Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2014 Oct 2;289(47):33001–33011. doi: 10.1074/jbc.M114.593749

FliT Selectively Enhances Proteolysis of FlhC Subunit in FlhD4C2 Complex by an ATP-dependent Protease, ClpXP*

Yoshiharu Sato ‡, Akiko Takaya ‡, Chakib Mouslim §, Kelly T Hughes §,1, Tomoko Yamamoto ‡,2
PMCID: PMC4239645  PMID: 25278020

Background: The flagellum-related protein FliT and the ATP-dependent protease ClpXP negatively regulate the activity of the flagellar master transcriptional regulator, FlhD4C2.

Results: FliT selectively enhances the ClpXP-dependent proteolysis of FlhC subunit of FlhD4C2.

Conclusion: FliT and ClpXP work concertedly to repress FlhD4C2 activity by enhanced degradation of FlhC subunit.

Significance: Enhancement of ClpXP-dependent proteolysis of FlhC by FliT is a novel example of regulated proteolysis.

Keywords: ATPases Associated with Diverse Cellular Activities (AAA), Chaperone, Gene Regulation, Protein Degradation, Proteolysis

Abstract

We previously reported that the ClpXP ATP-dependent protease specifically recognizes and degrades the flagellar master transcriptional activator complex, FlhD4C2, to negatively control flagellar biogenesis. The flagellum-related protein, FliT, is also a negative regulator of flagellar regulon by inhibiting the binding of FlhD4C2 to the promoter DNA. We have found a novel pathway of FliT inhibition of FlhD4C2 activity connected to ClpXP proteolysis. An in vitro degradation assay using purified proteins shows that FliT selectively increases ClpXP proteolysis of the FlhC subunit in the FlhD4C2 complex. FliT behaves specifically to ClpXP-dependent proteolysis of FlhC. An in vitro interaction assay detects the ternary complex of FliT-FlhD4C2-ClpX. FliT promotes the affinity of ClpX against FlhD4C2 complex, whereas FliT does not directly interact with ClpX. Thus, FliT interacts with the FlhC in FlhD4C2 complex and increases the presentation of the FlhC recognition region to ClpX. The DNA-bound form of FlhD4C2 complex is resistant to ClpXP proteolysis. We suggest that the role of FliT in negatively controlling the flagellar gene expression involves increasing free molecules of FlhD4C2 sensitive to ClpXP proteolysis by inhibiting the binding to the promoter DNA as well as enhancing the selective proteolysis of FlhC subunit by ClpXP.

Introduction

ClpXP is a member of the AAA+ proteases (the term AAA comes from ATPases associated with diverse cellular activities) that have important regulatory functions in bacterial cells by adjusting the activity of key metabolic enzymes or limiting the availability of critical regulatory proteins that control gene expression (1, 2). The ClpP component of ClpXP consists of two stacked heptameric rings, which enclose a central chamber containing the 14 active sites of the peptidase (3). The ClpX component is a hexameric ring ATPase that binds substrate proteins, denatures them, and translocates the unfolded polypeptides into the ClpP degradation chamber (4). Substrate recognition is critical for the targeted degradation of regulatory proteins whose level needs to be precisely controlled in cells. In some instances, substrates are recognized directly by ClpXP by a degradation tag (5). In other cases, which are called regulated proteolysis, an accessory protein called an adaptor is required to ensure efficient degradation (1, 6–8). Adaptor proteins enhance or expand the substrate recognition of their cognate proteases. For example, an adaptor protein, SspB, is present in Escherichia coli (7). When E. coli cells encounter amino acid starvation, translation stalls, and the generated truncated nascent peptides are tagged. SspB binds to both SsrA-tagged peptides and ClpX, thereby increasing the effective local concentration of these molecules. This adaptor-mediated degradation would rescue ribosome stalling caused by amino acid starvation.

We have recently reported that a Salmonella protein, YdiV, which was initially identified as a negative regulator of flagellar gene expression (9–11), accelerates ClpXP-dependent degradation of FlhD4C2, a master transcriptional regulator that acts at the apex of the transcription hierarchy of flagellar genes organized into three promoter classes. The data show that YdiV acts as an adaptor protein binding the FlhD subunit and delivering the FlhD4C2 complex to ClpXP protease for degradation (12). YdiV interacts with FlhD4C2 complex bound to the specific promoter DNA to release FlhD4C2 from the DNA-protein complex (12). YdiV is the first example of dual function protein that targets the transcriptional regulator for protease-dependent degradation by releasing the previously bound regulator protein from the DNA. Substrates identified for ClpXP proteolysis include many transcriptional activators with DNA binding activity, such as RpoS, CtrA, and FlhD4C2 (2, 13, 14). These specifically and strongly bind to the promoter DNA to activate transcription of their corresponding gene. It is therefore assumed that the specific binding of DNA to substrate protein may protect the protein from ClpXP proteolysis. Here we demonstrate that FlhD4C2 bound to the promoter DNA for class II genes in the flagellar regulon is resistant to ClpXP-proteolysis.

A Salmonella protein FliT is a multifunctional protein that regulates flagellar biogenesis. FliT functions as an anti-FlhD4C2 factor in transcriptional control (i.e. it inhibits the binding of FlhD4C2 complex to the promoter DNAs of class II genes in flagellar regulon, leading to the negative regulation of flagellar gene expression) (15). FliT is also an export chaperone specific for the filament-capping protein FliD; it binds to FliD to prevent its premature aggregation in the cytoplasm and control its export (16, 17). FliT also associates with ATPases of flagellar apparatus, FliI and FliJ (18).

In the present study, we demonstrate that FliT selectively enhances the proteolysis of FlhC subunit in FlhD4C2 complex by ClpXP. Our analyses show that FliT in vitro forms a ternary complex of ClpX-FliT-FlhD4C2 through interactions with ClpX and FlhD4C2 and between FliT and FlhC. We also show that the DNA-bound form of FlhD4C2 is resistant to ClpXP-dependent proteolysis. These findings indicate that the role of FliT as an anti-FlhD4C2 factor for flagellar expression includes (i) inhibition of FlhD4C2 binding to the promoter DNA, resulting in an increase of the form of FlhD4C2 sensitive to ClpXP-proteolysis, and (ii) enhancement of selective proteolysis of the FlhC subunit in the complex with ClpXP, decreasing the level of functional FlhD4C2.

EXPERIMENTAL PROCEDURES

Bacterial Strains, Plasmids, and Media

Bacterial strains and plasmids are listed in Tables 1 and 2 (12, 17, 19, 20). Bacteria were grown in L broth (1% Bacto tryptone, 0.5% Bacto yeast extract, 0.5% sodium chloride, pH 7.4) and L agar. When necessary, the medium was supplemented with chloramphenicol (20 μg ml−1) tetracycline (10 μg ml−1), ampicillin (25 μg ml−1), kanamycin (25 μg ml−1), and spectinomycin (25 μg ml−1).

TABLE 1.

Bacterial strains used in this study

Unless designated otherwise, these strains were constructed during the course of this study.

Strain Relevant properties Reference or source
S. enterica serovar Typhimurium
    TH18233 ΔaraBAD975::fliT+ (ParaBAD-fliT+) fliL5100::MudJ
    TH18236 ΔaraBAD975::fliT+ fliL5100::MudJ ΔclpX
    TH18237 ΔaraBAD975::fliT+ fliL5100::MudJ clpX79 (ΔZBD (AA1–60))

E. coli
    DH5αZ1 DH5α lacIq Laboratory collection
    CS5123 DH5αZl carrying pTKY610 Tomoyasu et al. (14)
    CS6757 MC4100 ΔclpPX::Cm ΔflhDC::Km
    CS6764 MC4100 ΔclpPX-lon::Cm ΔhslVU::Tc carrying pHCX1
    CS6828 DH5α carrying pGex6p1-FliT
    CS6840 SG1146 ΔclpP::Cm ΔflhDC::Km carrying pDHC1
    CS6453 MC4100 Δlon ΔclpPX/pProEX htb GFP-ssrA
    CS6530 DH5α carrying pTKY630
TABLE 2.

