Abstract
Background
Previous reports associated 2 mutant SOD1 alleles (SOD1:c.118A and SOD1:c.52T) with degenerative myelopathy in 6 canine breeds. The distribution of these alleles in other breeds has not been reported.
Objective
To describe the distribution of SOD1:c.118A and SOD1:c.52T in 222 breeds.
Animals
DNA from 33,747 dogs was genotyped at SOD1:c.118,SOD1:c.52, or both. Spinal cord sections from 249 of these dogs were examined.
Methods
Retrospective analysis of 35,359 previously determined genotypes at SOD1:c.118G>A or SOD1:c.52A>T and prospective survey to update the clinical status of a subset of dogs from which samples were obtained with a relatively low ascertainment bias.
Results
The SOD1:c.118A allele was found in cross‐bred dogs and in 124 different canine breeds whereas the SOD1:c.52T allele was only found in Bernese Mountain Dogs. Most of the dogs with histopathologically confirmed degenerative myelopathy were SOD1:c.118A homozygotes, but 8 dogs with histopathologically confirmed degenerative myelopathy were SOD1:c.118A/G heterozygotes and had no other sequence variants in their SOD1 amino acid coding regions. The updated clinical conditions of dogs from which samples were obtained with a relatively low ascertainment bias suggest that SOD1:c.118A homozygotes are at a much higher risk of developing degenerative myelopathy than are SOD1:c.118A/G heterozygotes.
Conclusions and Clinical Importance
We conclude that the SOD1:c.118A allele is widespread and common among privately owned dogs whereas the SOD1:c.52T allele is rare and appears to be limited to Bernese Mountain Dogs. We also conclude that breeding to avoid the production of SOD1:c.118A homozygotes is a rational strategy.
Keywords: Amyotrophic lateral sclerosis, Cytoplasmic aggregates, DNA test, Spinal cord
Abbreviations
- ALS
amyotrophic lateral sclerosis
- DM
degenerative myelopathy
- SOD1
superoxide dismutase 1
Taken literally, the term “canine degenerative myelopathy” (DM) could refer to a wide variety neurologic diseases of dogs. Since 1973, however, the term DM most often has been used to describe a progressive neurodegenerative disease (or diseases) with characteristic clinical signs and distinct histopathologic spinal cord lesions.1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 Most dogs are at least 8 years old before the onset of clinical signs. The initial signs of DM typically include asymmetric general proprioceptive ataxia and spastic paresis in the pelvic limbs. At this stage, segmental spinal reflexes are indicative of upper motor neuron loss. Disease progression is relentless, and dog owners often elect euthanasia within 1 year after onset of clinical signs when their dogs become paraplegic.2 When euthanasia is delayed, weakness can ascend to the thoracic limbs with the emergence of lower motor neuron signs such as flaccid tetraplegia, widespread muscle atrophy, dysphagia, and inability to bark.3, 4, 5 Because a variety of common acquired compressive spinal cord diseases can mimic the early signs of DM by compromising upper motor neuron pathways, a definitive diagnosis of DM can only be made postmortem by the histopathologic observation of axonal and myelin degeneration along with astrogliosis in spinal cord funiculi. These degenerative changes can occur throughout the spinal cord white matter, but usually are most severe in the dorsal portion of the lateral funiculus in the middle to lower thoracic spinal cord segments.1, 6, 7, 8, 9 Other histopathologic lesions in dogs with DM can include denervation atrophy in muscle and nerve fiber loss with axonal degeneration and secondary demyelination.3, 10
In 2009, we reported that dogs with histopathologically confirmed DM were homozygous for the A allele of a SOD1 missense mutation, SOD1:c.118G>A, which predicts a p.E40K amino acid substitution in superoxide dismutase 1 (SOD1).3 More recently, we described a histopathologically confirmed case of DM in a dog that tested homozygous for the ancestral SOD1:c.118G allele.11 This dog was homozygous for the T allele of a different SOD1 missense mutation, c.52A>T, which predicts a p.S18T amino acid substitution. The SOD1:c.52T homozygote was a Bernese Mountain Dog. The earlier study that identified the SOD1:c.118G>A mutation focused on 5 canine breeds: Boxer, Chesapeake Bay Retriever, German Shepherd Dog, Pembroke Welsh Corgi, and Rhodesian Ridgeback.3 Nonetheless, members of many other canine breeds have been diagnosed with DM.2, 5, 12, 13 To provide a broader view of the potential contribution of the known SOD1 missense mutations across multiple canine breeds, we here report 35,359 genotypes at SOD1:c.118, SOD1:c.52, or both determined using DNA samples from members of 222 canine breeds, including 249 dogs from which spinal cord segments were obtained post mortem for histopathologic evaluation.
