Abstract
Xylella fastidiosa is a gram-negative, xylem-limited plant pathogenic bacterium that causes disease in a variety of economically important agricultural crops including Pierce's disease of grapevines. Xylella fastidiosa biofilms formed in the xylem vessels of plants play a key role in early colonization and pathogenicity by providing a protected niche and enhanced cell survival. Here we investigate the role of Xylella fastidiosa PD1063, the predicted ortholog of Xanthomonas oryzae pv. oryzae PXO_03968, which encodes an outer membrane protein. To assess the function of the Xylella fastidiosa ortholog, we created Xylella fastidiosa mutants deleted for PD1063 and then assessed biofilm formation, cell-cell aggregation and cell growth in vitro. We also assessed disease severity and pathogen titers in grapevines mechanically inoculated with the Xylella fastidiosa PD1063 mutant. We found a significant decrease in cell-cell aggregation among PD1063 mutants but no differences in cell growth, biofilm formation, disease severity or titers in planta. Based on the demonstration that Xanthomonas oryzae pv. oryzae PXO_03968 encodes an outer membrane protein, secreted in association with outer membrane vesicles, we predicted that PD1063 would also be secreted in a similar manner. Using anti-PD1063 antibodies, we found PD1063 in the supernatant and secreted in association with outer membrane vesicles. PD1063 purified from the supernatant, outer membrane fractions and outer membrane vesicles was 19.2 kD, corresponding to the predicted size of the processed protein. Our findings suggest Xylella fastidiosa PD1063 is not essential for development of Pierce's disease in Vitis vinifera grapevines although further research is required to determine the function of the PD1063 outer membrane protein in Xylella fastidiosa.
Introduction
Xylella fastidiosa (Xf) is a gram-negative, xylem-limited plant pathogenic bacterium and the causal agent of a variety of economically important diseases including Pierce's disease (PD) of grapevines, almond leaf scorch and citrus variegated chlorosis [1]–[4]. In nature, Xf is transmitted by xylem-feeding insects such as sharpshooters in the leafhopper family Cicadellidae. PD strains exhibit a wide host range although Xf does not cause disease on all hosts [4], [5]. Once transmitted to the host plant, Xf forms biofilms within the xylem vessels, allowing the pathogen to form a protected niche in which the bacteria can multiply. Bacteria within these protected niches may form large aggregates that effectively plug the xylem element, impede or block transpiration and induce scorching symptoms, similar to what occurs when plants are under water stress. Some plant hosts, such as Vitis vinifera grapevines, often die from Xf infection [2].
Biofilm formation is a result of density-dependent gene expression, triggered by the process of quorum sensing [6]. Through quorum sensing, bacteria are able to communicate with each other via small signal compounds, which allow the bacteria to recognize population size and mediate the expression of specific genes when bacterial populations reach a threshold concentration [7], [8]. Xanthomonas oryzae pv. oryzae (Xoo), a close phylogenetic relative of Xf, is a gram-negative plant pathogenic bacterium and the causal agent of bacterial blight of rice [9]. Although not strictly xylem-limited, Xoo colonizes and moves systemically in xylem, similar to Xf, and contains many of the same functional genes [10], [11]. Both Xoo and Xf possess a similar diffusible signal factor (DSF) quorum sensing system. In Xf, mutants deficient in DSF exhibit hypervirulence in inoculated grapevines while Xoo mutants deficient in DSF exhibit reduced virulence in rice [12], [13]. In both cases, DSF has been shown to play a role in regulation of a variety of virulence factors such as biofilm formation and cell-cell aggregation [14].
Several reports (one of which was retracted) indicate that the Xoo PXO_03968 –encoded protein and predicted orthologs play a role in quorum sensing, biofilm formation and virulence, [15]–[17]. For example, Qian et al. identified a PXO_03968 ortholog in a proteomic study of the Xanthomonas oryzae pv. oryzicola (Xoc) RS105 secretome. They showed that deletion of the Xoc ortholog resulted in reduced biofilm formation and extracellular-polysaccharide production [18]. They also reported that the Xoc protein is necessary for full virulence on susceptible hosts. In Stenotrophomonas maltophilia, McCarthy et al. showed that the PXO_03968 ortholog (called smlt0387) acts as a cell-cell signal to regulate a diverse range of functions, including motility, biofilm formation and virulence [17].
The purpose of this study was to determine the functional role of the Xf ortholog of PXO_03968, called PD1063. In this study we show that PD1063 is found embedded in the outer membrane and secreted via membrane vesicles. This is supported by recent reports in which the PD1063 homolog, known as Xoo PXO_03968 was also found embedded in the outer membrane and secreted via membrane vesicles [19]. Our studies indicate that PD1063 plays a role in cell-cell aggregation in vitro but does not support a role for PD1063 in regulation of biofilm formation or as pathogenicity factor.