Plasmids used in this study

Plasmid Relevant characteristics Reference or source
pTKY610 pUHE21–2Δfd12 carrying clpP gene, Ap Takaya et al. (12)
pHCX1 pTrcHisA carrying clpX gene This study
pTKY630 pZA4lacIq carrying ΔZBD (1–60)-clpX gene This study
pDHC1 pTrcHisA carrying flhD-His6-flhC gene This study
pGex6p1-fliT pGex6p-1 carrying fliT gene Imada et al. (17)
pUHE21–2Δfd12 PA1/lacO1 system vector, Ap Gamer et al. (19)
pProEx htb GFP-SsrA pProEx htb carrying gfp-ssrA Wojtyra et al. (20)
pZA4lacIq lacIq Sp Lab collection
In Vivo Transcription of fliL Promoter

In vivo transcription of the FlhD4C2-dependent fliL promoter was monitored using a mini-Mu lac operon reporter MudJ (21). Transposition of MudJ into the chromosome of Salmonella Typhimurium strain LT2 was performed as described, selecting for MudJ-encoded kanamycin resistance (22). Selection plates also contained bacteriophage χ (Chi), which kills flagellated cells (23) and provided a positive selection for MudJ insertions that had disrupted flagellar genes. MudJ insertions were then subject to complementation and DNA sequence analysis. Selection for χ resistance and flagellar gene complementation analysis was performed as described (24). Complementation studies followed by DNA sequence analysis of the fliL5100::MudJ allele used here determined that the MudJ had inserted after the first base of amino acid 97 in the fliL coding region and placed the lac operon under the control of the fliL promoter.

Construction of Plasmids

To construct plasmid pHCX1 encoding His6-TEV-ClpX,3 the clpX gene was amplified from the chromosome of strain χ3306, using the primers clpX-NheTEV-f (GGTATGGCTAGCGAAAACCTGTACTTCCAAATGACAGATAAACGCAAAG) and clpX-Xho-r (GCAGATCTCGAGTTATTCGCCAGAAGCCT). The fragment generated was cleaved with NheI at the 5′ end and XhoI at the 3′ end, and cloned into pTrcHisA. To construct plasmid pDHC1 encoding FlhD-His6-TEV site-FlhC, the flhD gene was amplified from the chromosome with flhD-Nco-f (CTTCCCCATGGGAACAATGCATACA) and flhD-Xho-r (CTAGACTCGAGTTATGCCCTTTTCTTACG). The fragment generated was cleaved with NcoI at the 5′ end and XhoI at the 3′ end and cloned into pTrcHisA. To generate the flhC-containing plasmid, the gene was amplified by flhC-NdeI-TEV-f (CACGTGCATATGCACCATCACCACCATCATGAAAACCTGTACTTCCAAATGAGTGAAAAAAGCATTG) and flhC-XhoI-r (ACACCGCTCGAGTTAAACAGCCTGTTCGAT) primers from the chromosome of the strain χ3306. The fragment generated was cleaved with NdeI and XhoI and initially cloned into pCold. The region of His6-TEV site-flhC on pCold was amplified by using the primers flhC-Xho-f (GCCATCTCGAGGAAAGGCGCACTTAATTAT and flhC-Pst-r (GATCCCTGCAGTTAAACAGCCTGTTCGATC). The fragment generated was cleaved with XhoI at the 5′ end and PstI at the 3′ end and cloned into pTrcHisA-FlhD constructed as described above.

Purification of ClpP, ClpX, FliT, and FlhD4-(His6FlhC)2 Complex

To purify ClpP, 1 liter of cultured E. coli DH5aZ1 derivative carrying pTKY610 (CS5123) was incubated at 37 °C until the cells reached an A600 of 0.4. Isopropyl 1-thio-β-d-galactopyranoside was added to a final concentration of 1 mm for 3 h before the cells were collected by centrifugation. Cells suspended in 50 ml of buffer A (50 mm Tris-HCl, pH 7.5, 150 mm KCl, 10% glycerol) were incubated on ice for 30 min. After lysis by sonication, the supernatant after centrifugation was loaded onto a HiTrap Q HP column (1 ml; GE Healthcare) and washed with buffer A. The proteins were eluted with 20 ml of a 150–500 mm KCl linear gradient. The fractions containing ClpP were dialyzed into buffer B (50 mm sodium acetate, pH 5.3, 1 mm DTT, 10% glycerol). The sample was loaded onto a Resource S column (1 ml; GE Healthcare) and washed with buffer B. The proteins were eluted with 20 ml of a 0–1000 mm KCl linear gradient. The eluent was run on gel chromatography using Superdex 200 10/300GL (24 ml; GE Healthcare) with buffer C (50 mm Tris-HCl, pH 7.5, 1 mm MgSO4, 1 mm DTT, 40 mm NaCl, 10% glycerol).

To purify ClpX, 1 liter of a culture of E. coli MC4100, ΔclpXP-lon::Cm, ΔhslUV::Tc carrying pHCX1 (CS6764) was incubated at 37 °C until the cells reached an A600 of 0.4. Isopropyl 1-thio-β-d-galactopyranoside was added to a final concentration of 1 mm for 2 h before the cells were collected by centrifugation. They were resuspended in 100 ml of buffer D (50 mm Tris-HCl, pH 7.5, 300 mm NaCl, 20 mm imidazole, 0.02% Triton X-100, 20% glycerol) containing 2 tablets of Complete EDTA-free protease inhibitor (Roche Applied Science). After lysis by sonication, the supernatant collected following centrifugation was batch-bound to 1 ml of Ni-NTA-agarose (Qiagen) and washed with buffer D. Bound ClpX proteins were eluted with buffer E (50 mm Tris-HCl, pH 7.5, 300 mm NaCl, 500 mm imidazole, 0.02% Triton X-100, 20% glycerol). A one-twentieth molar amount of His-TEV protein was added to the elution fraction to remove the His-TEV cut site tag. The sample was dialyzed against buffer F (50 mm HEPES-KOH, pH 7.5, 300 mm NaCl, 20 mm imidazole, 0.02% Triton X-100, 20% glycerol) in a cold room for 4 h. Fractions containing ClpX were run on gel chromatography using Superdex 200 10/300GL (24 ml; GE Healthcare) with buffer G (50 mm Tris-HCl, pH 7.5, 50 mm NaCl, 1 mm DTT, 10% glycerol). For concentration, the fractions containing ClpX were loaded onto HiTrap Q HP (1 ml; GE Healthcare) and washed with buffer H (50 mm Tris-HCl, pH 7.5, 50 mm NaCl, 1 mm DTT, 20% glycerol). The proteins were eluted with 20 ml of a 0–1000 mm NaCl linear gradient. The peak fractions of ClpX were collected and dialyzed against buffer H.

To purify the FlhD4-(His6FlhC)2, 1 liter of a culture of E. coli SG1146 ΔclpP::Cm, ΔflhDC::Km carrying pDHC1 (CS6840) was incubated at 37 °C until the cells reached an A600 of 0.6. Isopropyl 1-thio-β-d-galactopyranoside was added to a final concentration of 1 mm for 3 h, and the cells were collected by centrifugation. The pelleted cells were resuspended in 80 ml of buffer I (50 mm NaHPO4, pH 8.0, 300 mm NaCl, 20 mm imidazole, 1 mm DTT) containing 2 tablets of complete-EDTA free protease inhibitor (Roche Applied Science). After lysis by sonication, the supernatant collected by centrifugation was batch-bound to a 1-ml slurry of Ni-NTA agarose (Qiagen) and washed with buffer I. Bound proteins were eluted with buffer I containing 250 mm of imidazole. The fractions containing FlhD4-(His6FlhC)2 were dialyzed against buffer J (50 mm HEPES-NaOH, pH 7.5, 50 mm NaCl, 1 mm DTT) and loaded onto HiTrap heparin column (1 ml; GE Healthcare). The proteins were eluted with 20 ml of a 0–1000 mm NaCl linear gradient. To purify intact FlhD4C2, the His-TEV site tag was removed by incubating with His-TEV protease during dialysis in buffer J for 4 h and loaded onto a heparin column as described above. His-GFP-SsrA was purified as described previously (20).

