Skip to main content
Annals of Botany logoLink to Annals of Botany
. 2003 Jan;91(1):49–54. doi: 10.1093/aob/mcg007

ITS Sequence Analysis and Phylogenetic Inference in the Genus Lens Mill.

GABRIELLA SONNANTE 1,*, INCORONATA GALASSO 1, DOMENICO PIGNONE 1
PMCID: PMC4240352  PMID: 12495919

Abstract

The internal transcribed spacer (ITS) region of the nuclear ribosomal DNA from cultivated lentil (Lens culinaris subsp. culinaris) and its wild relatives was isolated and analysed for nucleotide sequence variation. Sequence divergence values ranged from no polymorphism within single species and between the cultigen and one accession of its wild progenitor (L. culinaris subsp. orientalis) to 14 base substitutions between L. nigricans and L. lamottei. Jukes and Cantor distance ranged from 0 to 1·79 %. Phylogenetic analysis confirmed the divergence of L. nigricans from all species, and the closeness of cultivated lentil to its wild progenitor, although two gene pools could possibly be identified in subsp. orientalis. Based on this study, the two recently recognized species, L. lamottei and L. tomentosus were separated from the other species. Each wild species showed peculiar autapomorphies and, in general, did not display much variation among accessions. The trees using chickpea as an outgroup formed two main clusters, one constituted by L. nigricans only and the other including the remaining taxa. Within this larger group, small subclades could be identified.

Key words: Lens culinaris, Medik. subsp. culinaris, lentil, wild species, ITS sequence, polymorphism, parsimony, phylogenetic relationships

INTRODUCTION

The genus Lens Mill. includes seven taxa, the cultivated species Lens culinaris Medik. subsp. culinaris and its wild relatives (van Oss et al., 1997). The six wild lentil taxa are mostly distributed in the Mediterranean region and the wild progenitor [Lens culinaris Medik. subsp. orientalis (Boiss.) Ponert] of cultivated lentil reaches Central Asia. The cultigen is mostly cultivated in the Old World, principally round the Mediterranean and in Asia, but has spread all over the world, reaching the Americas and Australia (Ladizinsky et al., 1984).

Over the past years, several studies have assessed genetic diversity and phylogenetic relationships in the genus Lens using morphological characters (Ahmad et al., 1997) and a variety of different markers. For instance, the cpDNA sequence analysis (Mayer and Soltis, 1994) confirmed the phylogenetic closeness of subsp. orientalis to the cultigen, whereas L. nigricans (M. Bieb.) Godr. and L. ervoides (Brign.) Grande formed the ‘nigricans’ clade. In any case, L. nigricans was distinct from the other species, and a higher divergence was observed of both L. ervoides and L. odemensis Ladiz. from L. nigricans than from subsp. orientalis and cultivated lentil. In a more recent study on cpDNA restriction site diversity (van Oss et al., 1997), clustering resulted in three groups: (1) L. culinaris, L. tomentosus Ladiz. and L. odemensis, with relatively small differences among them; (2) L. ervoides and L. lamottei Czefr.; and (3) L. nigricans, which was distantly related to all the other species. Divergence of L. nigricans had been suggested previously on the basis of cytology and crossability (Ladizinsky et al., 1984), allozyme (Pinkas et al., 1989; Hoffman et al., 1986), nuclear DNA RFLP (Havey and Muehlbauer, 1989) and cpDNA RFLP analyses (Muench et al., 1991).

Using AFLP (Sharma et al., 1996), the greatest genetic similarity was shown between subsp. orientalis and subsp. culinaris. Amongst the wild taxa, the highest genetic identity was observed between L. nigricans and L. ervoides. With some primer combinations L. odemensis was intermediate to L. culinaris on the one hand and L. nigricans and L. ervoides on the other; with other primer combinations, L. odemensis was the species furthest from the remaining taxa.

Despite the studies mentioned above and a recent re‐evaluation of the genus (Ferguson et al., 2000), relationships within this complex taxon have still not been clarified. Studies using innovative approaches are therefore needed to increase our knowledge and permit a better evaluation of the genus.