Materials and Methods
This report includes the results of all SOD1:c.118G>A or SOD1:c.52A>T genotype determinations completed at the University of Missouri before April 5, 2013. These genotypes were generated by testing DNA from a variety of sources, including previously collected samples in the University of Missouri Animal DNA Repository or in the Canine Health Information Center DNA Bank (offa.org/chicdnabank.html). Other samples were submitted by dog owners or their veterinarians to the University of Missouri or to the Orthopedic Foundation for Animals for DNA testing for mutations associated with a variety of inherited disorders including DM, mostly for diagnostic purposes or to be used for marker‐assisted mate selection. DNA was extracted from EDTA‐anticoagulated blood samples as previously described.3 Other samples were collected using buccal swabs1 and stored on DNA storage cards.1 DNA was extracted from 3.2 mm diameter disks punched from the cards into 96‐well plates with an electric puncher.2 After 5 washes with distilled water at room temperature, 40 μL of distilled water was added to each well that contained a disk and the 96‐well plates were heated at 95°C for 30 minutes. The dissolved DNA samples were separated from the disks by transfer to another 96‐well plate.
Genotypes at SOD1:c.118G>A were determined as previously described3 or with a TaqMan allelic discrimination assay,14 which used 5′‐GTGGGCCTGTTGTGGTATCA‐3′ with 5′‐CAAACTGATGGACGTGGAATCC‐3′ for the PCR primers and 5′‐VIC‐CTCGCCTTTAGTCAGC‐MGB‐3′ (A allele) and 5′‐FAM‐CGCCTTCAGTCAGC‐MCB‐3′ (G allele) for the competing probes. Genotypes at SOD1:c.52A>T also were determined with a TaqMan allelic discrimination assay. The PCR primer sequences were 5′‐GCCGTGTGCGTGTTGAAG‐3′ with 5′‐CCCGCCCTTGCCTTCT‐3′ and the probe sequences were 5′‐VIC‐AGTGGATGGTGCCCTC‐MGB‐3′ for the A allele and 5′‐FAM‐TGGATGGAGCCCTC‐MGB‐3′ for the T allele.
The resequencing of SOD1 in DNA from individual dogs was accomplished by PCR amplification with primers flanking the coding regions and exon‐intron junctions of all 5 SOD1 exons. Table S1 contains the PCR primer sequences, the expected sizes of the amplicons, and the annealing temperatures used for these PCR amplifications. The PCR amplifications for exon 2 through exon 5 were done with a kit3 and 40 cycles of 95°C for 30 seconds, the annealing temperature for 30 seconds, followed by an additional 30 seconds at 72°C. For exon 1, the PCR amplifications were done with a different kit4 designed for use with G‐C rich templates and 24 cycles of 95°C for 30 seconds, 64°C for 30 seconds, followed by an additional 30 seconds at 72°C. The PCR amplicons were purified with a spin column5 and sequenced in both directions with an automated Sanger sequencer.6 DNA sequence analysis software7 was used to compare the nucleotide sequences from individual dogs to one another and to build 3.1 of the NCBI canine genome reference sequence.
All of the 249 canine thoracic spinal cords in this study were dissected at necropsy from dogs that were at least 8 years old. They were fixed and embedded in paraffin. Sections of the paraffin‐embedded samples were stained with hematoxylin and eosin and with either luxol fast blue‐periodic acid Schiff or luxol fast blue‐cresyl violet to detect neuronal fiber and myelin loss as previously described.3 Previously described procedures3 were used to immunostain spinal cord sections for glial fibrillary acid protein to detect astrogliosis and for SOD1 to detect SOD1‐containing cytoplasmic aggregates. The diagnosis of DM was confirmed by demonstration of the characteristic pattern of axonal degeneration, myelin loss, and gliosis in the thoracic spinal cord. All spinal cord sections were examined by the same board‐certified veterinary pathologist (GCJ).
Results
Before April 5, 2013, DNA from 33,746 individual dogs had been genotyped for the DM‐associated SOD1:c.118G>A mutation at the University of Missouri. This included 1,368 mixed‐breed dogs and 32,378 dogs claimed by their owners to be purebred representatives of 222 different canine breeds. Almost half (49%) of these dogs (n = 16,550) were homozygous for the ancestral (or G) allele whereas 9,112 dogs (27%) were A/G heterozygotes and 8,084 dogs (24%) were homozygous for the mutant (or A) allele. The frequency of the A allele for all genotyped dogs was 37%. Table S2 shows the uneven distributions of A allele frequencies among all 222 of the genotyped canine breeds. The A allele was detected in at least 1 representative from 124 breeds. Table 1 shows the distribution of A allele frequencies in the subset of breeds with at least 50 genotyped representatives. Among the 65 breeds in this subset, the Wire Fox Terrier had the highest SOD1:c.118A allele frequency (94%) whereas for 9 of these breeds all representatives tested homozygous for the c.118G allele.