To purify FliT, 1-liter cultures of E. coli BL21, carrying the plasmid pGex6p-1-GST-FliT, were grown to an A600 of 0.4, induced by adding 1.0 mm isopropyl 1-thio-β-d-galactopyranoside, incubated for 3 h, collected, and frozen. Thawed cells were suspended to 40 ml of lysis buffer (50 mm Tris-HCl, pH 7.5 150 mm NaCl, 10% glycerol, 1 mm DTT) containing 1 tablet of protease inhibitor (Complete EDTA-free, Roche Applied Science). The cells were lysed by sonication, and the lysate was centrifuged at 10,000 × g for 20 min at 4 °C. The supernatant was batch-bound to 1 ml of pre-equilibrated GST-Sepharose 4FF as slurry, and the sample was rotated for 20 min at 4 °C. After centrifugation, the beads were washed twice with 5 ml of lysis buffer. Bound GST-FliT was eluted in 1 ml of 20 mm reduced glutathione-containing lysis buffer. To purify GST-FliT, the eluted fraction was passed through a Superdex 200 10/300G column equilibrated with lysis buffer. For the purification of the intact version of FliT, the eluted fraction was dialyzed with lysis buffer containing 5 units of Precision protease overnight at 4 °C. The dialyzed sample was rebound to GST-Sepharose beads, and the flow-through fraction was passed through a HiTrap Q HP 1-ml column (equilibrated with buffer J and eluted with a 0–1000 mm NaCl linear gradient).

In Vitro Degradation Assay

The degradation assay was carried out in Clp assay buffer (25 mm HEPES, pH 7.6, 50 mm KCl, 10 mm MgCl2, and 1 mm DTT) using purified proteins. FlhD4-(His6FlhC)2 complex was incubated with ClpX and ClpP at 37 °C in the presence or absence of 3 mm ATP. To see the effect of FliT on the ClpXP proteolysis, a FlhD4-(His6FlhC)2 complex or intact FlhD4C2 complex was preincubated with FliT for 3 min at 37 °C and then proteolyzed as above. A portion of the reaction mixture was mixed with SDS-sample buffer and processed on 16% SDS-PAGE and Coomassie Brilliant Blue staining.

In Vitro Pull-down Assay

Purified FlhD4-(His6FlhC)2 (1 μm) was batch-bound to Ni-NTA resin in 100 μl of Clp binding buffer with 10 mm imidazole (25 mm HEPES-KOH, pH 7.6, 50 mm KCl, 10 mm MgCl2, 5% glycerol, 1 mm DTT, 1 mm ATP, or AMP-PNP, 10 mm imidazole). 0.1 μm ClpX6 and 1 μm FliT2 were preincubated with FlhD4-(His6FlhC)2 for 5 min. Bound beads were washed twice with 500 μl of Clp binding buffer. ClpX and FliT bound to FlhD4-(His6FlhC)2 were coeluted with 500 mm imidazole-containing Clp assay buffer. A pull-down assay with GST-Sepharose beads was used to detect ternary complex of FliT-FlhD4C2-ClpX. 1 μm purified (GST-FliT)2 was batch-bound to GST resin in 100 μl of Clp binding buffer with 1 mm ATPγS. 0.1 μm ClpX6 and 1 μm FlhD4-(His6FlhC)2 were preincubated with GST-FliT for 5 min. Bound beads were washed twice with 500 μl of Clp assay buffer. ClpX and FlhD4-(His6FlhC)2 bound to GST-FliT were coeluted with 100 mm GSH-containing Clp assay buffer.

ATPase Assay

ATPase activity was measured according to the colorimetric method of Lanzetta et al. (25) in 25 μl of Clp assay buffer. Samples contained 0.5 μg of ClpX and 3 mm ATP. 2.0 μg of FlhD4C2, 0.5 μg of ClpP, and 0.5 μg of FliT, respectively, were added to the samples when required. The reactions were stopped by the addition of 5 μl of 500 mm EDTA. The reaction mixture was mixed with 200 μl of malachite green mixture (3:1:1:1 volumes of water, 2 mm malachite green, 50 mm ammonium molybdate, and 2.5% polyvinyl alcohol), and 25 μl of 1 m sodium citrate. Absorption at 600 nm was measured after 30 min of incubation at room temperature. Results were compared with the calibration curve prepared for the phosphate salt.

Biolayer Interferometry (BLI) Analysis

To measure affinity and kinetics of the interaction of FlhD4-(His6FlhC)2 and DNA, a biolayer interferometry assay was done in an Octet RED96 instrument. Purified FlhD4-(His6FlhC)2 was captured on an Ni-NTA sensor (ForteBio). Purified flhB promoter DNA was serially diluted in Clp assay buffer and bound to captured FlhD4-(His6FlhC)2. One-shot kinetics analysis was done with parallel sensors, and a local Rmax model was fitted to estimate Kd and kon/koff. The first 10 s of dissociation time is omitted from the curve fitting analysis to minimize the buffer effect. To prepare DNA fragments of FlhD4C2 binding site, the class II promoter region ranging from −226 to +48 of the transcriptional start site of flhB was amplified by PCR (generated fragment size is 274 bp). To prepare unrelated DNA fragment unbound to FlhD4C2 as a negative control, a DNA fragment with similar sized 278-bp region is amplified from the Salmonella genome using the following primers, neg-dna-f (AAGGATCCGAAAACCTGTATTTTCAGATGAAACCTCTTCGCCAGCAAA) and neg-dna-r (TTTCTGCAGTTAGTCAGCGATTTCGTTTTCCTG).

RESULTS

FlhD4C2 Inhibition by FliT Is Partially Suppressed in ClpXP Mutants

The overexpression of FliT inhibits motility and transcription of flagellar genes (26). This effect has been shown to be dependent on the binding of FliT to the FlhD4C2 complex through the direct interaction with the FlhC subunit (17, 26). We recently established that overexpression of YdiV promotes degradation of FlhD4C2 in a ClpXP-dependent manner (12), leading to decreasing flagellar gene expression. This ClpXP-dependent effect of YdiV inhibition of flagellar genes transcription appears to be contingent on the degree of expression of YdiV because the expression of YdiV from a tetracycline-inducible promoter (PtetA) inhibits transcription of FlhD4C2-dependent gene expression in a ClpXP-dependent manner, yet the expression of YdiV from a stronger arabinose promoter (ParaBAD) inhibits FlhD4C2-dependent transcription in a ClpXP-independent pathway (12). The ClpXP-independent role of YdiV in suppressing gene expression was due to its interaction with FlhD4C2 bound to the class II promoter DNA to release FlhD4C2 from the DNA-protein complex (12). We thus investigated whether the effect of FliT on FlhD4C2-dependent transcription of flagellar genes also involved the ClpXP pathway. To test this hypothesis, the activity of a transcriptional fusion to a class II flagellar gene, fliL, in a strain overexpressing fliT under the control of ParaBAD in strain TH18233 (ParaBAD::fliT+ fliL::MudJ) was measured. In the presence of the arabinose inducer, overproduction of FliT resulted in inhibition of transcription of fliL, which appeared to be moderately suppressed in the absence of ClpX because the FliT-dependent inhibition of fliL transcription was partially diminished, but not abolished, in a clpX null mutant background (Table 3). This suggests that the ClpXP pathway is involved in the FliT-dependent inhibition of fliL transcription.

TABLE 3.

