Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2014 Mar 3;62(6):964–970. doi: 10.1002/glia.22653

Alpha-synuclein mRNA expression in oligodendrocytes in MSA

Yasmine T Asi 1, Julie E Simpson 2, Paul R Heath 2, Stephen B Wharton 2, Andrew J Lees 1,3, Tamas Revesz 1, Henry Houlden 3,4, Janice L Holton 1,
PMCID: PMC4238782  PMID: 24590631

Abstract

Multiple system atrophy (MSA) is a progressive neurodegenerative disease presenting clinically with parkinsonian, cerebellar, and autonomic features. α-Synuclein (αsyn), encoded by the gene SNCA, is the main constituent of glial cytoplasmic inclusion (GCI) found in oligodendrocytes in MSA, but the methods of its accumulation have not been established. The aim of this study is to investigate alterations in regional and cellular SNCA mRNA expression in MSA as a possible substrate for GCI formation. Quantitative reverse transcription polymerase chain reaction (qPCR) was performed on postmortem brain samples from 15 MSA, 5 IPD, and 5 control cases to investigate regional expression in the frontal and occipital regions, dorsal putamen, pontine base, and cerebellum. For cellular expression analysis, neurons and oligodendrocytes were isolated by laser-capture microdissection from five MSA and five control cases. SNCA mRNA expression was not significantly different between the MSA, IPD and control cases in all regions (multilevel model, P = 0.14). After adjusting for group effect, the highest expression was found in the occipital cortex while the lowest was in the putamen (multilevel model, P < 0.0001). At the cellular level, MSA oligodendrocytes expressed more SNCA than control oligodendrocytes and expression in MSA neurons was slightly lower than that in controls, however, these results did not reach statistical significance. We have demonstrated regional variations in SNCA expression, which is higher in cortical than subcortical regions. This study is the first to demonstrate SNCA mRNA expression by oligodendrocytes in human postmortem tissue using qPCR and, although not statistically significant, could suggest that this may be increased in MSA compared to controls.

Keywords: α-synuclein, multiple system atrophy, oligodendrocytes, glial cytoplasmic inclusions, laser-capture microdissection

Introduction

Multiple system atrophy (MSA) is a progressive neurodegenerative disease that clinically presents with parkinsonian, cerebellar and autonomic features and pathologically with glial cytoplasmic inclusions (GCIs) found in oligodendrocytes, myelin damage, neuronal loss, and gliosis (Ahmed et al. 2012; Ubhi et al. 2011). The main constituent of GCIs is α-synuclein (αsyn), as such, classifying MSA as part of the α-synucleinopathy group of diseases, which also includes Parkinson's disease (PD) and dementia with Lewy bodies (DLB). MSA is pathologically subtyped into striatonigral (SND), olivopontocerebellar (OPC) or mixed type reflecting the predominance of pathological burden in the respective anatomical structures. However, the basis for this regional vulnerability is poorly understood (Jellinger et al. 2005; Ozawa et al. 2004). The mechanism by which αsyn accumulates in oligodendrocytes as GCIs is as yet unknown but is hypothesized to result from the uptake of αsyn, released from neurons, by oligodendrocytes or by overexpression of SNCA mRNA in the disease condition (Reyes et al. 2014; Ubhi et al. 2011). Mutations and multiplications in SNCA, the gene encoding αsyn, have been identified in some cases of familial PD and these have occasionally been found to have oligodendroglial inclusions resembling GCIs (Gwinn-Hardy et al. 2000; Kiely et al. 2013; Markopoulou et al. 2008; Obi et al. 2008). Despite this, no mutations in SNCA have been associated with MSA (Gwinn-Hardy et al. 2000; Kiely et al. 2013; Markopoulou et al. 2008; Obi et al. 2008). There are limited studies in the literature of SNCA expression in MSA. In a small case study, SNCA mRNA levels in cortical regions (frontal, temporal, or occipital) of MSA brains did not differ from those in controls using quantitative PCR (qPCR) (Ozawa et al. 2001). Cortical regions are less severely affected by GCI pathology and neuronal loss in MSA and this may explain these results. Based on findings of our study, it may be plausible to suggest that expression differences are more likely to arise in areas more severely affected in MSA such as the pons and cerebellum. However, there are conflicting data with regards to SNCA expression in the pons. Jin et al. (2008) observed no difference in SNCA copy number and mRNA expression in the pons of MSA and control cases, while down-regulation was reported by Langerveld et al. (2007). Different isoforms of SNCA resulting from alternative mRNA splicing were investigated in PD, DLB, and MSA and isoform SNCA 98 was found to be up-regulated in the frontal cortex of MSA, while there was no significant difference in the level of SNCA 126 (Beyer et al. 2008).