Table 1.
Genotypes at SOD1:c.118 and A allele frequencies for breeds with at least 50 tested members.
| Breed | Number Tested | Genotype | A Allele Frequency | Breed | Number Tested | Genotype | A Allele Frequency | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| G/G | G/A | A/A | G/G | G/A | A/A | ||||||
| Wire Fox Terrier | 79 | 1 | 7 | 71 | 0.94 | Borzoi | 787 | 548 | 209 | 30 | 0.17 |
| Pembroke Welsh Corgi | 3,209 | 220 | 898 | 2,091 | 0.79 | English Springer Spaniel | 127 | 97 | 17 | 13 | 0.17 |
| Boxer | 3,934 | 500 | 1,177 | 2,257 | 0.72 | Border Collie | 80 | 63 | 7 | 10 | 0.17 |
| Cavalier King Charles Spaniel | 73 | 10 | 27 | 36 | 0.68 | French Bulldog | 87 | 64 | 18 | 5 | 0.16 |
| Pit Bull Terrier | 53 | 23 | 6 | 24 | 0.51 | Irish Setter | 57 | 42 | 12 | 3 | 0.16 |
| American Water Spaniel | 91 | 22 | 46 | 23 | 0.51 | Shiloh Shepherd | 221 | 161 | 53 | 7 | 0.15 |
| Australian Shepherd | 113 | 57 | 20 | 36 | 0.41 | Great Pyrenees | 85 | 68 | 10 | 7 | 0.14 |
| Collie | 151 | 73 | 39 | 39 | 0.39 | Saint Bernard | 78 | 60 | 15 | 3 | 0.13 |
| Soft Coated Wheaten Terrier | 88 | 45 | 18 | 25 | 0.39 | Chinese Crested | 53 | 40 | 13 | 0 | 0.12 |
| Hovawart | 64 | 31 | 17 | 16 | 0.38 | Staffordshire Bull Terrier | 52 | 46 | 1 | 5 | 0.11 |
| Bernese Mountain Dog | 2,413 | 941 | 1,112 | 360 | 0.38 | Mastiff (English Mastiff) | 114 | 93 | 19 | 2 | 0.10 |
| Chesapeake Bay Retriever | 2,344 | 958 | 1,034 | 352 | 0.37 | Norwich Terrier | 74 | 60 | 14 | 0 | 0.09 |
| German Shepherd Dog | 6,458 | 3,155 | 1,884 | 1,419 | 0.37 | Australian Cattle Dog | 61 | 53 | 5 | 3 | 0.09 |
| Tibetan Terrier | 69 | 32 | 24 | 13 | 0.36 | Coton de Tulear | 110 | 94 | 16 | 0 | 0.07 |
| Kerry Blue Terrier | 558 | 254 | 223 | 81 | 0.34 | Labrador Retriever | 475 | 433 | 19 | 23 | 0.07 |
| Czechoslovakian Wolfdog | 52 | 24 | 21 | 7 | 0.34 | Nova Scotia Duck Tolling Ret. | 59 | 52 | 6 | 1 | 0.07 |
| Cardigan Welsh Corgi | 544 | 271 | 194 | 79 | 0.32 | Poodle‐Standard | 533 | 468 | 60 | 5 | 0.07 |
| Pug | 382 | 202 | 113 | 67 | 0.32 | Beagle | 57 | 52 | 3 | 2 | 0.06 |
| Jack Russell Terrier | 60 | 36 | 10 | 14 | 0.32 | Belgian Malinois | 101 | 92 | 6 | 3 | 0.06 |
| Bloodhound | 264 | 125 | 117 | 22 | 0.30 | Tenterfield Terrier | 66 | 59 | 7 | 0 | 0.05 |
| Canaan Dog | 169 | 87 | 67 | 15 | 0.29 | Siberian Husky | 97 | 92 | 3 | 2 | 0.04 |
| Rhodesian Ridgeback | 2,645 | 1,381 | 1,023 | 241 | 0.28 | Dalmatian | 180 | 172 | 4 | 4 | 0.03 |
| Kuvasz | 75 | 46 | 19 | 10 | 0.26 | Golden Retriever | 334 | 322 | 2 | 10 | 0.03 |
| Welsh Terrier | 72 | 41 | 25 | 6 | 0.26 | Rottweiler | 76 | 73 | 2 | 1 | 0.03 |
| Komondor | 55 | 32 | 22 | 1 | 0.22 | Doberman Pinscher | 55 | 54 | 0 | 1 | 0.02 |
| Shetland Sheepdog | 58 | 41 | 10 | 7 | 0.21 | Alaskan Malamute | 61 | 60 | 0 | 1 | 0.02 |
| Tamaskan (Aatu Tamaskan) | 59 | 40 | 17 | 2 | 0.18 | Newfoundland | 62 | 61 | 0 | 1 | 0.02 |
| Puli | 123 | 87 | 29 | 7 | 0.17 | Rat Terrier | 63 | 62 | 1 | 0 | 0.01 |
Breed (and number tested) for 9 breeds represented only by G/G homozygotes: Weimaraner (112); Great Dane (84); Field Spaniel (75); Basenji (59); Akita (58); English Cocker Spaniel (56); Greater Swiss Mountain Dog (53); Bouvier des Flandres (51); Dachshund (50).