Effect of FliT overexpression on transcription of class 2 fliL gene in the clpX+ and ΔclpX backgrounds

Strain background Miller units (mean ± S.D.)
Relative activity (with arabinose/without arabinose)
Without arabinose With arabinose
-fold
clpX+ 2495.0 ± 107.4 31.1 ± 6.3 0.012
ΔclpX 3022.5 ± 268.4 357.0 ± 16.1 0.118
clpXΔ1–60 3146.4 ± 163.0 350.2 ± 12.6 0.111
FliT Directly Accelerates the Degradation of FlhC Subunit in FlhD4C2 Complex by ClpXP Protease

The finding that the FliT-dependent inhibition of fliL transcription was suppressed partially by clpXP mutation suggests that FliT might directly enhance the degradation of FlhD4C2 by ClpXP. Thus, the effects of FliT on the degradation of FlhD4C2 by ClpXP were tested in vitro. Purified ClpXP slowly degraded FlhC and FlhD subunits (Fig. 1a). In vitro degradation with purified FliT showed that it enhanced the ClpXP-dependent degradation of FlhC subunit but not the FlhD subunit in FlhD4C2 (Fig. 1a). In the absence of ATP, both FlhC and FlhD subunits remained undegraded, suggesting that the enhancement effect of FliT is linked to ATPase activity of ClpX. When ClpXP was removed from this reaction, degradation of FlhD4C2 did not occur (data not shown), excluding the possibilities that FliT also possesses protease activity and that proteases contaminate the purified FliT fraction. The effect of FliT on degradation of individual FlhC by ClpXP in vitro was not determined because the FlhC subunit could not be purified as a soluble protein, whereas FlhC could be purified when complexed in FlhD4C2. Purification of individual FlhC has so far not been successful (27, 28).

FIGURE 1.

FIGURE 1.

Degradation of FlhC in FlhD4C2 by ClpXP is accelerated by FliT in vitro. Effect of FliT on the ClpXP-dependent degradation of the FlhD4C2 (a) and FlhD4-(His6FlhC)2 (b) was examined. Each sample of 0.75 μm FlhD4C2 was preincubated for 3 min in the presence or absence of 1.0 μm FliT2 and mixed with 0.2 μm ClpX6ClpP14 and 0 or 3 mm ATP to start the proteolysis. Samples were taken at the indicated times. Each protein was separated in a 16% SDS-polyacrylamide gel and was detected by Coomassie Brilliant Blue staining. c, quantification of the FlhD and FlhC relative to the value at time 0 in the degradation assay using FlhD4-(His6FlhC)2. Mean and S.D. values (error bars) of the results of triplicate independent experiments are given. Triangles and squares show the band intensities of FlhD and FlhC, respectively. The solid line and the dashed line show the data of FliT(−) and FliT(+), respectively. The band intensity of ClpX in each lane was used for the internal control.

In vitro degradation assays, using purified FlhD4C2 complex whose FlhC subunit was His6-tagged at the N terminus, were also done to test the effect of N-terminal tagging of FlhC (Fig. 1b). ClpXP-dependent degradation of the FlhC subunit of this His-tagged FlhD4C2 complex was stimulated in the presence of FliT to the same extent as intact FlhC (Fig. 1, a–c). Hence, tagging the N terminus of FlhC subunit does not affect the function of FliT in enhancing ClpXP-dependent FlhC degradation. This His-tagged version of FlhD4-(His6FlhC)2 was therefore used for subsequent analyses. To check the effect of ADP that is generated during the reaction and inhibits the activity of ClpX, an in vitro degradation assay under regeneration condition was also performed by adding creatine kinase and creatine phosphate into the reaction. A consistent result was obtained in the degradation assay by the regeneration system, as expected from the clear difference of FlhC degradation between FliT(+) and FliT(−) at the early time point of reaction (∼15 min), where the generated ADP is negligible (data not shown).

N-terminal Domain of ClpX Is Required for Enhancement Effect of FliT on FlhC Degradation

ClpX unfolds proteins and presents them to ClpP for degradation. A zinc-binding domain (ZBD) at the N terminus of ClpX is proposed to play a role in the recognition of substrates destined for degradation (20, 29, 30). We asked whether the ZBD domain of ClpX is required for the enhancing effect of FliT on ClpXP proteolysis of FlhC by an in vitro degradation assay with the ZBD-depleted mutant ClpX. Removal of the N-terminal domain (deletion of amino acids 1–60) of ClpX completely abolished the enhancement of ClpXP-catalyzed proteolysis of FlhC by FliT (Fig. 2, a and b). The ZBD mutant of Salmonella ClpX used in this study could rapidly degrade the model substrate, GFP-SsrA (data not shown), as in E. coli ClpX (20). The requirement of the ZBD domain of ClpX for the inhibitory effect of FliT was also examined in a strain overexpressing the fliT+ gene under the control of ParaBAD. Depletion of the ZBD domain of ClpX partially suppressed the inhibitory effect of the overproduction of FliT on fliL transcription to the same extent as complete deletion of ClpX (Table 3). These results suggest that the N-terminal ZBD of ClpX is essential for the enhancement of ClpXP proteolysis of FlhC by FliT.

FIGURE 2.

FIGURE 2.

Effect of FliT to enhance in vitro degradation of FlhC requires N-terminal zinc binding domain of ClpX, and a very small amount of FliT efficiently enhances the degradation of FlhC. The degradation assay using N-terminal zinc-binding domain-depleted mutant ClpX was performed as described in the legend to Fig. 1. The level of FlhC during degradation assay is shown in a, and the quantification of the band intensity of FlhC is shown in b. Mean and S.D. values (error bars) of triplicate independent experiments are shown. The solid lines and the dashed lines show the data of FliT(−) and FliT(+), respectively. Squares and circles show the data of wild type ClpX and ΔZBD-ClpX, respectively. Degradation of 1.0 μm FlhD4C2 by 0.2 μm ClpXP was examined in the presence of four different concentrations of FliT2 (0, 0.02, 1.0, and 3.0 μm) in the degradation assay, as shown in c. The level of FlhC during the degradation assay is shown. Quantification of FlhC relative to the value at time 0 in the degradation assay is shown in d. Diamonds, squares, triangles, and circles show the data of 0, 0.02, 1.0, and 3.0 μm, respectively. Mean and S.D. values of triplicate independent experiments are given. 0.02 μm FliT2 is sufficient to enhance the degradation of 2.0 μm FlhC by 0.2 μm ClpX6ClpP14.

FliT Acts Efficiently and Specifically

Most of enhancement factors for AAA+ proteases are recycled during enhancement of the degradation of target substrate by protease, whereas some of the enhancement factors are degraded together with the target substrate by protease, such as Vir (31) and MecA (32); thus, a stoichiometric amount is required for an efficient enhancement reaction. To reveal in which way FliT acts, we examined whether FliT is recycled in the enhancement reaction. In vitro degradation assays using four different concentrations of FliTs showed that only 0.02 μm FliT2 sufficiently enhanced the degradation of a 100-fold molar excess of FlhC relative to FliT (Fig. 2, c and d). At a time of 10 min, about 30% of FlhC degradation was enhanced, corresponding to enhancement of 0.6 μm FlhC degradation by 0.02 μm FliT2 (30-fold molar excess). Moreover, the effect of FliT2 was almost saturated around 1 μm. These results suggest that FliT is recycled during enhancement of FlhC degradation, and only a small amount of FliT relative to FlhD4C2 is required for efficient enhancement of FlhC degradation.

To determine whether FliT is a specific enhancement factor for FlhC, in vitro degradation was assayed using purified model substrates, GFP-SsrA and LambdaO. Whether in the presence or absence of FliT, His6GFP-SsrA and LambdaO were degraded at similar rates (Fig. 3, a and b). As shown in the degradation of the FlhD4C2 complex (Fig. 1, b and c), degradation of the FlhD subunit was unaffected by the presence of FliT. These results suggest that FliT works specifically on FlhC, based on the specific interaction between FlhC and FliT rather than as a general enhancement factor promoting chaperone activity of ATPase subunit, like MecA for ClpC (33), or promoting the protease activity of ClpP (34).

FIGURE 3.

FIGURE 3.

Effect of FliT on ClpXP-catalyzed proteolysis of GFP-SsrA and of LambdaO in vitro. Degradation of 1.5 μm GFP-SsrA (a) and LambdaO (b) in the presence or absence of 1 μm FliT2 was assayed. The same reaction buffer with the FlhD4C2 degradation assay was used. Mean and S.D. values (error bars) of the results of triplicate independent experiments for GFP-SsrA and LambdaO are given in c and d, respectively.