In plants, the 18S‐5·8S‐25S rDNA locus has frequently been used for molecular systematic studies. A number of authors have demonstrated the usefulness of the internal transcribed spacers of this gene to assess phylogenetic relationships between cultivated species and their wild relatives (Baldwin, 1992). The rDNA is present in high copy numbers, with a high degree of homogeneity: whereas mature rRNA‐coding regions of the gene are quite conserved through evolution, the two internal transcribed spacers (ITS1 and ITS2) evolve more rapidly making them suitable for comparison of closely related taxa. ITS regions evolve cohesively within a single species and exhibit only limited sequence divergence between copies within single individuals (Arnheim et al., 1980); conversely, comparisons between species show good levels of sequence divergence. In some species, variation of the ITS sequence has proven useful for studies at the population and species level due to its high degree of sequence variation (Yuan and Küpfer, 1995; Desfeux and Lejeune, 1996; Kollipara et al., 1997; Aïnouche and Bayer, 1999).

To gain a better understanding of the phylogenetic relationships within the genus Lens, an analysis of the rDNA internal spacers was carried out on cultivated lentil, on one macrosperma and one microsperma morphotype (Barulina, 1930), on its wild progenitor, and on the wild relatives: L. odemensis, L. ervoides, L. nigricans, L. lamottei and L. tomentosus. Chickpea (Cicer arietinum L.) was included in the analysis as an outgroup. The ITS region of rDNA of the taxa mentioned above was isolated, cloned and sequenced.

MATERIALS AND METHODS

Genomic DNA was extracted from young leaves of the taxa listed in Table 1 following Paz and Veilleux (1997) and the region including the two spacers (ITS1 and ITS2) and 5·8S rDNA was amplified. A total volume of 50 µl for each reaction contained: 50 ng DNA, 50 mm KCl, 10 mm Tris–HCl pH 9·0, 1·5 mm MgCl2, 0·1 mm of each nucleotide (dATP, dCTP, dGTP, dTTP), 2·5 units of Taq DNA polymerase and 0·2 µm primer. The primers used, 18S dir (5′‐CGTAACAAGGTTTCCGTAGG‐3′) and 25S com (5′‐AGCGGGTAGTCCCGCCTGA‐3′) are complementary to the final part of 18S rDNA adjacent to ITS1 and to the initial part of 25S rDNA adjacent to ITS2, respectively (Venora et al., 2000). The amplification programme included a cycle at 94 °C for 3 min, 40 cycles of 94 °C for 30 s, 50 °C for 1 min and 72 °C for 45 s, and a final elongation at 72 °C for 5 min. The PCR product was run on an agarose gel. All taxa showed a single band of about 650 bp, except for chickpea which displayed a slightly longer fragment. The ITS region was then purified using ‘Quiaquick PCR purification kit’ (Quiagen, New York, NY, USA), and cloned in ‘pGem®‐T Easy Vector Systems’ (Promega, Madison, WI, USA). For each accession, two clones or more were selected and sequenced in both directions with an automated sequencer. Sequences were deposited in the EMBL database (accession numbers AJ404739–AJ404743, AJ441059–AJ441070 and AJ441321) and used as queries for similarity searches in the EMBL nucleotide database. Sequences were aligned using the program CLUSTAL X 1.8. For the phylogenetic reconstruction, the aligned sequence data matrix was analysed by means of the PHYLIP package (Felsenstein, 1989), in particular the programs DNADIST, using the Jukes and Cantor (1969) option, BOOTSEQ and DNAPARS, with and without randomization of sequence order. All character states, including indels, were given the same weight in the analysis. The CONSENSE program was used to build up the consensus tree of the most parsimonious trees obtained from DNAPARS. In addition, a dendrogram based on the maximum likelihood was obtained using the program DNAML. Trees were drawn using TreeView 1.6.6 software (Page, 1996).

Table 1.

Summary of all 19 accessions used in this study, with place of origin

Species/Accession number Donor Origin Code
L. culinaris subsp. culinaris macrosperma IG Italy—Altamura culinaris
L. culinaris subsp. culinaris microsperma IG Italy—Ustica culinaris
L. culinaris subsp. orientalis PI572366 USDA Turkey or1
L. culinaris subsp. orientalis PI572391 USDA Cyprus or2
L. culinaris subsp. orientalis W17080 USDA Syria or3
L. tomentosus ILWL93 ICARDA Turkey to1
L. tomentosus ILWL282 ICARDA Turkey to2
L. odemensis PI572360 USDA Israel od1
L. odemensis PI572361 USDA Israel od2
L. odemensis PI572364 USDA Turkey od3
L. lamottei ILWL14 ICARDA France la1
L. lamottei ILWL29 ICARDA Spain la2
L. lamottei ILWL434 ICARDA Turkey la3
L. ervoides PI572311 USDA Turkey er1
L. ervoides PI572317 USDA Italy er2
L. ervoides PI572329 USDA Israel er3
L. nigricans PI572340 USDA Italy ni1
L. nigricans PI572344 USDA Spain ni2
L. nigricans PI572358 USDA Ukraina ni3
Cicer arietinum var. Calia IG Italy cicer

Accession number is according to the donor (IG, Italy, USDA USA, or ICARDA Syria).