A total of 1,613 dogs were genotyped for the SOD1:c.52A>T mutation. All 701 tested mixed‐breed dogs and members of 56 breeds other than the Bernese Mountain Dog were homozygous for the ancestral c.52A allele (see Table S3). Among the 912 genotyped Bernese Mountain Dogs, 59 were heterozygotes and 2 (including a previously described dog11) were homozygous for the SOD1:c.52T allele. Thus, the SOD1:c.52T allele frequency among the 912 genotyped Bernese Mountain Dogs was 3.5%. All but 1 of these Bernese Mountain Dogs also were genotyped at SOD1:c.118. Table 2 shows the distribution of genotypes among the 911 Bernese Mountain Dogs genotyped at both SOD1 loci. Notable was the absence of dogs with any of the 3 genotypes (c.52T/T and c.118A/A; c.52T/T and c.118G/A; and, c.52A/T and c.118A/A) that require the presence of a haplotype consisting of both c.52T and c.118A. Because the SOD1:c.52T and SOD1:c.118A alleles rarely, if ever, occur together as a haplotype, the 24 dogs that are heterozygous at both c.52 and c.118 are most likely compound heterozygotes. Eleven of the 24 compound heterozygous Bernese Mountain Dogs were >8 years old in May 2013 and we were able to ascertain the clinical status of 6 of them. One of them died from unrelated causes at 9.0 years of age. Another 1 was unaffected at 8.3 years of age. The other 4 compound heterozygous Bernese Mountain Dogs have exhibited clinical signs of DM, including 1 that was euthanized because of advanced disease. The histopathologic findings for this dog confirmed the diagnosis of DM.
Table 2.
Distribution of combined SOD1:c.52 and SOD1:c.118 genotypes in Bernese Mountain Dogs.
| SOD1:c.52 Genotypes | SOD1:c118 Genotypes | ||
|---|---|---|---|
| G/G | G/A | A/A | |
| A/A | 316 | 399 | 136 |
| A/T | 35 | 24 | 0 |
| T/T | 2 | 0 | 0 |
Conclusions from histopathologic examination of 249 spinal cords from mixed‐breed dogs and purebred dogs from 38 different breeds, including 213 dogs which previously had received a presumptive diagnosis of DM, are summarized in Table S4. In this table (and in Table 3), the 45 spinal cords from dogs for which a presumptive diagnosis of DM was not supported by the histopathologic findings were grouped with the 36 spinal cords from dogs euthanized for reasons unrelated to DM and classified as controls. Of the 168 spinal cords with a confirmed diagnosis of DM, 157 were from SOD1:118A homozygous dogs, 9 (2 Bernese Mountain Dogs, 2 Chesapeake Bay Retrievers, 2 German Shepherd Dogs, 2 Rhodesian Ridgebacks, and 1 Alaskan Husky) were from SOD1:c.118A/G heterozygotes, and 2 were from SOD1:c.118G homozygotes. One of the 2 SOD1:118A/G heterozygous Bernese Mountain Dogs was a c.118A/G plus c.52A/T compound heterozygote as discussed above. The coding regions in all 5 SOD1 exons from the other 8 SOD1:c.118A/G heterozygotes with confirmed DM were analyzed by PCR amplification and automated Sanger sequencing, but no additional missense mutations were found. One of the 2 SOD1:118G homozygotes with confirmed DM was a previously described Bernese Mountain Dog that was homozygous for the T allele at SOD1:c.52 11 and other was from a 11‐year‐old German Shepherd Dog with a slightly slower rate of disease progression and a more pronounced sensorimotor neuropathy than is typical for DM. No potentially causal SOD1 sequence variants were found in DNA from this dog.
Table 3.