FliT, FlhD4C2, and ClpX Form Ternary Complex in Vitro

To understand the mechanism of action of FliT on FlhD4C2 degradation, interaction between FliT and ClpX was assayed. Previously known adaptors enhancing the degradation of ClpXP substrates, such as SspB and UmuD, act as a tethering mechanism. In this way, an adaptor interacts strongly with both the cognate substrate and ClpX to mediate a tighter interaction between ClpX and the substrate. Because ZBD is involved in the enhancing effect of FliT (Fig. 2a), it was assumed that ZBD directly interacts with FliT. BLI analysis allowed us to investigate the interaction between ClpX and FliT. LambdaO, known as a ZBD-binding protein (35), bound directly with ZBD in a concentration-dependent manner (data not shown). In contrast, there was no interaction between FliT and ZBD under the same condition. To examine the interaction between FliT and ClpX further, we also performed an in vitro pull-down assay using GST-tagged FliT. As reported previously, binary interaction between GST-FliT and FlhD4C2 was detected by the pull-down assay (Fig. 4a, lanes 1–3). No direct interaction between FliT and ClpX could be detected (Fig. 4a, lanes 4–6). On the other hand, preincubation of ClpX, GST-FliT, and FlhD4-(His6FlhC)2 generated a ternary complex of the three components (Fig. 4, a (lanes 7–9) and b). When purified GST instead of GST-FliT was incubated with ClpX and FlhD4C2, no ClpX or FlhD or FlhC was detected (Fig. 4, a (lanes 10–12) and b), which suggests that FliT mediates the formation of the ternary complex with ClpX and FlhD4C2. Whereas FliT stimulated ATPase activity of ClpX in the presence of FlhD4-(His6FlhC)2 and ClpP (Fig. 5, p < 0.01, Student's t test), there was no stimulation in the absence of FlhD4-(His6FlhC)2. The data also suggest that FliT does not directly interact with ClpX but does so with FlhC, forming a FliT-FlhD4C2-ClpX ternary complex.

FIGURE 4.

FIGURE 4.

Detection of ternary complex of GST-FliT-ClpX-FlhD4C2 by in vitro pull-down assay. 1 μm purified (GST-FliT)2 was batch-bound to GST resin in 100 μl of Clp assay buffer containing 1 mm ATPγS. The (GST-FliT)2 was incubated with 0.1 μm ClpX6 and 1 μm FlhD4-(His6FlhC)2 for 5 min. GST resin was washed twice by 500 μl of Clp assay buffer. ClpX and FlhD4-(His6FlhC)2 bound to GST-FliT were coeluted with 100 mm GSH-containing Clp assay buffer. Input (IN), wash (W), and elution (E) fractions were loaded onto the SDS-PAGE gel as shown in a. Mean and S.D. values (error bars) of the band intensities of ClpX estimated from triplicate independent experiments are given in b.

FIGURE 5.

FIGURE 5.

FliT promotes the ATPase activity of ClpX in the presence of FlhD4C2. ATPase activity of ClpX (0.5 μg) was measured in the absence or presence of FliT (0.5 μg), ClpP (0.5 μg), and/or FlhD4-(His6FlhC)2 (2.0 μg). Mean and S.D. values (error bars) were estimated from at least three independent experiments.

Binding of FlhD4C2 to ClpX Is Promoted by FliT

The formation of a ternary complex of FliT-FlhD4C2-ClpX (Fig. 4) suggests that the enhancing effect of FliT is exerted by a stepwise mechanism rather than a simple tethering mechanism, as follows: (i) binding of FliT to FlhD4C2 complex, (ii) alteration of the accessibility of the recognition region on FlhC, and thereby (iii) increase of the affinity between ClpX and FlhD4C2. To test this hypothesis, the binding between ClpX and FlhD4-(His6FlhC)2 complex was assessed by an in vitro pull-down assay using Ni-NTA-agarose beads. Coeluted ClpX bound to His-tagged FlhD4C2 complex in the presence or the absence of FliT was examined. In the presence of FliT, binding of ClpX to FlhD4C2 complex increased (Fig. 6, a and b, p < 0.01, Student's t test), suggesting that the affinity between ClpX and FlhD4C2 complex is promoted by FliT. A pull-down assay using a different FlhD4C2 protein with a His tag at the N terminus of FlhD also promoted interaction between FlhC and ClpX (data not shown), confirming that there was no effect of His tagging at the N terminus of FlhC on FlhC-ClpX interaction.

FIGURE 6.

FIGURE 6.

FliT promotes the binding between ClpX and FlhD4C2. 1.0 μm purified N terminally His-tagged FlhD4C2 was batch-bound to Ni-NTA resin in 100 μl of Clp assay buffer with 10 mm imidazole. 1 μm FliT2 was preincubated with FlhD4-(His6FlhC)2 for 5 min. Bound beads were washed twice in 500 μl of Clp assay buffer. ClpX and FliT bound to FlhD4-(His6FlhC)2 were coeluted with 500 mm imidazole-containing Clp assay buffer. Input (IN), wash (W), and elution (E) fractions were loaded on the SDS-PAGE gel as shown in a. Quantification of the ClpX coeluted with FlhD4C2 is shown in b. The result of quantification for the pull-down assay using the non-hydrolyzable ATP analog AMP-PNP is also shown in b. ClpX band intensity was normalized by the intensity of eluted FlhC in the same lane. *, statistical significance of the difference between FliT− and FliT+ (p < 0.01, Student's t test). The mean and S.D. values (error bars) were estimated from triplicate independent experiments.

To distinguish whether FliT enhances the recognition of FlhD4C2 complex by ClpX and/or promotes the unfolding of FlhD4C2 complex requiring ATPase activity of ClpX, a pull-down assay was performed with a non-hydrolyzable ATP analog, AMP-PNP. Increased affinity between ClpX and FlhD4C2 complex by FliT was also obtained with AMP-PNP (Fig. 6b). Thus, the FliT effect works at a very early stage of substrate processing by ClpX that does not require ATPase activity.

FlhD4C2 Is Protected from Degradation by ClpXP When Bound to Class II Promoter DNA

FlhD4C2 is a DNA-binding protein that strongly binds to the class II promoter region. To determine whether the FliT-ClpXP system degrades FlhD4C2 bound to the promoter DNA, interaction between flhB promoter DNA and His-tagged FlhD4-(His6FlhC)2 was initially assessed by the BLI method. Sensor responses for FlhD4C2-DNA interaction showed concentration dependence, with responses reaching a plateau around maximum concentration (Fig. 7a), indicating a specific interaction between FlhD4-(His6FlhC)2 and DNA (Fig. 7a). Control unrelated DNA fragments showed only faint or almost no interaction with FlhD4-(His6FlhC)2 (Fig. 7b). Kd of 2.1 ± 1.0 nm and t½ of 12.8 min ± 4.8 (decay of FlhD4C2-DNA complex) were estimated from the sensorgrams of triplicate independent BLI assays. Hence, purified FlhD4C2 strongly binds with flhB promoter DNA and dissociates slowly under the conditions of the degradation assay.

FIGURE 7.

FIGURE 7.

DNA-bound form of FlhD4C2 is resistant to proteolysis. a, sensorgrams in the BLI interaction assay between FlhD4-(His6FlhC)2 captured on Ni-NTA sensor chip and flhB promoter DNA. DNA concentrations used in the assay are shown. b, sensorgrams in the BLI interaction assay between FlhD4-(His6FlhC)2 captured on Ni-NTA sensor chip and control unrelated DNA fragment. c, degradation assay of FlhD4-(His6FlhC)2 by ClpXP in the presence or absence of FliT and/or DNA. 1 μm FliT2, 0.75 μm flhB promoter DNA, or 0.75 μm control DNA was mixed with 0.75 μm FlhD4-(His6FlhC)2 as indicated and incubated for 3 min at 37 °C. 1 μm FliT2 or 0.75 μm flhB promoter DNA and 0.2 μm ClpX6P14 were added as indicated and incubated for 5 min. FliT → DNA and DNA → FliT, the addition of FliT before DNA incubation and DNA before FliT incubation, respectively. ATP (3 mm) was added to start proteolysis. Each protein was separated in a 16% SDS-polyacrylamide gel and was detected by Coomassie Brilliant Blue staining. d, mean and S.D. values (error bars) of the FlhC band intensity estimated from the results of triplicate independent experiments are given. Solid lines with circle, square, and triangle symbols indicate the FliT(−) assays of no DNA, flhB promoter DNA, and control DNA, respectively. Dashed lines with asterisk and diamond symbols indicate the FliT(+) assays of DNA → FliT and FliT → DNA, respectively.