Previous studies focused on understanding SNCA mRNA expression in MSA at the regional level and there is little information relating to cellular expression. In situ hybridization studies of SNCA mRNA expression in PD and control cases have successfully identified expression in neurons but not in oligodendrocytes (Jin et al. 2008; Kingsbury et al. 2004; Miller et al. 2005; Solano et al. 2000). Unravelling the cellular expression profile of SNCA in MSA will help to shed light on the possible contribution of overexpression in oligodendrocytes as a mechanism for GCI formation. Therefore, the aim of this study was to investigate the regional and cellular expression profile of SNCA in MSA subtypes and controls using qPCR.

Materials and Methods

Tissue Collection

Samples were obtained from brains donated to the Queen Square Brain Bank (QSBB) for Neurological Disorders, Department of Molecular Neuroscience, UCL Institute of Neurology, London. The donations were made according to ethically approved protocols, and tissue is stored under a license issued by the Human Tissue Authority (No. 12198). One half of the brain is sliced in the coronal plane, flash frozen, and stored at −80°C on arrival to the QSBB, while the other half is fixed in 10% buffered formalin. Tissue was sampled from the frozen half brain.

Case Selection

MSA cases were pathologically typed based on published criteria into mixed, SND and OPCA subtypes (Ozawa et al. 2004). Five MSA-SND, five MSA-OPCA, five MSA-mixed subtypes were selected and sex and age matched to five IPD and four normal control cases to study regional αsyn mRNA expression (Table1). For cellular mRNA expression, five MSA-mixed subtype and six neurologically normal controls were used to isolate neurons and oligodendrocytes (Table2).

Table 1.

Demographics of Regional Expression Cohort

Case Age Sex Diagnosis MSA pathological type PMI (hr)
1 56 F MSA Mixed 28
2 62 M MSA Mixed 20
3 64 F MSA Mixed 52
4 66 M MSA Mixed 105
5 70 F MSA Mixed 65
6 50 F MSA SND 4
7 54 F MSA SND 47
8 58 F MSA SND 11
9 63 M MSA SND 27
10 72 M MSA SND 50
11 56 M MSA OPCA 37
12 60 F MSA OPCA 62
13 61 M MSA OPCA ND
14 64 M MSA OPCA 35
15 66 F MSA OPCA 74
16 61 F IPD NA 26
17 63 M IPD NA 37
18 65 M IPD NA 43
19 67 F IPD NA 108
20 70 M IPD NA 75
21 57 M Control NA 79
22 69 M Control NA ND
23 71 M Control NA 39
24 73 F Control NA 24

NA: not applicable; ND: not documented; PMI: post-mortem interval.

Table 2.

Demographics of Cellular Expression Cohort

Case Age Sex Diagnosis MSA pathological type PMI (hr) RIN before LCM RIN after LCM
1 50 M MSA Mixed 30 4.8 2.6
2 70 F MSA Mixed 65 5.8 ND
3 56 M MSA Mixed 75 4.7 ND
4 64 F MSA Mixed 99 4.4 2.8
5 64 M MSA Mixed 100 5.1 3.1
6 69 M Control NA ND 4.4 ND
7 82 F Control NA ND 4.8 3.6
8 73 F Control NA 24 5.3 2.0
9 85 M Control NA 78 4.2 2.2
10 80 F Control NA 49 3.9 2.5
11 83 M Control NA 63 4.2 2.3

NA: not applicable; ND: not documented; PMI: post-mortem interval.