Materials and Methods
Bacterial strains and growth conditions
Xf Fetzer wild-type strain [20] and the mutant strain XfΔ1063 (Table 1) were grown on solid PD3 medium [21] without and with kanamycin (5 ug ml−1), respectively, for 10 days at 28°C.
Table 1. Strains, plasmids and primers.
| Strain, Plasmid or Primer | Characteristics and Sequences | Source |
| Strains | ||
| E. Coli Top10 | F– mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara leu) 7697 galU galKrpsL (StrR) endA1 nupG | Invitrogen |
| Xylella fastidiosa Fetzer | Wild-type | [20] |
| Xylella fastidiosaΔ1063 | Xylella fastidiosa Fetzer PD1063::EZ::TN5<Kan-2>Tnp | This study |
| Plasmids | ||
| pCR2.1-TOPO | KanR AmpR, lacZ, T7 | Invitrogen |
| pUC18 | bla (ApR), lacZ, rep(pMB1) | Thermo Scientific |
| pCR2.1-PD1063 | pCR2.1-TOPO vector with gene PD1063 | This Study |
| pUC18-PD1063 | pUC18 vector with gene PD1063 | This Study |
| Primers | ||
| PD1063for | TCAGCGCTCTAAAACAATGGCGA | This study |
| PD1063rev | CACAGCCCGCCTATGGCACA | This study |
| PD1063chkfor | CAGTTGCAAAACTCCAAGCACAACA | This study |
| PD1063chkrev | GCGGCGGATCATGAACCTA | This study |
| Kan2FP-1 | ACCTACAACAAAGCTCTCATCAACC | Epicentre |
| Kan2RP-1 | GCAATGTAACATCAGAGATTTTGAG | Epicentre |
Cloning procedures and generation of PD1063-kan
PD1063 was PCR amplified from the Xf wild type Fetzer genome using primer pairs PD1063for (5′-TCAGCGCTCTAAAACAATGGCGA-3′) and PD1063rev (5′-CACAGCCCGCCTATGGCACA) and the 1015 bp product was cloned into pCR2.1-TOPO vector to generate pCR2.1-PD1063 (Table 1). The plasmid was digested with SacI and XbaI and the resulting fragment was cloned into SacI/XbaI digested pUC18 vector to generate pUC18-PD1063. A kanamycin resistance gene was randomly inserted into pUC18-PD1063 using the EZ-Tn5 <KAN-2> Insertion Kit according to the manufacturer's instructions (Epicentre, California), generating pUC18-PD1063:kan. Sequencing using primers kan-2RP-1/kan-2FP-1 determined the location of the kanamycin cassette insertion was at 102 bp. Plasmid pUC18-PD1063:kan was electroporated into electrocompetent Xf wild-type Fetzer cells as previously described [22]–[24], creating the Xf mutant XfΔ1063. Double crossover mutants were confirmed by PCR analysis of the clones using primer pair PD1063chkfor (5′- CAGTTGCAAAACTCCAAGCACAACA-3′) and PD1063chkrev (5′- GCGGCGGATCATGAACCTA-3′) and results are shown in Figure 1.
Figure 1. Confirmation of double crossover events in PD1063 mutants.

Agarose electrophoresis gel showing confirmation of double crossover in two Xf Δ1063 mutants using primers PD1063chkfor and PD1063chkrev.
Cell-cell aggregation, surface attachment assays and cell growth
For cell-cell aggregation assays, 10 cultures each of Xf wild-type Fetzer and two independent cultures of XfΔ1063 were incubated in liquid PD3 medium in 15 ml polystyrene tubes in a vertical position without shaking for 10 days. The turbidity (ODs) of the upper culture medium, composed mostly of dispersed cells, was measured using a spectrophotometer at 600 nm. The culture medium was returned to the original tube, the settled aggregate masses were dispersed by pipetting, and the total cell culture was measured (ODt). Relative percentage of aggregated cells was estimated as follows: percent aggregated cells = (ODt-ODs)/ODt ×100 [25]. The assay was repeated twice.
For biofilm assays, 10 cultures each of Xf wild-type Fetzer and two independent cultures of XfΔ1063 were incubated in liquid PD3 medium in 15 ml polystyrene tubes in a vertical position without shaking for 10 days. Attachment on the surface walls of the tubes was assessed by a crystal violet staining method [26], [27]. After the incubation period, the PD3 medium was discarded and a 0.1% (wt/vol) aqueous solution of crystal violet was added to each tube, allowed to incubate for 15 min, and rinsed with dH2O. The remaining stain was eluted from the bacterial ring using ethanol. The absorbance of the ethanol-crystal violet solution was measured at 540 nm. The assay was repeated twice.