In examining the effect of DNA on the degradation of FlhD4C2 by ClpXP in the presence of DNA (Fig. 7, c and d), it strongly inhibited the degradation of FlhC and FlhD, suggesting that the DNA-bound form of FlhD4C2 is resistant to proteolysis. Control DNA fragment unbound to FlhD4C2 did not affect the degradation of FlhD4C2, suggesting that this inhibition is due to specific interaction between FlhD4C2 and its binding site on class II promoter DNA. On the other hand, when 1 μm FliT2 was given before the addition of DNA, FlhC was rapidly degraded by ClpXP, from which we can infer that inhibition of the FlhD4C2-DNA interaction by FliT has an additional important role in the ClpXP-dependent pathway of FliT inhibition; FliT increases the proteolytically sensitive form of free FlhD4C2, which is preferentially degraded by ClpXP. If FliT was incubated after the addition of DNA, the inhibition of FlhC degradation by DNA was partially suppressed (Fig. 7, c and d). This suggests that once FlhD4C2 binds to DNA, interaction between FliT and FlhD4C2 is decreased due to the hindered access to the interaction site of FliT on FlhD4C2, consistent with the surface plasmon resonance experiments by Aldridge et al. (36). Remaining enhancement of FlhC degradation compared with the FliT(−)/flhB promoter DNA(+) reaction suggests that FlhD4C2 released from DNA during the degradation assay is rapidly captured by FliT and delivered to ClpXP-dependent proteolysis.

DISCUSSION

Mechanism of Enhancement of ClpXP-dependent Degradation of FlhC by FliT

Several mechanisms that enhance substrate degradation by AAA+ proteases have been proposed. These include the induction of subcellular co-localization of a protease and a substrate (2), promotion of substrate-protease affinity by adaptor molecules (6, 7), and enhancement of peptidase activity of ClpP by ADEP (34). We have shown that FliT selectively enhances FlhC degradation by adaptor-like mechanisms, through ternary complex formation of FliT-ClpX-FlhD4C2 and promotion of ClpX-FlhD4C2 interaction (Figs. 4, 6, and 8). However, the action of FliT was different from those of representative ClpX adaptors, such as SspB and UmuD; these adaptors enhance substrate degradation by a so-called tethering mechanism. The adaptor itself in the mechanism directly interacts with N-domain of ClpX and promotes ClpX-substrate interaction. FliT did not directly interact with ClpX, suggesting different mechanisms. Several adaptor-like factors are known to enhance substrate degradation without directly interacting with ClpX (37, 38). For example, degradation of the Mu Rep protein is enhanced by Vir, which does not interact directly with ClpX. Binding of Vir to Rep substrate leads to a conformational change of Rep degron, resulting in enhanced degradation of Rep (38). FliT also increased the interaction between ClpX and FlhD4C2, making affinity promotion by local conformational change possible for the FliT-ClpXP system. Conformational change or oligomeric state affects the susceptibility to AAA+ proteases; for example, polymerized FtsZ interacts with ClpX more tightly than the monomeric state (39, 40). Tight recognition and disassembly of only one protomer in the MuA tetramer by ClpX is also an example of conformation-dependent control of substrate recognition (41). Elucidation of the mechanism of an enhanced interaction between FlhC and ClpX from the structural viewpoint is an on-going project in our laboratory.

FIGURE 8.

FIGURE 8.

Model of ClpXP-dependent FliT inhibition of FlhD4C2 activity. In this study, we revealed two novel ClpXP-dependent routes of FliT effect in inhibiting FlhD4C2 activity. i, the inhibition of DNA binding of FlhD4C2 by FliT increases the free form of DNA-unbound FlhD4C2 sensitive to ClpXP-dependent proteolysis, thus leading to enhanced degradation of FlhD4C2. ii, FliT binding to FlhC subunit of FlhD4C2 promotes FliT-FlhD4C2-ClpXP ternary complex formation and enhances selective degradation of FlhC subunit of FlhD4C2. FliT is a flagellum-related gene whose transcription is regulated by both class II and class III promoters. Therefore, concerted action of FliT and ClpXP is considered to be important for the stringent control of FlhD4C2 activity in a manner of negative feedback control.

Degradation of FlhC Subunit in FlhD4C2 Complex Is Selectively Enhanced by FliT

The FliT effect of enhancing the degradation by ClpXP was found only for the FlhC subunit in the FlhD4C2 complex (Fig. 1), despite FliT promoting the binding of ClpX to FlhD4C2 (Fig. 6). The lack of direct interaction of ClpX with FliT and the fact that FliT interacts only with FlhC, but not with FlhD (17), suggest that FliT binding to FlhD4C2 specifically affects the FlhC subunit and ClpX-FlhC interaction. Considering the previously proposed model that ClpX does not recognize the substrate without degron (5), along with our observation that ClpXP degrades both subunits of the FlhD4C2 complex (Fig. 1), it seems that both subunits of the FlhD4C2 complex have their own individual degrons. Hence, it is of interest that ClpX-FlhD4C2 interaction is promoted by FliT, but only FlhC is enhanced. Degradation rates of FlhD and FlhC in vitro differ substantially (Fig. 1), suggesting that degradation of both subunits in the FlhD4C2 complex does not proceed simultaneously. Therefore, the individual subunits in FlhD4C2 are likely to be independently recognized and processed by ClpXP. Dissociation of the FlhD subunit from FlhC-FliT-ClpXP ternary complex during processing of FlhC subunit is probably the reason that it has no effect on FlhD degradation in the presence of FliT. Interestingly, in contrast to FliT, YdiV interacts with FlhD subunit in FlhD4C2 (42), but it enhanced ClpXP-dependent proteolysis of both subunits, FlhC and FlhD, of FlhD4C2 (12). Rapid degradation of the FlhD subunit in the FlhD4C2 could generate unstable dissociated individual FlhC and cause drastic conformational change to FlhC, which may lead to its enhanced proteolysis.

FlhD and FlhC exist as two forms in the cell, FlhD2 and FlhD4C2 (43). For efficient binding of FlhD4C2 to class II promoter DNA, both subunits of FlhD4C2 are required (44), suggesting that enhanced degradation of only the FlhC subunit is sufficient to control FlhD4C2 activity. The fact that FlhD2 also has a DNA binding ability (43) indicates its distinctive role and suggests that selective enhancement of FlhC degradation has an additional effect other than decreasing FlhD4C2 activity. FlhD2 also has roles in stabilizing FlhC and promoting the DNA binding ability of FlhC by forming stable hetero-oligomer FlhD4C2. Thus, the cellular pool of individual FlhD2 might affect FlhD4C2 activity and support rapid construction of active FlhD4C2 when cells require flagella. Enhancement of FlhC degradation by FliT-ClpXP may be involved in adjusting the cellular pool of FlhD2.

Multiple Degradation Enhancement Factors for FlhD4C2

We found a second factor that enhances FlhD4C2 degradation in addition to YdiV. Intriguingly, the ClpXP-dependent effect of FliT in vivo was stronger than that of YdiV (data not shown), suggesting that both work on the ClpXP-dependent pathway but in dissimilar ways. The two factors interact with different partners; YdiV interacts with FlhD, whereas FliT interacts with the FlhC subunit in FlhD4C2. Another notable difference relates to the DNA binding state of FlhD4C2. We previously showed that YdiV stripped off FlhD4C2 that was prebound to DNA (12). On the other hand, FliT could not interact with FlhD4C2 prebound to DNA (36). ClpXP moderately degrades both subunits of FlhD4C2 even without FliT; however, the DNA-bound form of FlhD4C2 becomes insensitive to proteolysis by ClpXP (Fig. 7). Furthermore, the FlhD4C2-DNA complex is very stable, as shown from the slow dissociation of FlhD4C2 from FlhD4C2-DNA complex (t½ = 12.8 min from our BLI assay and >40 min as reported by Claret and Hughes (43)). These results suggest that control of FlhD4C2 activity by FliT or ClpXP is mostly restricted by the state of the DNA-unbound free form of FlhD4C2. The FliT effect, shifting the equilibrium from the DNA-bound to the DNA-unbound form by inhibiting DNA binding of FlhD4C2, may have an additional role in the ClpXP-dependent pathway (i.e. increasing the amount of recognizable FlhD and FlhC in FlhD4C2, which leads to the enhanced proteolysis by ClpXP) (Fig. 8).