Results of immunohistochemical staining for SOD1 aggregates.
| Breed | Number Tested | Confirmed DM | Controls | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| G/G | G/A | A/A | G/G | G/A | A/A | ||||||||
| Pos | Neg | Pos | Neg | Pos | Neg | Pos | Neg | Pos | Neg | Pos | Neg | ||
| Alaskan Husky | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| American Eskimo Dog | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| American Staffordshire Terrier | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 |
| Australian Shepherd | 3 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Beagle | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 |
| Bernese Mountain Dog | 19 | 1 | 0 | 2 | 0 | 13 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
| Bloodhound | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Borzoi | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Boxer | 35 | 0 | 0 | 0 | 0 | 24 | 0 | 0 | 1 | 1 | 5 | 2 | 2 |
| Caanan Dog | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Cardigan Welsh Corgi | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Cavalier King Charles Spaniel | 2 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 |
| Chesapeake Bay Retriever | 6 | 0 | 0 | 2 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | 1 | 0 |
| English Cocker Spaniel | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 | 0 | 0 | 0 | 0 |
| English Springer Spaniel | 3 | 0 | 0 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| German Shepherd Dog | 16 | 0 | 1 | 2 | 0 | 7 | 0 | 0 | 2 | 1 | 2 | 0 | 1 |
| Golden Retriever | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Kerry Blue Terrier | 2 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| mixed breed | 6 | 0 | 0 | 0 | 0 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
| Pembroke Welsh Corgi | 40 | 0 | 0 | 0 | 0 | 27 | 0 | 0 | 1 | 1 | 6 | 1 | 4 |
| Pug | 3 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
| Rhodesian Ridgeback | 11 | 0 | 0 | 1 | 0 | 5 | 0 | 0 | 1 | 0 | 3 | 0 | 1 |
| Rottweiler | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Rough Collie | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Scottish Deerhound | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Soft Coated Wheaten Terrier | 2 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Standard Poodle | 2 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Standard Schnauzer | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Tibetan Terrier | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 |
| White German Shepherd | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Wire Fox Terrier | 2 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Total | 173 | 1 | 1 | 8 | 0 | 105 | 0 | 0 | 15 | 4 | 21 | 6 | 12 |
“Pos” means aggregates containing SOD1 antigen were detected; “Neg” means aggregates containing SOD1 antigen were not detected.
One hundred and seventy‐three spinal cords, including 115 with confirmed DM and 58 controls, were examined by immunohistochemistry with anti‐SOD1 antibodies. The results are summarized in Table 3 and photomicrographs from selected cases are shown in Fig S1. Aggregates containing SOD1 antigen were detected in all 105 spinal cords from SOD1:c.118A homozygous dogs with confirmed DM. In addition, the SOD1:c.52T homozygous Bernese Mountain Dog and all 8 of the examined SOD1:c.118A/G heterozygous dogs with histopathologically confirmed DM had SOD1 aggregates whereas no SOD1 aggregates were detected in the SOD1:c.118G homozygous German Shepherd Dog with confirmed DM. Among the 58 control spinal cords examined by immunohistochemistry, 6 of 18 spinal cords from dogs that were homozygous for the SOD1:c.118A allele had SOD1 aggregates and 4 of 25 spinal cords from dogs that were A/G heterozygotes at SOD1:c.118 had SOD1 aggregates. These aggregates were not detected in any of the 15 spinal cords from control dogs that were homozygous for the SOD1:c.118G allele.
The occurrence of histopathologically confirmed DM in 8 dogs that were A/G heterozygotes at SOD1:c.118 and had no other SOD1 sequence variants prompted us to estimate the relative risks for developing DM for dogs with different SOD1:c.118 genotypes (A/A versus A/G versus G/G). To avoid the large ascertainment biases associated with most of the genotypes in this report, we restricted our analysis to dogs that were clinically normal and <8 years old when samples were submitted for genotyping, but that were >10 years old when an update of their clinical status was requested from their owners in the form of an online survey. Dog owners responded by providing clinical updates for 137 dogs of 17 different breeds (Table S5). As indicated in Table 4, 18 of the 30 dogs with the homozygous SOD1:c.118A genotype developed clinical signs consistent with DM whereas only 2 of the 55 SOD1:c.118A/G heterozygous dogs and only 3 of the 52 SOD1:c.118G homozygous dogs developed compatible clinical signs.
Table 4.
Owner reported online survey results for dogs that were sampled when clinically normal and younger than 8 years old, but were 10 years old or older when their clinical status was updated.
| Genotype at SOD1:c.118 | No. of Dogs Queried | No. of Queries Answered | Percent Response | No. Without Clinical DM Signs | No. with Clinical DM Signs | Percent with Clinical DM Signs |
|---|---|---|---|---|---|---|
| G/G | 204 | 52 | 25 | 49 | 3 | 6 |
| A/G | 177 | 55 | 31 | 53 | 2 | 4 |
| A/A | 131 | 30 | 23 | 12 | 18 | 60 |
| Total | 512 | 137 | 27 | 124 | 23 | 19 |
DM, degenerative myelopathy.