For cell growth assays, 10 cultures each of Xf wild-type Fetzer and XfΔ1063 were incubated in 30 ml liquid PD3 medium in 50 ml polypropylene tubes with shaking at 100 rpm. At the same time every day, for a total of 10 days, the cultures were shaken by hand to disperse clumps and 1 ml of culture was measured using a spectrophotometer at 600 nm. The culture was discarded after being measured. The assay was repeated twice. The data from cell-cell aggregation, biofilm formation and cell growth assays were analyzed non-parametrically using one-way analysis of variance and multiple pair-wise comparison using the Tukey test (SigmaPlot).
Pathogenicity assay on Vitis vinifera Thompson seedless grapevines and in planta bacterial population determination
Pathogenicity assays on Vitis vinifera Thompson seedless grapevines were performed as previously described [28]–[30]. Xf Fetzer and XfΔ1063 were adjusted to 108 CFU/ml in 1× PBS and two 20 µl drops were inoculated into 15 plants per strain using a pinprick inoculation procedure [31]. PBS served as negative control and 2 replications of the experiment were performed. After the first appearance of symptoms, typically 10 weeks following inoculation, the plants were evaluated for symptom progression biweekly until all plants were dead. A scale from 0 (healthy) to 5 (dead) was used to rate symptoms severity [30]. The data was analyzed non-parametrically using the two-way analysis of variance and multiple pair-wise comparison using the Tukey test (SigmaPlot).
For in planta bacterial population determination, petiole tissues from the point of inoculation (POI) and 25 cm above the POI were taken 12 weeks after inoculation and the number of bacteria quantified by culture. Briefly, the petioles were surface sterilized, ground in 2 ml of sterile 1× PBS, and serial dilutions plated on solid PD3 medium. After 7–10 days the number of Xf colonies was determined. The data was analyzed non-parametrically using the two-way analysis of variance and multiple pair-wise comparison using the Tukey test (SigmaPlot).
Generation of anti-PD1063 antibodies
PD1063 antibodies were generated against a 14 amino acid peptide, GDYNKQKFRSIDLKC. The cysteine residue was added to the N-terminus to facilitate keyhole limpet hemocyanin adjuvant conjugation. Peptide synthesis and conjugation was conducted by GenScript USA Inc (New Jersey). The peptide was resuspended in 1× PBS/Freund's incomplete adjuvant (Sigma-Aldrich, Missouri) 50/50 for the first and five booster injections. Immunizations were conducted by the Comparative Pathology Laboratory at UC Davis. One hundred twenty-five micrograms of peptide was injected twice subcutaneously and twice intramuscularly, per injection date, into New Zealand White rabbits on a 10 day schedule. Test bleeds were taken after the fourth and fifth injections and the rabbits were terminally bled three weeks after the fifth injection. Serum was stored at −20°C until used. Indirect ELISA using synthesized non-conjugated peptide was performed to determine the bleed with the highest antibody titer and the optimal working dilution. Activity and specificity of the anti-PD1063 serum were evaluated using pre-immune serum in indirect ELISA and western blots. No non-specific adhesion of polyclonal, pre-immune rabbit antibodies was found (data not shown).
Isolation of secreted proteins and vesicles
Total secreted protein and vesicles were isolated from Xf as described by Voegel et al. and Welsch et al. [32], [33]. Briefly, wild-type Xf Fetzer, XfΔ1063 and media controls were grown for 5 days in 500 ml PD3 at 28°C. Supernatant was obtained by centrifugation at 3000 g for 10 min and 20 ml of supernatant was placed into dialysis tubing (12-14000 MWCO, Spectrum Chemical Mfg Corp, New Jersey). Samples were dialysed against 1× PBS, 0.1 M EDTA (pH 8.0) and concentrated on polyethyleneglycol bisphenol A epichlorohydrin copolymer 15–20 kDa (Sigma-Aldrich, Missouri) until sample volume was 5 ml. Sucrose was added to the 5 ml concentrated sample to a final concentration of 40% (w/v) followed by the addition of 50 µl 10% SDS, 100 µl β-mercaptoethanol and 2 ml phenol. Samples were vortexed and centrifuged at 800 g for 5 min at room temperature. Approximately 2 ml of the top layer was transferred into a new tube and the centrifugation step was repeated. To collect the protein fraction, samples were divided into two tubes and 10 ml of methanol was added to each tube. Samples were vortexed and centrifuged at 3300 g for 5 min at 4°C. The supernatant was discarded, 10 ml methanol was added to the pellet and the centrifugation step was repeated. The resulting pellet was air-dried and resuspended in 100 µl 1% SDS, 65 mM Tris/HCl (pH 7.0).
For isolation of membrane vesicles, wild-type Xf Fetzer, XfΔ1063 and media controls were grown as previously described and supernatant was obtained by centrifugation at 3000 g for 10 min. Supernatant was filtered through a 0.45 µm sterile filter for elimination of whole cells. Resulting filtrate was centrifuged at 38400 g for 1 h at 4°C to obtain the vesicle pellet and culture supernatant fraction. The pellet was resuspended in 1% SDS, 65 mM Tris/HCl (pH 7.0). Trichloroacetic acid (TCA) to a final concentration of 13% was added to the supernatant fraction. Precipitated proteins were harvested by centrifugation at 15000 g for 15 min, washed with 70% ethanol, air-dried and resuspended in 500 µl 1% SDS, 65 mM Tris/HCl (pH 7.0).