In E. coli, multiple anti-adaptors for RssB are expressed to control RpoS levels in multiple modes when cells adapt to the different stresses (e.g. anti-adaptors IraM and IraP are up-regulated for protecting RpoS from rapid degradation by RssB in response to magnesium and phosphate deprivation, respectively) (45). Such multiple adaptor-related factors present a rational strategy for the bacteria to respond to different stresses. In the case of the control of FlhD4C2, FliT and YdiV seem to have distinct roles and have different timings, considering that expression of YdiV only occurs when Salmonella encounter nutrient poor conditions (10). YdiV may have an important role in shutting off flagellar biogenesis inside macrophage and evading the host immune system (46). For such purposes, YdiV ought to completely inhibit FlhD4C2 activity; to accomplish a complete shut-off, YdiV acts even on the DNA-bound form of FlhD4C2 (i.e. on all states of FlhD4C2). In contrast, FliT expression is regulated by flagellar class II and III promoters (i.e. downstream of flhDC). Hence, accelerated FlhC degradation by FliT-ClpXP is assumed to be important in controlling the number of flagella by a negative feedback mechanism. Salmonella depleted of fliT have more flagella irrespective of the nutrient levels in the culture media (36). Aldridge et al. (36) showed that overexpression of FliT could not completely abolish the basal level of flagellar expression. Consistent with these results, our data show that the effect of FliT-ClpXP regulation is maximum on the free DNA-unbound FlhD4C2 (Fig. 7) (i.e. the DNA-bound state of FlhD4C2 becomes resistant to FliT and to ClpXP). This moderate negative regulation dependent on the DNA binding state of FlhD4C2 may contribute to the retention of a basal level of flagellar expression in order to construct a substantial number of flagella or work as a buffer to respond rapidly to external stimuli favoring the flagellated state, as in the model proposed by Aldridge et al. (36). The insensitivity of DNA-bound FlhD4C2 to FliT inhibition and the long half-life of DNA-bound FlhD4C2 indicate the importance of the stringent control of the cellular level of the free form of FlhD4C2 in the regulation of flagellar biogenesis. The fact that only a very small amount of FliT sufficiently enhanced ClpXP-dependent degradation of FlhC (Fig. 2, c and d) suggests the relative impact and efficacy of the ClpXP pathway compared with the stoichiometric action of FliT alone inhibiting DNA binding of FlhD4C2. From these results, the ClpXP pathway of the FliT-dependent anti-FlhD4C2 effect can be considered as having a substantial role in the negative feedback loop that controls flagellar biogenesis.

Acknowledgments

We thank Dr. K. Karata and K. Odakura for helpful discussion and technical assistance. Purified intact FliT proteins and plasmids expressing GST-FliT and intact FliT were the generous gift of Dr. K. Namba and Dr. T. Minamino. We thank Dr. W. A. Houry for kindly providing purified LambdaO protein and expression plasmids of ZBD and GFP-SsrA.

*

This work was supported, in whole or in part, by National Institutes of Health Public Health Service Grant GM056141 (to K. T. H.). This research was also supported in part by Grants-in-aid for Scientific Research 25253029 (to T. Y.) and 26860282 (to Y. S.) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.

3
The abbreviations used are:
TEV
tobacco etch virus
Ni-NTA
nickel-nitrilotriacetic acid
ATPγS
adenosine 5′-O-(thiotriphosphate)
BLI
biolayer interferometry
ZBD
zinc-binding domain
AMP-PNP
5′-adenylyl-β,γ-imidodiphosphate.