RESULTS

The length of the ITS regions in Lens species was similar to that observed in other legumes: ITS1 was 235 bp in all Lens species except L. nigricans (237 bp), whereas ITS2 was 212 bp, except in L. ervoides (211 bp). The A/T content was 48 % in all species, except L. nigricans which showed a slightly higher A/T content (almost 49 %). Repeated or microsatellite motifs were not found in the ITS1 or ITS2 sequences. A FASTA search of all ITS clones against the EMBL Nucleotide Sequence Database showed a high similarity with Vicia faba (94 %) and Pisum sativum (93 %), whereas chickpea ITS displayed a lower similarity (89 %). The aligned DNA sequences of the ITS region of all 19 taxa used in this study are given in Table 1.

A high homology of ITS1 and ITS2 sequences was observed among the Lens taxa analysed, and overall 21 variable characters were observed within the ingroup. The highest divergence between the cultigen and a wild species was observed for L. nigricans, with ten substitutions and two insertions, of which seven were autapomorphies, four symplesiomorphies shared with the outgroup and one a synapomorphy with the remaining wild Lens species. Lens nigricans was also the most divergent species within the ingroup and showed distance values ranging from 1·34 to 1·79 % (Table 2). Distance analysis indicated that L. lamottei was the next most divergent species within the ingroup (values from 0·44 to 0·74 %, excluding L. nigricans), as a consequence of two autapomorphies and one symplesiomorphy with the outgroup not shared with the remaining Lens species. No intraspecific variation was disclosed, since the three accessions analysed for this species showed the same nucleotide sequence. All the remaining species showed distance values always lower than 0·44; in particular, L. ervoides showed an autapomorphic deletion in all accessions and a single autapomorphy in one accession only (er2); with regards to L. odemensis, accessions od1 and od2 shared an autopomorphy not present in the remaining conspecific accession nor in the other species; the accession od3, conversely, showed an autapomorphy unique to this accession; L. tomentosus showed a single symplesiomorphy with the outgroup which was not present in the remaining ingroup taxa.

Table 2.

Percentage distance matrix from ITS nucleotide sequences based on Jukes and Cantor’s (1969) model

ni1 –
ni2 0·00 –
ni3 0·00 0·00 –
to2 1·49 1·49 1·49 –
to1 1·49 1·49 1·49 0·00 –
culinaris 1·49 1·49 1·49 0·30 0·30 –
or2 1·64 1·64 1·64 0·44 0·44 0·15 –
or3 1·49 1·49 1·49 0·30 0·30 0·00 0·15 –
er3 1·34 1·34 1·34 0·15 0·15 0·15 0·30 0·15 –
er2 1·49 1·49 1·49 0·30 0·30 0·30 0·44 0·30 0·15 –
er1 1·34 1·34 1·34 0·15 0·15 0·15 0·30 0·15 0·00 0·15 –
od3 1·49 1·49 1·49 0·30 0·30 0·30 0·44 0·30 0·15 0·30 0·15 –
or1 1·34 1·34 1·34 0·15 0·15 0·15 0·30 0·15 0·00 0·15 0·00 0·15 –
la1 1·79 1·79 1·79 0·59 0·59 0·59 0·74 0·59 0·44 0·59 0·44 0·59 0·44 –
la2 1·79 1·79 1·79 0·59 0·59 0·59 0·74 0·59 0·44 0·59 0·44 0·59 0·44 0·00 –
la3 1·79 1·79 1·79 0·59 0·59 0·59 0·74 0·59 0·44 0·59 0·44 0·59 0·44 0·00 0·00 –
od1 1·49 1·49 1·49 0·30 0·30 0·30 0·44 0·30 0·15 0·30 0·15 0·30 0·15 0·59 0·59 059 –
od2 1·49 1·49 1·49 0·30 0·30 0·30 0·44 0·30 0·15 0·30 0·15 0·30 0·15 0·59 0·59 0·59 0·00 –
cicer 10·71 10·71 10·71 10·34 10·34 10·71 10·90 10·71 10·54 10·73 10·54 10·71 10·53 10·71 10·71 10·71 10·71 10·71 –
ni1 ni2 ni3 to2 to1 culin. or2 or3 er3 er2 er1 od3 or1 la1 la2 la3 od1 od2 cicer