Isolation of outer-membrane proteins
Xf outer-membrane proteins were isolated as described by Voegel et al. and Nikaido [32], [34]. Briefly, one liter volumes of liquid PD3 cultures of Xf Fetzer and XfΔ1063 were centrifuged at 3000 g for 10 min. The resulting Xf cells were washed with 10 mM HEPES (pH 7.4) and resuspended in 5 ml of 10 mM HEPES, pH 7.4, containing 0.02 mg DNase ml−1, 0.02 mg RNase ml−1, 1 mM PMSF and 0.1 M EDTA. Cells were passed three times through a French pressure cell at 900 p.s.i (6.2 MPa) and unbroken cells were removed by centrifugation at 3000 g for 10 min at 4°C. The resulting supernatant was centrifuged at 180000 g for 1 h at 4°C, the pellet was resuspended in 2 ml HEPES buffer and centrifuged at 3000 g for 2 min to remove insoluble material. The supernatant was applied on top of a sucrose step gradient consisting of 2.5 ml sucrose solutions at 55%, 52.5%, 50% and 47.5% (w/w). The samples were placed in a swinging-bucket rotor (Beckman SW-40) and centrifuged at 100000 g for 18 h at 4°C. The resulting bands were collected, diluted with 20 ml HEPES buffer and centrifuged at 180000 g for 1 h. The pellets were resuspended in 100 µl HEPES buffer and stored in 5 µl aliquots at −20°C. Western blot analysis using anti-MopB antibodies [35] (kindly provided by Dr. George Bruening, UC Davis) was used to identify which fraction from the sucrose gradient contained the outer-membrane proteins, MopB protein being the membrane protein reporter.
Western blot analysis
Proteins were separated by SDS-PAGE on a 12% Tris/HCl polyacrylamide gel in all instances except for identification of outer-membrane fractions with anti-MopB antibodies, which used a 10% Tris/HCl polyacrylamide gel. The proteins were transferred to a PVDF membrane (Whatman, Maine) at 100 V for 1 h in western transfer buffer (25 mM Tris, 192 mM glycine, 10% methanol) and subsequently blocked overnight in 5% nonfat milk in 1× PBS. After washing three times for 15 min with 1× PBS, 0.05% Tween 20, the membrane was probed with a 1∶1600 dilution of anti-PD1063 antisera in 1× PBS for 1 h at 37°C. The membrane was washed three times for 15 min with 1× PBS, 0.05% Tween 20 then incubated with a 1∶1600 dilution of goat anti-rabbit IgG alkaline phosphatase conjugate (Bio-Rad, California) for 1 h at 37°C. The membrane was washed three times for 15 min with 1× PBS, 0.05% Tween 20 and bound conjugate was detected using an alkaline phosphatase conjugate substrate kit (Bio-Rad, California).
Results and Discussion
XfΔ1063 mutant cultures formed significantly less (P = 0.003) cell-cell aggregation than wild-type Xf (Figure 2A). There were no significant differences between wild-type Xf Fetzer and the XfΔ1063 mutant in surface attachment (biofilm formation) or cell growth (Figure 2B, C). Significance was defined as P<0.05. Cell-cell aggregation is mediated by a variety of factors including hemagluttinin proteins [30], [32]. These factors allow Xf to transition from a “sticky”, clumping phase to a movement phase, which is essential for virulence, and often controlled by quorum sensing processes.
Figure 2. Evaluation of biofilm formation, cell aggregation and cell growth in XfΔ1063 mutants.
A) Comparison of cell aggregation by wild-type Xf Fetzer, Xf Δ1063 mutant after 10 days growth in static liquid culture. Values shown are mean of 10 samples +/− standard error. The assay was repeated twice and data shown is representative of both assays. B) Comparison of biofilm formation by wild-type Xf Fetzer and Xf Δ1063 mutant after 10 days growth in static liquid culture. Values shown are mean of 10 samples +/− standard error. The assay was repeated twice and data shown is representative of both assays. C) Comparison of cell growth by wild-type Xf Fetzer and Xf Δ1063 mutant over 10 days growth in liquid culture with shaking at 100 rpm. Values shown are the mean of 10 samples +/− standard error. The assay was repeated twice and data shown is representative of both assays.
We found no significant differences (P>0.05) between wild-type Xf and XfΔ1063 in disease severity after 18 weeks growth under greenhouse conditions (Figure 3). There were no significant differences (P>0.05) in wild-type Xf or XfΔ1063 colony titers isolated 18 weeks post inoculation from the point of inoculation or 25 cm above the point of inoculation (Table 2). These results support recent findings that no statistical differences in populations were observed between the wild type Xoo strain PXO99 and the Xoo PXO_03968 mutant in planta [19]. However these studies conflict with a report by McCarthy et al. and Qian et al. that homologs of this protein have roles in virulence in S. maltophilia and Xoc, respectively [17], [18]. In the case of Xoc, Qian et al. also showed a role in cell growth in planta [18]. Our results indicate that PD1063 does not play a role in regulation of Xf density-dependent processes essential for virulence, except for cell-cell aggregation in vitro, in contrast to reports in S. maltophilia and Xoc [17], [18]. In the case of S. maltophilia, the homolog of Xoo PXO_03968 was required for full virulence whereas with Xoc, the homolog was essential for pathogenicity, in planta growth and in vitro biofilm formation [17], [18]. Cell-cell aggregation was not tested in either of the aforementioned systems.
Figure 3. Pathogenicity assay on Vitis vinifera grapevines.
Disease ratings of greenhouse grown Thompson seedless grapevines pin-prick inoculated with wild-type Xf Fetzer, Xf Δ1063 and PBS (negative control) through 18 weeks post-inoculation. Values shown are mean of 15 plants +/− standard error. The assay was repeated twice and data shown is representative of both assays.
Table 2. Populations (CFU/g of tissue) of Xylella fastidiosa isolated from Thompson seedless grapevine petioles 18 weeks post-inoculation.
| Strain | POI a | Above POI a |
| Xf Fetzer | 1.68 (±1.1)×108 | 2.03 (±9.3)×108 |
| XfΔ1063 | 1.69 (± 4.5)×107 | 1.97 (±8.7)×108 |
| PBS | 0 | 0 |
Point of inoculation (POI) or 25 centimeters above the POI.
Western blot analysis with anti-PD1063 antibodies on total secreted protein isolated from wild-type Xf, XfΔ1063 and media control identified PD1063 at approximately 19.2 kD only in protein fractions isolated from wild-type Xf (Figure 4). Western blot analysis of vesicles isolated from the aforementioned cultures again identified PD1063 only in vesicles isolated from wild-type Xf (Figure 4). Outer membrane vesicle production is a general feature of gram-negative bacteria and Xf has previously been shown to produce outer membrane vesicles [32], [36], [37]. Western blot analysis on outer membranes isolated from wild-type Xf and XfΔ1063 determined that PD1063 was associated with the membrane only in wild-type Xf, again at approximately 19.2 kD (Figure 5). Presence of outer membranes in all fractions was verified with anti-MopB antibodies, MopB being an outer membrane protein marker (Figure S1). Association of PD1063 with vesicles and in the supernatant is predicted by a secretory leader sequence, as identified using SignalP 4.0 [38]. The 19.2 kD protein isolated from the media corresponds to the predicted protein size once the leader sequence has been cleaved [39]. Similar results were also found in the case of Xoo PXO_03968, a homolog of PD1063 [19]. Similar to Xoo PXO_03968, PD1063 is likely processed through the general secretory system (type II secretion system) [11].
Figure 4. Western blot analysis of Xf secreted protein and vesicles.
Western blot analysis of isolated secreted proteins and vesicles developed with anti-PD1063 antibodies. Lanes A and B are precision plus protein dual-color standard and positive control (PD1063 Peptide A- keyhole limpet hemocyanin conjugate), respectively. Lanes C and D, Xf Fetzer secreted protein; lane E XfΔ1063 mutant secreted protein; lanes F and G, PD3 media (negative control); lane H, Xf Fetzer vesicles; lane I, XfΔ1063 vesicles; lane J, PD3 media (negative control). Positively stained proteins are found at approximately 19.2 kD in Xf Fetzer secreted protein and vesicle samples, the predicted size of processed PD1063 after the signal sequence has been cleaved.
Figure 5. Western blot analysis of Xf's outer membrane proteins.
Western blot analysis of isolated outer membrane proteins developed with anti-PD1063 antibodies. Lanes A and B are precision plus protein dual-color standard and positive control (PD1063 Peptide A-keyhole limpet hemocyanin conjugate), respectively. Lanes C–F are Xf Fetzer outer membrane fractions and lanes G–J are XfΔ1063 outer membrane fractions. Positively stained proteins are found only in wild type Xf Fetzer at approximately 19.2 kD, the predicted size of processed PD1063 after the signal sequence has been cleaved. XfΔ1063 serves as a negative control since PD1063 is not processed in the mutant strain.
Using protein blast, we found Xf PD1063 and Xoo PXO_03968 have 48% protein identity. The homologs in Xoc and S. maltophilia have 48% and 52% protein identity, respectively, to Xf PD1063 [40]. It is not uncommon for homologous proteins to have protein identities in this range as there are generally conserved regions of the protein that are important for function. According to PFAM analysis of the Xf PD1063 amino acid sequence, the protein is predicted to be an outer membrane protein and is classified as an outer membrane protein β–barrel domain (PF13505) based on the structure of Escherichia coli OmpX, PDB entry 1ORM [41], [42]. While we have confirmed that Xf PD1063 is located in the membrane, the observed differences in the functional role of the proteins may be due to the differences in amino acid sequence identity. The most important difference observed is the role in pathogenicity, or lack thereof, of Xf PD1063 in virulence compared to S. maltophilia and Xoc [17], [18].
While we found no role for PD1063 in pathogenicity, we did see a reduction in cell-cell aggregation. As predicted, we found PD1063 associated with the outer membrane and outer membrane vesicles. There are a number of factors involved in cell-cell aggregation, including hemagluttinin. With the loss of hemagluttinin, Xf was unable to clump and consequentially was hypervirulent in planta [30]. The loss of hemagluttinin caused a complete loss of cell-cell aggregation whereas the loss of PD1063 resulted in a small reduction of cell-cell aggregation in Xf. We did not see a complete loss of cell-cell aggregation and Xf was likely able to clump in planta and did not cause an increase in virulence as seen with other non-clumping Xf mutants. Since we found PD1063 associated with the outer membrane and vesicles, the protein may be involved in normal vesicle formation in Xf. It is possible that the loss of PD1063 has an effect on the membranes of Xf, causing it to be less sticky. Other clumping factors, such as hemagluttinin, are still being produced resulting in some level of cell-cell aggregation.
In conclusion, we have investigated the role of the Xf PD1063 protein, a homolog of Xoo PXO_03968, and found conflicting results with previous reports on homologs of the Xoo PXO_03968 in Xoc and S. maltophilia. In Xf, we found that the PD1063 protein is not involved in virulence or cell growth in planta or biofilm formation and cell growth in vitro. This is in contrast to reports of the Xoo PXO_03968 homolog in other systems. In the case of Xoc and S. matlophilia reports indicate a role for the PXO_03968 homolog in biofilm formation and virulence among other density dependent processes. This is not the first time a putative cell-cell signaling protein in Xf has exhibited a phenotype different from close relatives. This occurred in the case of DSF where Xf exhibited hypervirulence and Xoo exhibited reduced virulence when the rpfF gene, responsible for DSF production, was mutated [12], [13]. While we were unable to identify a clear role for PD1063, other than in cell-cell aggregation in vivo, our research supports recent reports that a homolog of PD1063, Xoo PXO_03968, is secreted in association with outer-membrane vesicles. Our results provide further evidence that what seems to be the norm in many other plant pathogenic bacteria is not always the same in the case of Xf. Further research is required to understand what role, if any, PD1063 plays in Xf.
Supporting Information
Verification of Xf outer-membrane protein fraction. Western blot analysis of isolated outer membrane proteins developed with anti-MopB antibodies. Lane A is precision plus protein dual-color standard. Lanes B-E are Xf Fetzer outer membrane fractions and lanes G-J are XfΔ1063 outer membrane fractions. Positive bands corresponding to the MopB outer membrane protein are seen at 42 kD. This verifies that the outer membrane fraction isolated does in fact contain outer membranes. Lane F is empty.
(TIF)
Acknowledgments
This research was supported by the California Department of Food and Agriculture UC Pierce's Disease Research Grant Program. We would also like to thank Dr. George Bruening for supplying the anti-mopB antibodies, Dr. Bryce Falk for assistance with ultra-centrifugation and Dr. Michele Igo and Sherry Huston for assistance with the French Press. The authors appreciate the helpful suggestions of Dr. Pamela Ronald in the preparation of this manuscript.
Data Availability
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper.
Funding Statement
The work reported in this manuscript was supported by a grant from the United States Department of Agriculture, grant #2010-34442-21101. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Wells JM, Raju BC, Hung HY, Weisburg WG, Mandelcopaul L, et al. (1987) Xylella fastidiosa gen-nov, sp-nov - gram-negative, xylem-limited, fastidious plant bacteria related to Xanthomonas spp. International Journal of Systematic Bacteriology 37:136–143. [Google Scholar]
- 2. Hopkins DL (1989) Xylella fastidiosa - xylem limited bacterial pathogen of plants. Annual Review of Phytopathology 27:271–290. [DOI] [PubMed] [Google Scholar]
- 3. Hartung JS, Beretta J, Brlansky RH, Spisso J, Lee RF (1994) Citrus variegated chlorosis-bacterium- axenic culture, pathogenicity, and serological relationships with other strains of Xylella fastidiosa . Phytopathology 84:591–597. [Google Scholar]
- 4. Hopkins DL, Purcell AH (2002) Xylella fastidiosa: Cause of Pierce's disease of grapevine and other emergent diseases. Plant Disease 86:1056–1066. [DOI] [PubMed] [Google Scholar]
- 5. Hewitt WB, Houston BR, Frazier NW, Freitag JH (1946) Leafhopper transmission of the virus causing Pierce's disease of grape and dwarf of alfalfa. Phytopathology 36:117–128. [PubMed] [Google Scholar]
- 6. Morris CE, Monier JM (2003) The ecological significance of biofilm formation by plant-associated bacteria. Annual Review of Phytopathology 41:429–453. [DOI] [PubMed] [Google Scholar]
- 7. Fuqua WC, Winans SC (1994) A LuxR-LuxI type regulatory system activates Agrobacterium TI plasmid conjugal transfer in the presence of a plant tumor metabolite. Journal of Bacteriology 176:2796–2806. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Fuqua C, Winans SC, Greenberg EP (1996) Census and consensus in bacterial ecosystems: The LuxR-LuxI family of quorum-sensing transcriptional regulators. Annual Review of Microbiology 50:727–751. [DOI] [PubMed] [Google Scholar]
- 9. Swings J, Vandenmooter M, Vauterin L, Hoste B, Gillis M, et al. (1990) Reclassification of the causal agents of bacterial-blight (Xanthomonas campestris pv oryzae) and bacterial leaf streak (Xanthomonas campestris pv oryzicola) of rice as pathovars of Xanthomonas oryzae (Ex Ishiyama 1922) sp-nov, nom-rev. International Journal of Systematic Bacteriology 40:309–311. [Google Scholar]
- 10. Lee BM, Park YJ, Park DS, Kang HW, Kim JG, et al. (2005) The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice. Nucleic Acids Research 33:577–586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Simpson AJG, Reinach FC, Arruda P, Abreu FA, Acencio M, et al. (2000) The genome sequence of the plant pathogen Xylella fastidiosa. Nature 406:151–157. [DOI] [PubMed] [Google Scholar]
- 12. Chatterjee S, Sonti RV (2002) rpfF mutants of Xanthomonas oryzae pv. oryzae are deficient for virulence and growth under low iron conditions. Molecular Plant-Microbe Interactions 15:463–471. [DOI] [PubMed] [Google Scholar]
- 13. Newman KL, Almeida RPP, Purcell AH, Lindow SE (2004) Cell-cell signaling controls Xylella fastidiosa interactions with both insects and plants. Proceedings of the National Academy of Sciences of the United States of America 101:1737–1742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Chatterjee S, Wistrom C, Lindow SE (2008) A cell-cell signaling sensor is required for virulence and insect transmission of Xylella fastidiosa. Proceedings of the National Academy of Sciences of the United States of America 105:2670–2675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Lee SW, Han SW, Sririyanum M, Park CJ, Seo YS, et al. (2009) A Type I-Secreted, Sulfated Peptide Triggers XA21-Mediated Innate Immunity (Retracted article. See vol. 342, pg. 191, 2013). Science 326:850–853. [DOI] [PubMed] [Google Scholar]
- 16. Han SW, Sriariyanun M, Lee SW, Sharma M, Bahar O, et al. (2011) Small Protein-Mediated Quorum Sensing in a Gram-Negative Bacterium. Plos One 6:10. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 17. McCarthy Y, Dow JM, Ryan RP (2011) The Ax21 Protein Is a Cell-Cell Signal That Regulates Virulence in the Nosocomial Pathogen Stenotrophomonas maltophilia. Journal of Bacteriology 193:6375–6378. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 18. Qian GL, Zhou YJ, Zhao YC, Song ZW, Wang SY, et al. (2013) Proteomic Analysis Reveals Novel Extracellular Virulence-Associated Proteins and Functions Regulated by the Diffusible Signal Factor (DSF) in Xanthomonas oryzae pv. oryzicola. Journal of Proteome Research 12:3327–3341. [DOI] [PubMed] [Google Scholar]
- 19. Bahar O, Pruitt R, Luu DD, Schwessinger B, Daudi A, et al. (2014) The Xanthomonas Ax21 protein is processed by the general secretory system and is secreted in association with outer membrane vesicles. PeerJ 2:e242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Hendson M, Purcell AH, Chen DQ, Smart C, Guilhabert M, et al. (2001) Genetic diversity of Pierce's disease strains and other pathotypes of Xylella fastidiosa. Applied and Environmental Microbiology 67:895–903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Davis MJ, French WJ, Schaad NW (1981) Axenic culture of the bacteria associated with phony disease of peach and plum leaf scald. Current Microbiology 6:309–314. [Google Scholar]