Discussion
The DM‐associated SOD1:c.118A allele appears to be widely distributed in the overall canine population. The allele was present in representatives from 124 different breeds or varieties, which accounts for 56% of the breeds represented in this study. For the 98 breeds in which only the SOD1:c.118G allele was detected, the mean number of genotyped dogs from each breed was only 23.4. Furthermore, in 49 of these breeds, <10 dogs were genotyped. The genotyping of more breed members would likely identify additional breeds harboring the SOD1:c.118A allele. The widespread distribution of this mutation among breeds suggests that it originated before the establishment of individual breeds. Because of the late onset of the disease signs associated with this mutation, there would be little natural selective pressure to decrease the frequency of the mutant allele. The breed‐specific SOD1:c.118A allele frequencies varied greatly even among similar breeds. For example, all 53 of the genotyped Greater Swiss Mountain Dogs were homozygous for the ancestral SOD1:c.118G allele whereas the SOD1:c.118A allele frequency was 38% for the 2,413 genotyped representatives of the closely related Bernese Mountain Dog breed. Furthermore, even though before 1985 Smooth Fox Terriers and the Wire Fox Terriers were considered by the American Kennel Club to be varieties of a single breed which could be interbred, the SOD1:c.118A allele frequency was 94% for the 79 genotyped Wire Fox Terriers whereas all 30 Smooth Fox Terriers were SOD1:c.118G homozygotes. Because dogs were selected for genotyping for a variety of reasons, the breed‐specific allele frequencies determined here are unlikely to reflect the precise overall allele frequencies for the various breeds.
In contrast to the widespread distribution of the SOD1:c.118A allele, the SOD1:c.52T allele appears to be restricted to Bernese Mountain Dogs. Even among the 912 genotyped Bernese Mountain Dogs, the SOD1:c.52T allele frequency was only 3.5%, much lower than the 38% SOD1:c.118A allele frequency in this breed. Of the 2 SOD1:c.52T homozygous Bernese Mountain Dogs, 1 developed DM as previously described11 and the other was normal at the time of sample submission and is currently <8 years of age and thus younger than the expected age of onset for DM. The 24 Bernese Mountain Dogs that were heterozygous at both SOD1:c.52 and SOD1:c.118 were most likely compound heterozygotes. The development of signs of DM in 4 of these compound heterozygotes supports our earlier assertion that the SOD1:c.52T allele can cause or contribute to the development of DM.11 We now know, however, that some SOD1:c.118 heterozygous dogs with no other SOD1 missense mutations have developed DM (see below). Documented development of DM in additional SOD1:c.52T homozygotes would provide more definitive evidence that the SOD1:c.52T allele can cause DM.
Crisp et al15 have isolated detergent‐insoluble SOD1 aggregates from the spinal cords of dogs with DM and shown that the amount of insoluble SOD1 is higher in spinal cords from more severely affected dogs. This confirms our earlier histopathologic demonstration of cytoplasmic SOD1 aggregate accumulation in the motor neurons from the spinal cords of DM‐affected dogs.4, 11 Ogawa et al16 have independently shown similarly appearing SOD1 aggregates in spinal cords from Pembroke Welsh Corgis with DM. As shown in Table 3, cytoplasmic aggregates containing SOD1 antigen were found in spinal cord neurons in all but 1 of the examined dogs with histopathologically confirmed DM. The exception was a German Shepherd Dog without any sequence variants in SOD1 coding regions. Although human SOD1 was the first gene to be associated with amyotrophic lateral sclerosis (ALS),17 mutations in many additional genes have been reported to cause ALS.18 It seems likely that the DM in the German Shepherd Dog without SOD1 aggregates results from a distinct genetic or acquired etiology. Among the control dogs, cytoplasmic aggregates bound anti‐SOD1 antibodies in spinal cord neurons from 6 of 18 SOD1:c.118A homozygotes and 4 of 25 SOD1:c.118A/G heterozygotes, even though the histopathologic examination of these cords did not support a diagnosis of DM. Mice overexpressing mutant human SOD1 transgenes have been commonly used as models to study ALS. These murine models develop SOD1‐containing aggregates before their motor neuron deficits become apparent.19 Thus, it seems plausible that some or all of the control dogs with cytoplasmic SOD1 aggregates were in a preclinical stage of DM when euthanized. Nonetheless, the occurrence of SOD1 aggregates in several of the control dogs indicates that their presence is not by itself a reliable diagnostic indicator for DM. In the previously mentioned transgenic mouse models, genetic background can affect neurodegeneration onset or progression.20 This suggests that mean susceptibility to SOD1‐associated DM could differ among breeds.
All of the dogs with confirmed DM in our earlier study were SOD1:c.118A homozygotes,3 which suggested an autosomal recessive mode of inheritance. This differs from the autosomal dominant mode of inheritance typically seen with human SOD1‐associated ALS.21 We now report that the diagnosis of DM has been histopathologically confirmed in 8 dogs that were A/G heterozygotes at SOD1c.118, but had no other sequence variants predicted to alter the primary structure of the encoded SOD1. This finding is consistent with the hypothesis that the pathologic mechanisms underlying the development of DM are similar to the toxic gain‐of‐function mechanisms believed to be responsible for the development of SOD1‐related ALS.22 The occurrence of confirmed DM in these 8 SOD1c.118A/G heterozygotes suggested that compared to SOD1c.118G homozygotes, the heterozygotes are at increased risk of developing DM. This finding could call into question the strategy commonly used by dog breeders who mate SOD1:c.118A homozygotes or SOD1:c.118A/G heterozygotes only to SOD1:c.118G homozygotes to avoid the production of new generations of SOD1:c.118A homozygotes at risk of developing DM in old age. Thus, we wanted to estimate the risk of developing DM for dogs with the heterozygous SOD1c.118A/G genotype relative to SOD1:c.118A homozygotes and to SOD1:c.118G homozygotes. Most of our genotype results could not be used for this purpose because of the strong biases associated with sample acquisition. Instead, we estimated relative risks based only on the genotype results for clinically normal dogs that were sampled at <8 years of age but that were ≥10 years of age when their clinical status was recently updated. We considered the results from these dogs to have a relatively low ascertainment bias because this cohort of dogs was too young to have exhibited clinical signs of DM when the samples were submitted for genotyping. As indicated in Table S5, we received survey results updating the clinical status for 137 dogs from 17 breeds. Sixty percent of the 30 SOD1:c.118A homozygous dogs in this cohort developed clinical signs consistent with DM whereas only 4% of the 55 SOD1:c.118A/G heterozygotes and only 6% of the 53 SOD1:c.118G homozygotes developed clinical signs of DM (Table 4). This suggests that the relative risk of developing signs of DM for SOD1:c.118A/G heterozygotes is similar to that of G/G homozygotes and much lower than that for SOD1:c.118A homozygotes. Thus, the above‐mentioned strategy of breeding to avoid the production of SOD1:c.118A homozygous puppies still appears to be warranted, particularly in breeds with high SOD1:c.118A allele frequencies where stricter selection strategies would come at the expense of selecting for other important traits.
Supporting information
Table S1. PCR primer sequences, amplicon sizes, and annealing temperatures for PCR amplification of canine SOD1 exons.
Table S2. SOD1:c.118 genotypes and A allele frequencies for individual breeds.
Table S3. SOD1:c.52 genotypes and T allele frequencies for individual breeds or varieties.
Table S4. SOD1:c.118 genotypes of DM‐affected and control dogs with evaluated spinal cord histopathology.
Table S5. Compilation of owner‐reported clinical‐update survey results.
Fig S1. Photomicrographs of spinal cord sections with and without SOD1 aggregates.
Fig S2. DM Questionnaire.
Acknowledgments
We appreciate the help from dog owners and their veterinarians who provided buccal swab samples, blood samples, and fixed spinal cord segments as well as clinical information about the dogs.
Grant support: Supported by grants #821, #1213A from the AKC Canine Health Foundation, a University of Missouri, College of Veterinary Medicine Faculty Research Award, ALS Association grant #6054, and grants from the Orthopedic Foundation for Animals and the Swedish Research Council.
Conflict of Interest Declaration: A DNA test to diagnose degenerative myelopathy and to identify heterozygous carriers of the SOD1:c.118A allele is the subject of pending patent applications that include 3 of the coauthors (Gary Johnson, Joan Coates, and Kerstin Lindblad‐Toh) of this manuscript.
Footnotes
Whatman FTA Elute cards and swabs; GE Healthcare Life Sciences, Piscataway, NJ
Wallac DBS Puncher, PerkinElmer, Waltham, MA
GoTaq enzyme and buffer; Promega, Madison, WS
AccuPrimer GC‐Rich DNA Polymerase; Invitrogen, Carlsbad, CA
QIAquick PCR Purification Kit; Qiagen Inc, Alameda, CA
Applied Biosystems 3730xl DNA Analyzer, South San Francisco, CA
Sequencer 5.0; Gene Codes Corporation, Ann Arbor, MI
References
- 1. Averill DR. Degenerative myelopathy in the aging German Shepherd Dog: Clinical and pathologic findings. J Am Vet Med Assoc 1973;162:1045–1051. [PubMed] [Google Scholar]