REFERENCES

  • 1. Gonzalez M., Rasulova F., Maurizi M. R., Woodgate R. (2000) Subunit-specific degradation of the UmuD/D′ heterodimer by the ClpXP protease: the role of trans recognition in UmuD′ stability. EMBO J. 19, 5251–5258 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. McGrath P. T., Iniesta A. A., Ryan K. R., Shapiro L., McAdams H. H. (2006) A dynamically localized protease complex and a polar specificity factor control a cell cycle master regulator. Cell 124, 535–547 [DOI] [PubMed] [Google Scholar]
  • 3. Baker T. A., Sauer R. T. (2006) ATP-dependent proteases of bacteria: recognition logic and operating principles. Trends Biochem. Sci. 31, 647–653 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Sauer R. T., Bolon D. N., Burton B. M., Burton R. E., Flynn J. M., Grant R. A., Hersch G. L., Joshi S. A., Kenniston J. A., Levchenko I., Neher S. B., Oakes E. S., Siddiqui S. M., Wah D. A., Baker T. A. (2004) Sculpting the proteome with AAA+ proteases and disassembly machines. Cell 119, 9–18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Flynn J. M., Neher S. B., Kim Y. I., Sauer R. T., Baker T. A. (2003) Proteomic discovery of cellular substrates of the ClpXP protease reveals five classes of ClpX-recognition signals. Mol. Cell 11, 671–683 [DOI] [PubMed] [Google Scholar]
  • 6. Zhou Y., Gottesman S., Hoskins J. R., Maurizi M. R., Wickner S. (2001) The RssB response regulator directly targets σ(S) for degradation by ClpXP. Genes Dev. 15, 627–637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Levchenko I., Seidel M., Sauer R. T., Baker T. A. (2000) A specificity-enhancing factor for the ClpXP degradation machine. Science 289, 2354–2356 [DOI] [PubMed] [Google Scholar]
  • 8. Camberg J. L., Wickner S. (2012) Regulated proteolysis as a force to control the cell cycle. Structure 20, 1128–1130 [DOI] [PubMed] [Google Scholar]
  • 9. Jonas K., Edwards A. N., Ahmad I., Romeo T., Römling U., Melefors O. (2010) Complex regulatory network encompassing the Csr, c-di-GMP and motility systems of Salmonella Typhimurium. Environ. Microbiol. 12, 524–540 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Wada T., Morizane T., Abo T., Tominaga A., Inoue-Tanaka K., Kutsukake K. (2011) EAL domain protein YdiV acts as an anti-FlhD4C2 factor responsible for nutritional control of the flagellar regulon in Salmonella enterica serovar Typhimurium. J. Bacteriol. 193, 1600–1611 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Wada T., Hatamoto Y., Kutsukake K. (2012) Functional and expressional analyses of the anti-FlhD4C2 factor gene ydiV in Escherichia coli. Microbiology 158, 1533–1542 [DOI] [PubMed] [Google Scholar]
  • 12. Takaya A., Erhardt M., Karata K., Winterberg K., Yamamoto T., Hughes K. T. (2012) YdiV: a dual function protein that targets FlhDC for ClpXP-dependent degradation by promoting release of DNA-bound FlhDC complex. Mol. Microbiol. 83, 1268–1284 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Zhou Y., Gottesman S. (1998) Regulation of proteolysis of the stationary-phase σ factor RpoS. J. Bacteriol. 180, 1154–1158 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Tomoyasu T., Takaya A., Isogai E., Yamamoto T. (2003) Turnover of FlhD and FlhC, master regulator proteins for Salmonella flagellum biogenesis, by the ATP-dependent ClpXP protease. Mol. Microbiol. 48, 443–452 [DOI] [PubMed] [Google Scholar]
  • 15. Kutsukake K., Ikebe T., Yamamoto S. (1999) Two novel regulatory genes, fliT and fliZ, in the flagellar regulon of Salmonella. Genes Genet. Syst. 74, 287–292 [DOI] [PubMed] [Google Scholar]
  • 16. Fraser G. M., Bennett J. C., Hughes C. (1999) Substrate-specific binding of hook-associated proteins by FlgN and FliT, putative chaperones for flagellum assembly. Mol. Microbiol. 32, 569–580 [DOI] [PubMed] [Google Scholar]
  • 17. Imada K., Minamino T., Kinoshita M., Furukawa Y., Namba K. (2010) Structural insight into the regulatory mechanisms of interactions of the flagellar type III chaperone FliT with its binding partners. Proc. Natl. Acad. Sci. U.S.A. 107, 8812–8817 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Minamino T., Kinoshita M., Imada K., Namba K. (2012) Interaction between FliI ATPase and a flagellar chaperone FliT during bacterial flagellar protein export. Mol. Microbiol. 83, 168–178 [DOI] [PubMed] [Google Scholar]
  • 19. Gamer J., Bujard H., Bukau B. (1992) Physical interaction between heat shock proteins DnaK, DnaJ, and GrpE and the bacterial heat shock transcription factor σ 32. Cell 69, 833–842 [DOI] [PubMed] [Google Scholar]
  • 20. Wojtyra U. A., Thibault G., Tuite A., Houry W. A. (2003) The N-terminal zinc binding domain of ClpX is a dimerization domain that modulates the chaperone function. J. Biol. Chem. 278, 48981–48990 [DOI] [PubMed] [Google Scholar]
  • 21. Groisman E. A. (1991) In vivo genetic engineering with bacteriophage Mu. Methods Enzymol. 204, 180–212 [DOI] [PubMed] [Google Scholar]
  • 22. Hughes K. T., Roth J. R. (1988) Transitory cis complementation: a method for providing transposition functions to defective transposons. Genetics 119, 9–12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Meynell E. W. (1961) A phage, φ χ, which attacks motile bacteria. J. Gen. Microbiol. 25, 253–290 [DOI] [PubMed] [Google Scholar]
  • 24. Yamaguchi S., Fujita H., Ishihara A., Aizawa S., Macnab R. M. (1986) Subdivision of flagellar genes of Salmonella typhimurium into regions responsible for assembly, rotation, and switching. J. Bacteriol. 166, 187–193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Lanzetta P. A., Alvarez L. J., Reinach P. S., Candia O. A. (1979) An improved assay for nanomole amounts of inorganic phosphate. Anal. Biochem. 100, 95–97 [DOI] [PubMed] [Google Scholar]
  • 26. Yamamoto S., Kutsukake K. (2006) FliT acts as an anti-FlhD2C2 factor in the transcriptional control of the flagellar regulon in Salmonella enterica serovar Typhimurium. J. Bacteriol. 188, 6703–6708 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Campos A., Zhang R. G., Alkire R. W., Matsumura P., Westbrook E. M. (2001) Crystal structure of the global regulator FlhD from Escherichia coli at 1.8 Å resolution. Mol. Microbiol. 39, 567–580 [DOI] [PubMed] [Google Scholar]
  • 28. Wang S., Fleming R. T., Westbrook E. M., Matsumura P., McKay D. B. (2006) Structure of the Escherichia coli FlhDC complex, a prokaryotic heteromeric regulator of transcription. J. Mol. Biol. 355, 798–808 [DOI] [PubMed] [Google Scholar]
  • 29. Baker T. A., Sauer R. T. (2012) ClpXP, an ATP-powered unfolding and protein-degradation machine. Biochim. Biophys. Acta 1823, 15–28 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Thibault G., Yudin J., Wong P., Tsitrin V., Sprangers R., Zhao R., Houry W. A. (2006) Specificity in substrate and cofactor recognition by the N-terminal domain of the chaperone ClpX. Proc. Natl. Acad. Sci. U.S.A. 103, 17724–17729 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Welty D. J., Jones J. M., Nakai H. (1997) Communication of ClpXP protease hypersensitivity to bacteriophage Mu repressor isoforms. J. Mol. Biol. 272, 31–41 [DOI] [PubMed] [Google Scholar]
  • 32. Turgay K., Hahn J., Burghoorn J., Dubnau D. (1998) Competence in Bacillus subtilis is controlled by regulated proteolysis of a transcription factor. EMBO J. 17, 6730–6738 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Schlothauer T., Mogk A., Dougan D. A., Bukau B., Turgay K. (2003) MecA, an adaptor protein necessary for ClpC chaperone activity. Proc. Natl. Acad. Sci. U.S.A. 100, 2306–2311 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Kirstein J., Hoffmann A., Lilie H., Schmidt R., Rübsamen-Waigmann H., Brötz-Oesterhelt H., Mogk A., Turgay K. (2009) The antibiotic ADEP reprogrammes ClpP, switching it from a regulated to an uncontrolled protease. EMBO Mol. Med. 1, 37–49 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Thibault G., Houry W. A. (2012) Role of the N-terminal domain of the chaperone ClpX in the recognition and degradation of lambda phage protein O. J. Phys. Chem. B 116, 6717–6724 [DOI] [PubMed] [Google Scholar]
  • 36. Aldridge C., Poonchareon K., Saini S., Ewen T., Soloyva A., Rao C. V., Imada K., Minamino T., Aldridge P. D. (2010) The interaction dynamics of a negative feedback loop regulates flagellar number in Salmonella enterica serovar Typhimurium. Mol. Microbiol. 78, 1416–1430 [DOI] [PubMed] [Google Scholar]
  • 37. Garg S. K., Kommineni S., Henslee L., Zhang Y., Zuber P. (2009) The YjbH protein of Bacillus subtilis enhances ClpXP-catalyzed proteolysis of Spx. J. Bacteriol. 191, 1268–1277 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Marshall-Batty K. R., Nakai H. (2003) Trans-targeting of the phage Mu repressor is promoted by conformational changes that expose its ClpX recognition determinant. J. Biol. Chem. 278, 1612–1617 [DOI] [PubMed] [Google Scholar]
  • 39. Camberg J. L., Hoskins J. R., Wickner S. (2009) ClpXP protease degrades the cytoskeletal protein, FtsZ, and modulates FtsZ polymer dynamics. Proc. Natl. Acad. Sci. U.S.A. 106, 10614–10619 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Sugimoto S., Yamanaka K., Nishikori S., Miyagi A., Ando T., Ogura T. (2010) AAA+ chaperone ClpX regulates dynamics of prokaryotic cytoskeletal protein FtsZ. J. Biol. Chem. 285, 6648–6657 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Abdelhakim A. H., Sauer R. T., Baker T. A. (2010) The AAA+ ClpX machine unfolds a keystone subunit to remodel the Mu transpososome. Proc. Natl. Acad. Sci. U.S.A. 107, 2437–2442 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Li B., Li N., Wang F., Guo L., Huang Y., Liu X., Wei T., Zhu D., Liu C., Pan H., Xu S., Wang H. W., Gu L. (2012) Structural insight of a concentration-dependent mechanism by which YdiV inhibits Escherichia coli flagellum biogenesis and motility. Nucleic Acids Res. 40, 11073–11085 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Claret L., Hughes C. (2000) Functions of the subunits in the FlhD2C2 transcriptional master regulator of bacterial flagellum biogenesis and swarming. J. Mol. Biol. 303, 467–478 [DOI] [PubMed] [Google Scholar]
  • 44. Claret L., Hughes C. (2002) Interaction of the atypical prokaryotic transcription activator FlhD2C2 with early promoters of the flagellar gene hierarchy. J. Mol. Biol. 321, 185–199 [DOI] [PubMed] [Google Scholar]
  • 45. Battesti A., Hoskins J. R., Tong S., Milanesio P., Mann J. M., Kravats A., Tsegaye Y. M., Bougdour A., Wickner S., Gottesman S. (2013) Anti-adaptors provide multiple modes for regulation of the RssB adaptor protein. Genes Dev. 27, 2722–2735 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Stewart M. K., Cummings L. A., Johnson M. L., Berezow A. B., Cookson B. T. (2011) Regulation of phenotypic heterogeneity permits Salmonella evasion of the host caspase-1 inflammatory response. Proc. Natl. Acad. Sci. U.S.A. 108, 20742–20747 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES