the environment, which in turn globally coordinates mRNA and stable RNA synthesis; (2) binding of Mn instead of Mg to compounds which can alter the catalytic activity of enzymes and tertiary structure of tRNA; (3) binding of Mn to small RNAs involved in translational regulation, leading to RNA structural changes; and (4) decreased protein turnover due to the role of Mn in protection from ROS [reviewed in 15]. There are also up and down-regulation of ribosomal proteins by Mn (Table 2), which might be involved in the change of mRNA synthesis according to the environment changes sensed by Mn. Or this might be due to the inefficient cell separation, because it has been reported that even after lysis in PBS buffer a lot of soluble and membrane-associated proteins remain in the membrane fraction (for example, the ribosomal proteins L1/L2/L3/L4/L5 or the elongation factor Tu) [52]. These proteins are often highly abundant and may therefore obscure membrane proteins in the SDS-PAGE. We note that Mn caused some changes in the level of chaperone proteins (GroEL) and proteases (ClpX) associated with protein turnover. Mn homeostasis and Mn-dependent regulation appears to involve several factors, and more work is necessary to determine the mechanism of Mn regulation in N. gonorrhoeae and the role of Mn in pathogenesis in this organism.

Table 1.

Primers used in this study for PCR and qRT-PCR

Primer	Sequence (5′ - 3′)
PilEsignalF	ATGAATACCCTTCAAAAAGGCTTTACCC
PilEsignalR	AGTCTTGGTAGGCGGGAAGGGCGAC
ppa_RTfor	TTACCGAACAACCTCTGGCAAC
ppa_RTrev	GCAGGTACGCAGACGATTTTG
ppsa_RTfor	GGCAAATCGGTAACCAACGTC
ppsa_RTrev	TTTCGATGGTCAGCGCGTA
sodB_RTfor	TCCAAGAAGCGTTCAATGCC
sodB_RTrev	GGCGTTGGAAGTGGAAATCA
Ppk_for	CGTCATGCCGCCTGAAACCGGCGCA
Ppk_rev	GCGGGTCAGCCTCGGAGCAAATC
ppa-KO-F	CCAGCGCGTTTTCGACAAAGG
ppa-KO-R	ATCCTGCTCATCGAACGCAC

Abbreviations

ABC

ATP binding cassette

ABTS

2,2’-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)

BHI

brain heart infusion

CAC

citric acid cycle

ED

Entner-Douderoff

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

IAA

iodoacetamide

Mn

manganese

NCBI

National Center for Biotechnology Information

OM

outer membrane

PEP

phosphoenolpyruvate

PMN

polymorphonuclear leukocyte

PolyP

polyphosphate

Ppa

inorganic pyrophosphatase

RNS

reactive nitrogen species

SOD

superoxide dismutase

TCEP

Tris(carboxyethyl) phosphine

TIGR

The Institute for Genomic Research