- 2. Coates JR, Wininger FA. Canine degenerative myelopathy. Vet Clin North Am Small Anim Pract 2010;40:929–950. [DOI] [PubMed] [Google Scholar]
- 3. Awano T, Johnson GS, Wade CM, et al. Genome‐wide association analysis reveals a SOD1 mutation in canine degenerative myelopathy that resembles amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A 2009;106:2794–2799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Coates JR, March PA, Oglesbee M, et al. Clinical characterization of a familial degenerative myelopathy in Pembroke Welsh Corgi dogs. J Vet Intern Med 2007;21:1323–1331. [DOI] [PubMed] [Google Scholar]
- 5. Matthews NS, de Lahunta A. Degenerative myelopathy in an adult Miniature Poodle. J Am Vet Med Assoc 1985;186:1213–1215. [PubMed] [Google Scholar]
- 6. Griffiths IR, Duncan ID. Chronic degenerative radiculomyelopathy in the dog. J Small Anim Pract 1975;16:461–471. [DOI] [PubMed] [Google Scholar]
- 7. Braund KG, Vandevelde M. German Shepherd Dog myelopathy—A morphologic and morphometric study. Am J Vet Res 1978;39:1309–1315. [PubMed] [Google Scholar]
- 8. Johnston PEJ, Barrie JA, McCulloch MC, et al. Central nervous system pathology in 25 dogs with chronic degenerative radiculomyelopathy. Vet Rec 2000;146:629–633. [DOI] [PubMed] [Google Scholar]
- 9. March PA, Coates JR, Abyad RJ, et al. Degenerative myelopathy in 18 Pembroke Welsh Corgi dogs. Vet Pathol 2009;46:241–250. [DOI] [PubMed] [Google Scholar]
- 10. Shelton GD, Johnson GC, O'Brien DP, et al. Degenerative myelopathy associated with a missense mutation in the superoxide dismutase 1 (SOD1) gene progresses to peripheral neuropathy in Pembroke Welsh Corgis and Boxers. J Neurol Sci 2012;318:55–64. [DOI] [PubMed] [Google Scholar]
- 11. Wininger FA, Zeng R, Johnson GS, et al. Degenerative myelopathy in a Bernese Mountain Dog with a novel SOD1 missense mutation. J Vet Inter Med 2011;25:1166–1170. [DOI] [PubMed] [Google Scholar]
- 12. Bichsel P, Vandevelde M, Lang J, Kull‐Hachler S. Degenerative myelopathy in a family of Siberian Husky dogs. J Am Vet Med Assoc 1983;183:998–1000. [PubMed] [Google Scholar]
- 13. Kathmann I, Cizinauskas S, Doherr MG, et al. Daily controlled physiotherapy increases survival time in dogs with suspected degenerative myelopathy. J Vet Intern Med 2006;20:927–932. [DOI] [PubMed] [Google Scholar]
- 14. Livak KJ. Allelic discrimination using fluorogenic probes and the 5′ nuclease assay. Genet Anal 1999;14:143–149. [DOI] [PubMed] [Google Scholar]
- 15. Crisp MJ, Beckett J, Coates JR, Miller TM. Canine degenerative myelopathy: Biochemical characterization of superoxide dismutase 1 in the first naturally occurring non‐human amyotrophic lateral sclerosis model. Exp Neurol 2013;248:1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Ogawa M, Uchida K, Park ES, et al. Immunohistochemical observation of canine degenerative myelopathy in two Pembroke Welsh Corgi dogs. J Vet Med Sci 2011;73:1275–1279. [DOI] [PubMed] [Google Scholar]
- 17. Rosen DR, Siddique T, Patterson D, et al. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 1993;362:59–62. [DOI] [PubMed] [Google Scholar]
- 18. Redler RL, Dokholyan NV. The complex molecular biology of amyotrophic lateral sclerosis (ALS). Prog Mol Biol Transl Sci 2012;107:215–262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Stieber A, Gonatas JO, Gonatas NK. Aggregation of ubiquitin and a mutant ALS‐linked SOD1 protein correlate with disease progression and fragmentation of the Golgi apparatus. J Neurol Sci 2000;173:53–62. [DOI] [PubMed] [Google Scholar]
- 20. Heiman‐Patterson TD, Sher RB, Blankenhorn EA, et al. Effect of genetic background on phenotype variability in transgenic mouse models of amyotrophic lateral sclerosis: A window of opportunity in the search for genetic modifiers. Amyotroph Lateral Scler 2011;12:79–86. [DOI] [PubMed] [Google Scholar]
- 21. Rothstein JD. Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009;65(Suppl 1):S3–S9. [DOI] [PubMed] [Google Scholar]
- 22. Verma A, Tandan R. RNA quality control and protein aggregates in amyotrophic lateral sclerosis: A review. Muscle Nerve 2013;47:330–338. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1. PCR primer sequences, amplicon sizes, and annealing temperatures for PCR amplification of canine SOD1 exons.
Table S2. SOD1:c.118 genotypes and A allele frequencies for individual breeds.
Table S3. SOD1:c.52 genotypes and T allele frequencies for individual breeds or varieties.
Table S4. SOD1:c.118 genotypes of DM‐affected and control dogs with evaluated spinal cord histopathology.
Table S5. Compilation of owner‐reported clinical‐update survey results.
Fig S1. Photomicrographs of spinal cord sections with and without SOD1 aggregates.
Fig S2. DM Questionnaire.