Regional Sampling, RNA Extraction, and Reverse Transcription

Frozen tissue (∼100 mg) from the posterior frontal region (cortex and subcortical white matter), occipital region (cortex and subcortical white matter), dorsal putamen, pontine base, and cerebellum (white matter) was collected and homogenised using TissueRuptor (Qiagen, Germany). RNA extraction was carried out using RNeasy Mini Kit (Qiagen, Germany) and cDNA synthesized using SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen, UK) according to the manufacturer's instructions.

Cellular Sampling, RNA Extraction, and Reverse Transcription

Neurons from the pontine base (∼1,000 cells) and oligodendrocytes from the cerebellar white matter (∼1,000 cells) were isolated in five MSA and six control cases using the PixCell II laser-capture microdissection (LCM) system (Arcturus Engineering, Mountain View, CA). Neurons were identified using toluidine blue stain and oligodendrocytes using a rapid immunohistochemistry (IHC) protocol as previously described (Waller et al. 2012). Briefly, 7-µm frozen section were collected on uncharged, sterile glass slides and warmed to RT for 30 sec. The sections were then fixed in ice-cold acetone for 3 min and immunostained using oligodendrocyte-specific protein (OSP) primary antibody (Abcam, UK, ab7474) and VECTASTAIN Elite ABC kit (Vector labs, Burlingame, CA, PK-6101). Sections were blocked with normal goat serum (2%) for 3 min then incubated in OSP (1:10) for 3 min at RT. After a brief rinse with tris-buffered saline (TBS), sections were incubated in 5% biotinylated secondary antibody for 3 min at RT, then rinsed again with TBS. The avidin–biotin complex solution was then added to the section for 3 min at RT then rinsed off. DAB peroxidase substrate kit (Vector labs, Burlingame, CA, SK-4100) was used to visualize the reaction by incubating section for 3 min at RT. The sections were rinsed with TBS, dehydrated in graded alcohol (70, 95, 100, 100% for 1 min each), cleared in two changes of xylene and allowed to air dry in an air-flow hood for an hour prior to LCM. This rapid IHC protocol was carried out under sterile conditions and using diethylpyrocarbonate (DEPC)-treated water. RNA extraction of LCM samples was carried out using the Arcturus PicoPure RNA isolation kit (Applied Biosystems, UK, KIT0204) and cDNA synthesized using SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen, UK) according to manufacturer's instructions. RNA quality and concentration was then assessed using the Nanodrop and Agilent Bioanalyser 2100. Maintenance of RNA quality was adequate as assessed by the RIN of samples before and after LCM was carried out. Prior to LCM, samples had a mean RIN of 4.7 (range 4.2–5.8) declining to 2.6 (range 2.0–3.1) after LCM and this is in keeping with previous findings (Waller et al. 2012).

Quantitative PCR

qPCR was performed on Stratagene MX3000p (Agilent technologies, CA) using 50-ng cDNA and Power SYBR Green Master Mix (Applied Biosystems) according to the manufacturer's instructions. All primers were run at the following thermal profile: one cycle at 95°C for 10 min followed by 40 cycles at 95°C for 15 min and 60°C for 1 min. Three reference genes, UCB, TBP, and GAPDH, were determined as appropriate to normalize regional expression data using qBase plus software (Biogazelle, Belgium). Due to limited sample volume, one reference gene (UBC) was used to normalize LCM expression data. Primers for the gene of interest (GOI), SNCA, were designed in house while the reference genes were obtained from RTprimerDB (Table3).

Table 3.

Primers Information

Gene SNCA TBP UBC GAPDH
Gene name synuclein, alpha (non A4 component of amyloid precursor) TATA box binding protein Ubiquitin C Glyceraldehyde-3-phosphate dehydrogenase
RefSeq no. NM_001146055.1 NM_003194 NM_021009 NM_002046
Primer sequence F: CAACAGTGGCTGAGAAGACCA F: TGCACAGGAGCCAAGAGTGAA F: F: GAAATCCCATCACCATCTTCCAGG
R: GCTCCTTCTTCATTCTTGCCCA R: CACATCACAGCTCCCCACCA ATTTGGGTCGCGGTTCTTG R:
R: TGCCTTGACATTCTCGATGGT GAGCCCCAGCCTTCTCCATG
Alignment F: base 228 to 249 F: base 892 to 913 F: base 399 to 418 F: base 313 to 337
R: base 369 to 390 R: base 1004 to 1024 R: base 511 to 532 R: base 413 to 433
Amplicon length (bp) 163 132 133 120
Organism Homo sapiens Homo sapiens Homo sapiens Homo sapiens
Source In house design RTPrimerDB (ID: 2630) RTPrimerDB (ID: 8) RTPrimerDB (ID: 1108)