The two lentil morphotypes, macrosperma and microsperma, showed no difference in ITS sequence. Three accessions of L. culinaris subsp. orientalis from different geographical regions were analysed (see Table 1); one of these, namely or3 from Syria, showed the same ITS1 and ITS2 sequence as that of cultivated lentil, while or2 from Cyprus showed an autapomorphy in ITS1 whilst remaining unchanged in the rest of the sequence; these two subsp. orientalis accessions and the cultivated ones displayed an autapomorphy in the ITS2 sequence; in this position, the third subsp. orientalis accession from Turkey (or1) shared a synapomorphy with the other Lens taxa.

The consensus of the 16 most parsimonious trees (Fig. 1) obtained by parsimony analysis with sequences added in the input order, using Cicer arietinum as an outgroup, shows two robust branches: one at a basal position identifies with a high bootstrap the three L. nigricans accessions, and the other includes all the remaining accessions and taxa. This latter clade is further subdivided in two sister subclades. The more basal includes cultivated lentil and two accessions of subsp. orientalis (from Cyprus and from Syria), with a bootstrap of 87, whereas the second subclade includes the remaining taxa, namely L. ervoides, L. odemensis, L. tomentosus, L. lamottei and the third accession of subsp. orientalis from Turkey. In this subclade, L. lamottei and L. ervoides appear to aggregate in separate groups, and the L. odemensis accession from Turkey (od3) is separated from the other conspecific accessions.

graphic file with name mcg007f1.jpg

Fig. 1. The consensus of the 16 most parsimonious phylogenetic trees obtained using DNAPARS program. Name codes are as in Table 1. Numbers above nodes are bootstrap values; values below 60 are not reported.

The consensus maximum likelihood tree (Fig. 2) shows that, apart from the outgroup chickpea, and from L. nigricans, the other Lens species are very close to one another, even though some clustering of species can be observed. Also this tree shows that accessions of subsp. orientalis are not grouped in the same clade, nor are accessions of L. odemensis.

graphic file with name mcg007f2.jpg

Fig. 2. The consensus tree obtained from the maximum likelihood analysis using DNAML program. Name codes are as in Table 1. Numbers above nodes are bootstrap values; values below 60 are not reported.

DISCUSSION

In eukaryotes, the rDNA is a multigene family with nuclear copies arranged in tandem arrays, organized in nucleolus organizer regions (NORs), potentially at more than one chromosomal location. The gene is discontinuous and contains two internal transcribed spacers, ITS1 and ITS2. The rapid concerted evolution and homogenization of this gene family, occurring through unequal crossing‐over and biased gene conversion (Hillis et al., 1991), makes it useful for phylogenetic reconstruction (Arnheim, 1983).

PCR amplification of the ITS regions, followed by sequencing, has been used to study phylogenetic relationships among many plant genera, including important crops such as cotton (Wendel et al., 1995), maize (Buckler and Holtsford, 1996), sorghum (Sun et al., 1995) and wheat (Hsiao et al., 1995).

In the genus Lens, little variation in ITS sequence was observed. Nevertheless, it is sufficient to draw some conclusions. The first evidence points to the fact that the genus is polyphyletic, with two main clades being identified: the first includes L. nigricans; and the second all the remaining species. All the accessions of L. nigricans show autapomorphic insertions and substitutions that are not found in members of the sister group constituted by the remaining Lens species. Therefore, this species occupies a basal position in the trees shown. These findings confirm that L. nigricans represents a taxon distantly related to all the other species of Lens. The great divergence of L. nigricans is also suggested by cytology and crossability (Ladizinsky et al., 1984), allozyme (Pinkas et al., 1989; Hoffman et al., 1986), nuclear DNA RFLP (Havey and Muehlbauer, 1989) and cpDNA RFLP analyses (Muench et al., 1991), and cpDNA variation (van Oss et al., 1997).

According to the ITS sequence variation, the two recently recognized species L. lamottei and L. tomentosus can be considered as independent entities, since they show specific autapomorphies. Lens lamottei was first described in Russia by Czefranova (1971), and later recognized as being the same taxon as the differentiated cytotype of L. nigricans (Ladizinsky et al., 1984). Even though these two species are morphologically similar and cross‐compatible, their hybrids are sterile (Ladizinsky et al., 1984) and they also show other genetic differences (Hoffman et al., 1986; van Oss et al., 1997). In our study, L. lamottei and L. nigricans do not share any synapomorphy and show a distance of 1·79 % from each other; these two species are not grouped together by parsimony or maximum likelihood analyses, or by cpDNA variation analysis (van Oss et al., 1997). Even though accessions of L. lamottei belong to a major group together with other species, they share two autopomorphies and one symplesiomorphy and, for this reason, they give rise to a clear sub‐branch.

Lens tomentosus was separated from L. culinaris subsp. orientalis by Ladizinsky (1997). These two taxa are morphologically similar, except for the hairy pod of the former, but they are very different karyotypically and genetically. As for cpDNA mutations, L. tomentosus is closer to L. odemensis than to any other Lens species (van Oss et al., 1997). In our ITS analyses, L. tomentosus is clearly separated from L. culinaris subsp. orientalis and is grouped in a complex cluster to which many species pertain, including L. odemensis.

The present analysis showed L. ervoides to be rather similar to the other Lens species; Jukes and Cantor distance was rather low with most other species, except L. nigricans and, to a lesser extent, L. lamottei. These findings contrast with previous reports on similarity to L. lamottei based on cpDNA (van Oss et al., 1997), or cross‐compatibility with L. nigricans (Ladizinsky, 1993), or even similarity to this latter species based on AFLP analysis (Sharma et al., 1996). This species is an example of the difficulty of describing phyletic relationships based on a limited number of characters, stressing the necessity of multidisciplinary approaches.

In the case of L. orientalis subsp. orientalis, we found two accessions, from Cyprus and from Syria (or2 and or3), whose sequence was similar to that of cultivated lentil, whereas the other accession from Turkey showed a synapomorphy with the other wild taxa in the ITS2 that was not shared by the cultigen, or2 or or3. For this reason the Turkish accession was separated from the rest of the cultigroup in the trees. A wide variation in many characters has been observed in the wild progenitor of cultivated lentil, and characters that are polymorphic in the wild progenitor but monomorphic in the cultigen can be utilized to identify the genetic stock from which the cultigen has originated (Ladizinsky, 1999). After analysing a number of subsp. orientalis accessions, Ladizinsky concluded that Israel, South Lebanon and Central Asia could be excluded as areas of lentil domestication, whereas Turkey and northern Syria could represent places where lentil was domesticated since three accessions from these regions were identical to the cultigen for the diagnostic characters. In our study a further analysis of ITS2 from five more accessions of the cultigen from different geographical origins showed that this was monomorphic for the described autapomorphy, whereas six more subsp. orientalis accessions from Turkey revealed polymorphism at the same site (data not shown). Therefore, it seems that two gene pools can be identified in subsp. orientalis based on this particular nucleotide of ITS2 sequence. This character, which is also present in the other wild species, might be the result of introgression from allied species, and rapid concerted evolution might be the reason for fixation of this variant sequence in the gene pool of subsp. orientalis (Wendel et al., 1995). On the other hand, this nucleotide represents an autapomorphy for the cultigen and other two accessions of subsp. orientalis. It could therefore have occasionally arisen in the subsp. orientalis gene pool; in this case, cultivated lentil originated from a lineage possessing this autapomorphy. It is not possible to reach a definite conclusion on the basis of a single nucleotide. Nevertheless, it is feasible to make this observation the starting point of an in‐depth study with the aim of gaining a better understanding of the genetic structure of the subsp. orientalis gene pool and its relationship to cultivated lentil. Such information is of great importance for the exploitation of the genetic resources of wild taxa.

The uniformity of the ITS sequence in cultivated lentil is in agreement with previous observations that there is little genetic variation in this crop, and further supports the idea that the morphotypes ‘microsperma’ and ‘macrosperma’ are simple variants for quantitative traits resulting from disruptive selection (Sonnante and Pignone, 2001).

Owing to the limited number of informative characters, ITS sequences alone cannot resolve all the controversies concerning relationships between the species of Lens, excluding the evidence for the divergence of L. nigricans. Molecular data from the literature reach, in some cases, contrasting conclusions and therefore, relationships within this genus require further investigation. It is likely that the relationships will only be resolved by adopting an integrated approach and collecting data on different biological characters.

NOTE

After this article was submitted, a paper by Mayer and Bagga (2002) was published on a similar topic. During the revision of this article, the authors decided not to refer to the work by Mayer and Bagga in order to maintain an independent view, since all the work in this paper was carried out, and conclusions drawn, without any knowledge of Mayer and Bagga’s work.

ACKNOWLEDGEMENTS

We thank USDA and ICARDA genebanks for donating seeds; Mr F. P. Losavio for growing plants and extracting DNA; and Dr Cecilia Lanave for useful criticism. This research was partially funded by the project MURST ‘ingegneria molecolare’, Progetto n. 2, ‘Studio di geni di interesse biomedico e agroalimentare’.

Supplementary Material

Content Snapshot

Received: 21 March 2002; Returned for revision: 11 August 2002; Accepted: 2 October 2002    Published electronically: 13 November 2002

References

  1. AhmadMet al.1997. Phylogenetic relationships in Lens species and their interspecific hybrids as measured by morphological characters. Euphytica 94: 101–111. [Google Scholar]
  2. AïnoucheAK, Bayer R.1999. Phylogenetic relationships in Lupinus (Fabaceae: Papilionideae) based on internal transcribed spacer sequences (ITS) of nuclear ribosomal DNA. American Journal of Botany 86: 590–607. [PubMed] [Google Scholar]
  3. ArnheimN.1983. Concerted evolution of multigene families. In: Nei M, Koehn eds. Evolution of genes and proteins Sunderland, Mass: Sinauer Associates Inc., 38–61. [Google Scholar]
  4. ArnheimN, Krystal M, Schmickel R, Wilson G, Ryder O, Zimmer E.1980. Molecular evidence for genetic exchanges among ribosomal genes on non‐homologous chromosomes in man and apes. Proceedings of the National Academy of Sciences of the USA 77: 7323–7327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. BaldwinBG.1992. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: an example from the Compositae. Molecular Phylogenetics and Evolution 1: 3–16. [DOI] [PubMed] [Google Scholar]
  6. BarulinaHI.1930. Lentils of the USSR and other countries. Bulletin of Applied Botanical Plant Breeding (Leningrad) 40 (Suppl.): 1–319. [Google Scholar]
  7. BucklerES, Holtsford TP.1996. Zea ribosomal repeat evolution and substitution patterns. Molecular Biology and Evolution 13: 623–632. [DOI] [PubMed] [Google Scholar]
  8. CzefranovaZ.1971. Review of species in the genus Lens Mill. Vov Sistemat Vysshikh Rastenii 8: 184–191 (in Russian). [Google Scholar]
  9. DesfeuxC, Lejeune B.1996. Systematics of Euromediterranean Silene (Caryophyllaceae): evidence from a phylogenetic analysis using ITS sequences. Comptes Rendus de l’Academie des Sciences, Paris, Sciences de le Vie/Life Sciences 319: 351–358. [PubMed] [Google Scholar]
  10. FelsensteinJ.1989. Phylogeny inference package (version 3.2). Cladistics 5: 164–166. [Google Scholar]
  11. FergusonME, MaxtedN, Slageren M van, Robertson LD.2000. A re‐assessment of the taxonomy of Lens Mill. (Leguminosae, Papilionoideae, Vicieae). Botanical Journal of the Linnean Society 133: 41–59. [Google Scholar]
  12. HaveyMJ, Muehlbauer FJ.1989. Variability for restriction fragment lengths and phylogenies in lentil. Theoretical and Applied Genetics 77: 839–843. [DOI] [PubMed] [Google Scholar]
  13. HillisDM, Moritz C, Porter CA, Baker RJ.1991. Evidence for biased gene conversion in concerted evolution of ribosomal DNA. Science 251: 308–310. [DOI] [PubMed] [Google Scholar]
  14. HoffmanDL, Soltis DE, Muehlbauer FJ, Ladizinsky G.1986. Isozyme polymorphism in Lens (Leguminosae). Systematic Botany 11: 392–402. [Google Scholar]
  15. HsiaoC, Chatterton NJ, Asay KH, Jensen KB.1995. Phylogenetic relationship of the monogenomic species of the wheat tribe, Triticeae (Poaceae), inferred from nuclear rDNA (internal transcribed spacer) sequences. Genome 38: 211–222. [DOI] [PubMed] [Google Scholar]
  16. HymowitzT.1990. Grain legumes. In: Janick J, Simon JE, eds. Advances in new crops Portland, OR: Timber Press, 54–57. [Google Scholar]
  17. JukesTH, Cantor CR.1969. Evolution of protein molecules. In: Munro HN, ed. Mammalian protein metabolism London: Academic Press, 21–132. [Google Scholar]
  18. KolliparaKP, Singh RJ, Hymowitz T.1997. Phylogenetic and genomic relationships in the genus Glycine Willd. Based on sequences from the ITS region of nuclear rDNA. Genome 40: 57–68. [DOI] [PubMed] [Google Scholar]
  19. LadizinskyG.1993. Wild lentils. Critical Reviews in Plant Sciences 12: 169–184. [Google Scholar]
  20. LadizinskyG.1997. A new species of Lens from south‐east Turkey. Botanical Journal of the Linnean Society 123: 257–260. [Google Scholar]
  21. LadizinskyG.1999. Identification of lentil’s wild genetic stock. Genetic Resources and Crop Evolution 46: 115–118. [Google Scholar]
  22. LadizinskyG, Braun D, Goshen D, Muehlbauer FJ.1984. The biological species of the genus Lens L. Botanical Gazette 154: 253–261. [Google Scholar]
  23. MayerMS, Bagga SK.2002. The phylogeny of Lens (Leguminosae): new insight from ITS sequence analysis. Plant Systematics and Evolution 232: 145–154. [Google Scholar]
  24. MayerMS, Soltis PS.1994. Chloroplast DNA phylogeny of Lens (Leguminosae): origin and diversity of the cultivated lentil. Theoretical and Applied Genetics 87: 773–781. [DOI] [PubMed] [Google Scholar]
  25. MuenchDG, Slinkard AE, Scoles GJ.1991. Determination of genetic variation and taxonomy in lentil (Lens Miller) species by chloroplast DNA polymorphism. Euphytica 56: 213–218. [Google Scholar]
  26. PageRDM.1996. TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12: 357–358. [DOI] [PubMed] [Google Scholar]
  27. PazMM, Veilleux RE.1997. Genetic diversity based on randomly amplified polymorphic DNA (RAPD) and its relationship with the performance of diploid potato hybrids. Journal of the American Society for Horticultural Science 122: 740–747. [Google Scholar]
  28. PinkasR, Zamir D, Ladizinsky G.1985. Allozyme divergence and evolution in the genus Lens Plant Systematic and Evolution 151: 131–140. [Google Scholar]
  29. SharmaSK, Knox MR, Ellis THN.1996. AFLP analysis of the diversity and phylogeny of Lens and its comparison with RAPD analysis. Theoretical and Applied Genetics 93: 751–758. [DOI] [PubMed] [Google Scholar]
  30. SonnanteG, Pignone D.2001. Assessment of genetic variation in a collection of lentil using molecular tools. Euphytica 120: 301–307. [Google Scholar]
  31. SunY, Skinner DZ, Liang GH, Hulbert SH.1995. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89: 26–32. [DOI] [PubMed] [Google Scholar]
  32. van OssH, Aron Y, Ladizinsky G.1997. Chloroplast DNA variation and evolution in the genus Lens Mill. Theoretical and Applied Genetics 94: 452–457. [Google Scholar]
  33. VenoraG, Blangiforti S, Frediani M, Maggini F, Gelati MT, Ruffini Castiglione M, Cremonini R.2000. Nuclear DNA contents, rDNAs, chromatin organization, and karyotype evolution in Vicia sect. faba Protoplasma 213: 118–125. [Google Scholar]
  34. WendelJF, Schnabel A, Seelanan T.1995. An unusual ribosomal DNA sequence from Gossypium gossypioides reveals ancient, cryptic, intergenomic introgression. Molecular Phylogenetics and Evolution 4: 298–313. [DOI] [PubMed] [Google Scholar]
  35. YuanYM, Küpfer P.1995. Molecular phylogenetics of the subtribe Gentianinae (Gentianaceae) inferred from the sequences of the internal transcribed spacers (ITS) of nuclear ribosomal DNA. Plant Systematics and Evolution 196: 207–226. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Content Snapshot

Articles from Annals of Botany are provided here courtesy of Oxford University Press

RESOURCES