- 22. Matsumoto A, Young GM, Igo MM (2009) Chromosome-based genetic complementation system for Xylella fastidiosa. Appl Environ Microbiol 75:1679–1687. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Guilhabert MR, Hoffman LM, Mills DA, Kirkpatrick BC (2001) Transposon mutagenesis of Xylella fastidiosa by electroporation of Tn5 synaptic complexes. Molecular Plant-Microbe Interactions 14:701–706. [DOI] [PubMed] [Google Scholar]
- 24. Guilhabert MR, Kirkpatrick BC (2003) Transformation of Xylella fastidiosa with broad host range RSF1010 derivative plasmids. Molecular Plant Pathology 4:279–285. [DOI] [PubMed] [Google Scholar]
- 25. Burdman S, Jurkevitch E, Soria-Diaz ME, Serrano AM, Okon Y (2000) Extracellular polysaccharide composition of Azospirillum brasilense and its relation with cell aggregation. FEMS Microbiol Lett 189:259–264. [DOI] [PubMed] [Google Scholar]
- 26. Espinosa-Urgel M, Salido A, Ramos JL (2000) Genetic analysis of functions involved in adhesion of Pseudomonas putida to seeds. J Bacteriol 182:2363–2369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Leite B, Andersen PC, Ishida ML (2004) Colony aggregation and biofilm formation in xylem chemistry-based media for Xylella fastidiosa. Fems Microbiology Letters 230:283–290. [DOI] [PubMed] [Google Scholar]
- 28. Hill BL, Purcell AH (1997) Populations of Xylella fastidiosa in plants required for transmission by an efficient vector. Phytopathology 87:1197–1201. [DOI] [PubMed] [Google Scholar]
- 29. Purcell AH, Saunders SR, Hendson M, Grebus ME, Henry MJ (1999) Causal Role of Xylella fastidiosa in Oleander Leaf Scorch Disease. Phytopathology 89:53–58. [DOI] [PubMed] [Google Scholar]
- 30. Guilhabert MR, Kirkpatrick BC (2005) Identification of Xylella fastidiosa antivirulence genes: Hemagglutinin adhesins contribute to Xylela fastidiosa biofilm maturation and colonization and attenuate virulence. Molecular Plant-Microbe Interactions 18:856–868. [DOI] [PubMed] [Google Scholar]
- 31. Hopkins DL (1985) Physiological and pathological characteristics of virulent and avirulent strains of the bacterium that causes Pierce's disease of grapevine. Phytopathology 75:713–717. [Google Scholar]
- 32. Voegel TM, Warren JG, Matsumoto A, Igo MM, Kirkpatrick BC (2010) Localization and characterization of Xylella fastidiosa haemagglutinin adhesins. Microbiology-Sgm 156:2172–2179. [DOI] [PubMed] [Google Scholar]
- 33. Welsch R, Maass D, Voegel T, DellaPenna D, Beyer P (2007) Transcription factor RAP2.2 and its interacting partner SINAT2: Stable elements in the carotenogenesis of Arabidopsis leaves. Plant Physiology 145:1073–1085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Nikaido H (1983) Proteins forming large channels from bacterial and mitochondrial outer membranes - porins and phage-lambda receptor protein. Methods in Enzymology 97:85–100. [DOI] [PubMed] [Google Scholar]
- 35. Dandekar AM, Gouran H, Ibanez AM, Uratsu SL, Aguero CB, et al. (2012) An engineered innate immune defense protects grapevines from Pierce disease. Proceedings of the National Academy of Sciences of the United States of America 109:3721–3725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Ionescu M, Zaini PA, Baccari C, Tran S, da Silva AM, et al. (2014) Xylella fastidiosa outer membrane vesicles modulate plant colonization by blocking attachment to surfaces. Proceedings of the National Academy of Sciences of the United States of America 111:E3910–E3918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Beveridge TJ (1999) Structures of gram-negative cell walls and their derived membrane vesicles. Journal of Bacteriology 181:4725–4733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature Methods 8:785–786. [DOI] [PubMed] [Google Scholar]
- 39. Stothard P (2000) The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques 28:1102–+. [DOI] [PubMed] [Google Scholar]
- 40. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. Journal of Molecular Biology 215:403–410. [DOI] [PubMed] [Google Scholar]
- 41. Sonnhammer ELL, Eddy SR, Durbin R (1997) Pfam: A comprehensive database of protein domain families based on seed alignments. Proteins-Structure Function and Genetics 28:405–420. [DOI] [PubMed] [Google Scholar]
- 42. Fernandez C, Adeishvili K, Wuthrich K (2001) Transverse relaxation-optimized NMR spectroscopy with the outer membrane protein OmpX in dihexanoyl phosphatidylcholine micelles. Proceedings of the National Academy of Sciences of the United States of America 98:2358–2363. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Verification of Xf outer-membrane protein fraction. Western blot analysis of isolated outer membrane proteins developed with anti-MopB antibodies. Lane A is precision plus protein dual-color standard. Lanes B-E are Xf Fetzer outer membrane fractions and lanes G-J are XfΔ1063 outer membrane fractions. Positive bands corresponding to the MopB outer membrane protein are seen at 42 kD. This verifies that the outer membrane fraction isolated does in fact contain outer membranes. Lane F is empty.
(TIF)
Data Availability Statement
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper.