Expression Analysis and Statistics

Standard curves were used to extrapolate expression value of each gene in each region or cell. The GOI was then normalized to the geometric mean of the reference genes as recommended by Vandesompele et al. (2002). A multilevel statistical model was used for regional expression analysis while the Mann–Whitney U test was used to analyze cellular expression results with the significance levels set at P < 0.05.

Results

Regional SNCA mRNA expression was examined in the posterior frontal region, occipital region, dorsal putamen, pontine base, and cerebellar white matter of three MSA subtypes (mixed, SND, and OPCA), IPD, and control cases (Fig. 1). SNCA expression level was highest in IPD and lowest in MSA-SND, however, data analysis using a multilevel statistical model showed that there was no statistically significant difference between the different groups (multilevel statistical model, P = 0.14). After adjusting for group effect, the highest expression was found in the occipital cortex while the lowest was in the putamen. The differences between regions were found to be statistically significant (multilevel statistical model, P < 0.0001).

Figure 1.

Figure 1

SNCA mRNA regional expression (A) Expression between the different cases (adjusted for regions) shows no statistically significant differences between the groups although the lowest level of expression was found in MSA-SND and the highest in IPD cases (P = 0.14). (B) After adjusting for case type, a statistically significant difference in SNCA expression between regions was found (P < 0.0001), with the lowest expression in the dorsal putamen and the highest in the occipital cortex. Multilevel model test with significance level set at P = 0.05. The boxplot show median values as the line within the box, the box reflects the interquartile range and the whiskers the range of the values.PFR: posterior frontal region; OR: occipital region; Put-D: dorsal putamen; CBM: cerebellum; Ctx: cortex; WM: white matter; MSA: multiple system atrophy; SND: striatonigral degeneration; OPC: olivopontocerebellar; IPD: idiopathic Parkinson's disease; SNCA: α-synuclein.

Next SNCA expression in neurons and oligodendrocytes isolated by laser capture was explored in the pontine base and cerebellar white matter, respectively, as these regions are affected in MSA. SNCA expression was detected in neurons and oligodendrocytes of both MSA and control cases, with the highest level of expression being found in MSA oligodendrocytes (Fig. 2A). The fold changes in mRNA expression between the different cell types and groups were also calculated (Fig. 2B). Although none of the differences identified reached statistical significance, there was a slight increase in expression in MSA oligodendrocytes as compared to control oligodendrocytes (fold change = 0.7, Mann–Whitney U test, P = 0.18). Expression in MSA neurons was slightly decreased as compared to control neurons (fold change = –0.4, Mann–Whitney U test, P= 0.46). Comparing the different cell types within the same groups revealed that control oligodendrocytes express 0.3 more SNCA than control neurons (Mann–Whitney U test, P = 0.92). The greatest difference was seen between MSA oligodendrocytes and neurons where expression in MSA oligodendrocytes was 3.1 times higher than MSA neurons (Mann–Whitney U test, P = 0.16).

Figure 2.

Figure 2

SNCA mRNA cellular expression(A) SNCA is expressed in neurons and oligodendrocytes of both MSA and control cases. Expression in neurons is greater in controls as compared to MSA (P = 0.47), in contrast to oligodendrocytes where expression is greater in MSA (P = 0.18) but these results did not reach statistical significance. (B) Bar graph representing fold change of expression values between the different cases and cell types. No statistically significant differences were found although there was a trend toward increased expression in MSA oligodendrocytes when compared to control oligodendrocytes (P = 0.18), MSA neurons (P = 0.16) and control neurons (P = 0.18). In contrast, there was a slight decrease in αsyn expression in MSA neurons as compared to control neurons (P = 0.46). The greatest difference seems to be the increase in expression in MSA oligodendrocytes compared with MSA neurons. Mann–Whitney U test with significance level set at P = 0.05. The boxplot shows median values as the line within the box, the box reflects the interquartile range and the whiskers the range of the values. Oligo: oligodendrocytes; MSA: multiple system atrophy; SNCA: α-synuclein.

Discussion

αSyn has been localized in the brain to neuronal presynaptic terminals and may play a role in neuronal plasticity, vesicular transport, and membrane interaction (Iwai et al. 1995; Kahle et al. 2000; Reynolds et al. 2011). There has been great interest in the possible mechanisms by which αsyn forms primarily oligodendroglial inclusions in MSA since its identification as the main constituent of the GCIs. Understanding the expression pattern of SNCA in MSA at both regional and cellular levels is essential to determine if changes in expression play a role in MSA pathogenesis and whether this influences regional vulnerability to disease. The regional expression analysis in this study now demonstrates that SNCA expression level varies across different brain regions in control, MSA, and IPD groups. The greatest expression is found in the occipital grey matter and the lowest level in the putamen. However, SNCA mRNA expression is not significantly different between the MSA subgroups, IPD and control cases in all regions. The expression trend found in MSA and control cases used in this study is similar to that documented in expression databases such as UKBEC and Allen Brain Atlas, which analyze gene expression in control human brains (Hawrylycz et al. 2012; Trabzuni et al. 2011). The similarity in trend, where SNCA is generally expressed more in cortical regions than subcortical and cerebellar regions, has at least two main implications. The first is that the vulnerability of StrN and OPC regions is not associated with a higher baseline expression of SNCA. It could be hypothesized that the concentration of GCIs in specific regions is due to higher expression levels of SNCA in normal conditions in those regions that is exacerbated by disease. Our data do not support this hypothesis as SNCA mRNA levels are higher in cortical than subcortical regions in both normal and disease cases, while GCI pathology is greater in subcortical and hindbrain structures such as the StrN and OPC regions in MSA. This also indicates that the disease does not cause an alteration in expression levels in areas of greater vulnerability. The absence of a difference in SNCA expression levels between the different MSA groups, IPD, and controls may imply that factors contributing to pathogenic mechanisms of MSA may be further downstream and not at the transcriptional level and could suggest that impaired αsyn degradation may contribute to the disease. Another possibility is that any differences at the transcriptional level are masked by the cellular heterogeneity of the samples. To overcome this problem, we used LCM to obtain samples highly enriched in neurons and oligodendrocytes.

It has long been suggested that mature oligodendrocytes lack αsyn (Jin et al. 2008; Miller et al. 2005; Solano et al. 2000). However, cell-culture evidence indicates that rat and mouse oligodendrocytes express αsyn protein and mRNA, and in some cases this expression is transient, appearing in precursor cells and declining as they mature (Culvenor et al. 2002; Nielsen et al. 2006; Richter-Landsberg et al. 2000). To date, there is one published study addressing the question of SNCA mRNA expression in MSA oligodendrocytes (Miller et al. 2005). This study used double-labeling in situ hybridization of SNCA and proteolipid protein (PLP), an oligodendrocyte marker, and showed that SNCA is not expressed in oligodendrocytes in MSA or control brains. As ISH has limited sensitivity, the findings of this study do not exclude the possibility of SNCA mRNA expression by oligodendrocytes (Deglincerti and Jaffrey 2012; Miller et al. 2005).

Analyzing SNCA expression in LCM-isolated neurons and oligodendrocytes, our data indicate that this highly conserved protein is expressed in human oligodendrocytes and that expression in MSA oligodendrocytes is greater than control oligodendrocytes. In our hands, LCM isolation of OSP-positive oligodendrocytes provides an oligodendrocyte-enriched sample (Waller et al. 2012). This suggests that SNCA overexpression in MSA oligodendrocytes may be a possible mechanism contributing to GCI formation. The cellular expression of αsyn in MSA in this study may also explain the pathological profile of the disease. GCIs are found in greater abundance than NCIs in MSA, and this greater susceptibility of oligodendrocytes to inclusion formation may be a reflection of overexpression of αsyn by oligodendrocytes in MSA.

The novel findings of this LCM study demonstrating expression of SNCA mRNA in oligodendrocytes open the door to further exploration of the molecular pathogenesis of MSA. Expanding the current study to examine cellular SNCA mRNA expression in other affected and unaffected brain regions in MSA may help to elucidate the selective vulnerability of StrN and OPC regions. In addition to affected and unaffected brain regions, examination of SNCA expression in MSA cases with short disease duration and long disease duration may provide further insight into the role of SNCA mRNA expression on clinical outcome. A further step would be to characterize SNCA mRNA expression in oligodendrocytes with and without GCIs to determine the contribution of SNCA expression to inclusion formation in oligodendrocytes. In addition to GCI+/− oligodendrocytes, SNCA mRNA expression may also be explored at different stages of oligodendrocyte maturation. The oligodendrocyte lineage comprises precursor, immature, mature nonmyelinating, and mature myelinating cells and αsyn protein in GCIs has been found in mature but not precursor oligodendrocytes in MSA (Ahmed et al. 2013; Papp et al. 1989). Therefore, determining SNCA mRNA expression in the different maturational stages may provide further insight into the vulnerability of mature oligodendrocytes to αsyn aggregation.

Acknowledgments

Grant sponsor: Multiple System Atrophy Trust, Parkinson's UK, Alzheimer's Research UK and the Progressive Supranuclear Palsy (Europe) Association. (JH, AL, and TR); Grant sponsor: Reta Lila Weston Institute for Neurological Studies (JH, AL); Grant sponsor: Government of Kuwait (YTA); Grant sponsor: Multiple System Atrophy Trust and Medical Research Council (HH); Grant sponsor: Medical Research Council, Biotechnology and Biological Sciences Research Council, and Alzheimer's research UK (SBW). This study was supported by researchers at the National Institute for Health Research University College London Hospitals Biomedical Research Centre.

References

  1. Ahmed Z, Asi YT, Lees AJ, Revesz T, Holton JL. Identification and quantification of oligodendrocyte precursor cells in multiple system atrophy, progressive supranuclear palsy and Parkinson's disease. Brain Pathol. 2013;23:263–273. doi: 10.1111/j.1750-3639.2012.00637.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ahmed Z, Asi YT, Sailer A, Lees AJ, Houlden H, Revesz T, Holton JL. The neuropathology, pathophysiology and genetics of multiple system atrophy. Neuropathol Appl Neurobiol. 2012;38:4–24. doi: 10.1111/j.1365-2990.2011.01234.x. [DOI] [PubMed] [Google Scholar]
  3. Beyer K, Domingo-Sàbat M, Humbert J, Carrato C, Ferrer I, Ariza A. Differential expression of alpha-synuclein, parkin, and synphilin-1 isoforms in Lewy body disease. Neurogenetics. 2008;9:163–172. doi: 10.1007/s10048-008-0124-6. [DOI] [PubMed] [Google Scholar]
  4. Culvenor JG, Rietze RL, Bartlett PF, Masters CL, Li Q-X. Oligodendrocytes from neural stem cells express alpha-synuclein: increased numbers from presenilin 1 deficient mice. Neuroreport. 2002;13:1305–1308. doi: 10.1097/00001756-200207190-00018. [DOI] [PubMed] [Google Scholar]
  5. Deglincerti A, Jaffrey SR. Insights into the roles of local translation from the axonal transcriptome. Open Biol. 2012;2:120079. doi: 10.1098/rsob.120079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Gwinn-Hardy K, Mehta ND, Farrer M, Maraganore D, Muenter M, Yen SH, Hardy J, Dickson DW. Distinctive neuropathology revealed by alpha-synuclein antibodies in hereditary parkinsonism and dementia linked to chromosome 4p. Acta Neuropathol. 2000;99:663–672. doi: 10.1007/s004010051177. [DOI] [PubMed] [Google Scholar]
  7. Hawrylycz MJ, Lein ES, Guillozet-Bongaarts AL, Shen EH, Ng L, Miller JA, van de Lagemaat LN, Smith KA, Ebbert A, Riley ZL, Abajian C, Beckmann CF, Bernard A, Bertagnolli D, Boe AF, Cartagena PM, Chakravarty MM, Chapin M, Chong J, Dalley RA, Daly BD, Dang C, Datta S, Dee N, Dolbeare TA, Faber V, Feng D, Fowler DR, Goldy J, Gregor BW, Haradon Z, Haynor DR, Hohmann JG, Horvath S, Howard RE, Jeromin A, Jochim JM, Kinnunen M, Lau C, Lazarz ET, Lee C, Lemon TA, Li L, Li Y, Morris JA, Overly CC, Parker PD, Parry SE, Reding M, Royall JJ, Schulkin J, Sequeira PA, Slaughterbeck CR, Smith SC, Sodt AJ, Sunkin SM, Swanson BE, Vawter MP, Williams D, Wohnoutka P, Zielke HR, Geschwind DH, Hof PR, Smith SM, Koch C, Grant SGN, Jones AR. An anatomically comprehensive atlas of the adult human brain transcriptome. Nature. 2012;489:391–399. doi: 10.1038/nature11405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Iwai A, Masliah E, Yoshimoto M, Ge N, Flanagan L, de Silva HA, Kittel A, Saitoh T. The precursor protein of non-A beta component of Alzheimer's disease amyloid is a presynaptic protein of the central nervous system. Neuron. 1995;14:467–475. doi: 10.1016/0896-6273(95)90302-x. [DOI] [PubMed] [Google Scholar]
  9. Jellinger KA, Seppi K, Wenning GK. Grading of neuropathology in multiple system atrophy: Proposal for a novel scale. Mov Disord 20(Suppl. 2005;12):S29–S36. doi: 10.1002/mds.20537. [DOI] [PubMed] [Google Scholar]
  10. Jin H, Ishikawa K, Tsunemi T, Ishiguro T, Amino T, Mizusawa H. Analyses of copy number and mRNA expression level of the alpha-synuclein gene in multiple system atrophy. J Med Dent Sci. 2008;55:145–153. [PubMed] [Google Scholar]
  11. Kahle PJ, Neumann M, Ozmen L, Haass C. Physiology and pathophysiology of alpha-synuclein. Cell culture and transgenic animal models based on a Parkinson's disease-associated protein. Ann N Y Acad Sci. 2000;920:33–41. doi: 10.1111/j.1749-6632.2000.tb06902.x. [DOI] [PubMed] [Google Scholar]
  12. Kiely AP, Asi YT, Kara E, Limousin P, Ling H, Lewis P, Proukakis C, Quinn N, Lees AJ, Hardy J, Revesz T, Houlden H, Holton JL. α-Synucleinopathy associated with G51D SNCA mutation: A link between Parkinson's disease and multiple system atrophy? Acta Neuropathol. 2013;125:753–769. doi: 10.1007/s00401-013-1096-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kingsbury AE, Daniel SE, Sangha H, Eisen S, Lees AJ, Foster OJF. Alteration in α-synuclein mRNA expression in Parkinson's disease. Mov Disord. 2004;19:162–170. doi: 10.1002/mds.10683. [DOI] [PubMed] [Google Scholar]
  14. Langerveld AJ, Mihalko D, DeLong C, Walburn J, Ide CF. Gene expression changes in postmortem tissue from the rostral pons of multiple system atrophy patients. Mov Disord. 2007;22:766–777. doi: 10.1002/mds.21259. [DOI] [PubMed] [Google Scholar]
  15. Markopoulou K, Dickson DW, McComb RD, Wszolek ZK, Katechalidou L, Avery L, Stansbury MS, Chase BA. Clinical, neuropathological and genotypic variability in SNCA A53T familial Parkinson's disease. Variability in familial Parkinson's disease. Acta Neuropathol. 2008;116:25–35. doi: 10.1007/s00401-008-0372-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Miller DW, Johnson JM, Solano SM, Hollingsworth ZR, Standaert DG, Young AB. Absence of α-synuclein mRNA expression in normal and multiple system atrophy oligodendroglia. J Neural Transm. 2005;112:1613–1624. doi: 10.1007/s00702-005-0378-1. [DOI] [PubMed] [Google Scholar]
  17. Nielsen JA, Maric D, Lau P, Barker JL, Hudson LD. Identification of a novel oligodendrocyte cell adhesion protein using gene expression profiling. J Neurosci. 2006;26:9881–9891. doi: 10.1523/JNEUROSCI.2246-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Obi T, Nishioka K, Ross OA, Terada T, Yamazaki K, Sugiura A, Takanashi M, Mizoguchi K, Mori H, Mizuno Y, Hattori N. Clinicopathologic study of a SNCA gene duplication patient with Parkinson disease and dementia. Neurology. 2008;70:238–241. doi: 10.1212/01.wnl.0000299387.59159.db. [DOI] [PubMed] [Google Scholar]
  19. Ozawa T, Okuizumi K, Ikeuchi T, Wakabayashi K, Takahashi H, Tsuji S. Analysis of the expression level of alpha-synuclein mRNA using postmortem brain samples from pathologically confirmed cases of multiple system atrophy. Acta Neuropathol. 2001;102:188–190. doi: 10.1007/s004010100367. [DOI] [PubMed] [Google Scholar]
  20. Ozawa T, Paviour D, Quinn NP, Josephs KA, Sangha H, Kilford L, Healy DG, Wood NW, Lees AJ, Holton JL, Revesz T. The spectrum of pathological involvement of the striatonigral and olivopontocerebellar systems in multiple system atrophy: Clinicopathological correlations. Brain. 2004;127:2657–2671. doi: 10.1093/brain/awh303. [DOI] [PubMed] [Google Scholar]
  21. Papp MI, Kahn JE, Lantos PL. Glial cytoplasmic inclusions in the CNS of patients with multiple system atrophy (striatonigral degeneration, olivopontocerebellar atrophy and Shy-Drager syndrome) J Neurol Sci. 1989;94:79–100. doi: 10.1016/0022-510x(89)90219-0. [DOI] [PubMed] [Google Scholar]
  22. Reyes JF, Rey NL, Bousset L, Melki R, Brundin P, Angot E. Alpha-synuclein transfers from neurons to oligodendrocytes. Glia. 2014;62:387–398. doi: 10.1002/glia.22611. [DOI] [PubMed] [Google Scholar]
  23. Reynolds NP, Soragni A, Rabe M, Verdes D, Liverani E, Handschin S, Riek R, Seeger S. Mechanism of membrane interaction and disruption by α-synuclein. J Am Chem Soc. 2011;133:19366–19375. doi: 10.1021/ja2029848. [DOI] [PubMed] [Google Scholar]
  24. Richter-Landsberg C, Gorath M, Trojanowski JQ, Lee VM. alpha-synuclein is developmentally expressed in cultured rat brain oligodendrocytes. J Neurosci Res. 2000;62:9–14. doi: 10.1002/1097-4547(20001001)62:1<9::AID-JNR2>3.0.CO;2-U. [DOI] [PubMed] [Google Scholar]
  25. Solano SM, Miller DW, Augood SJ, Young AB, Penney JB. Expression of alpha-synuclein, parkin, and ubiquitin carboxy-terminal hydrolase L1 mRNA in human brain: Genes associated with familial Parkinson's disease. Ann Neurol. 2000;47:201–210. [PubMed] [Google Scholar]
  26. Trabzuni D, Ryten M, Walker R, Smith C, Imran S, Ramasamy A, Weale ME, Hardy J. Quality control parameters on a large dataset of regionally dissected human control brains for whole genome expression studies. J Neurochem. 2011;119:275–282. doi: 10.1111/j.1471-4159.2011.07432.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ubhi K, Low P, Masliah E. Multiple system atrophy: A clinical and neuropathological perspective. Trends Neurosci. 2011;34:581–590. doi: 10.1016/j.tins.2011.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):Research0034. doi: 10.1186/gb-2002-3-7-research0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Waller R, Woodroofe MN, Francese S, Heath PR, Wharton SB, Ince PG, Sharrack B, Simpson JE. Isolation of enriched glial populations from postmortem human CNS material by immuno-laser capture microdissection. J Neurosci Methods. 2012;208:108–113. doi: 10.1016/j.jneumeth.2012.04.014. [DOI] [PubMed] [Google Scholar]

Articles from Glia are provided here courtesy of Wiley

RESOURCES