RNase L Attenuates Mitogen-stimulated Gene Expression via Transcriptional and Post-transcriptional Mechanisms to Limit the Proliferative Response

Background: Serum-response factor (SRF) induces mRNAs that promote cell proliferation, whereas RNase L and tristetraprolin (TTP) degrade specific mRNAs to inhibit proliferation.

Results: RNase L and TTP interact and down-regulate SRF to attenuate mitogen-induced gene expression.

Conclusion: RNase L and TTP are components of a regulatory network that limits the proliferative response to mitogens.

Significance: The RNase L/TTP axis represents a target to inhibit cancer cell proliferation.

Abstract

The cellular response to mitogens is tightly regulated via transcriptional and post-transcriptional mechanisms to rapidly induce genes that promote proliferation and efficiently attenuate their expression to prevent malignant growth. RNase L is an endoribonuclease that mediates diverse antiproliferative activities, and tristetraprolin (TTP) is a mitogen-induced RNA-binding protein that directs the decay of proliferation-stimulatory mRNAs. In light of their roles as endogenous proliferative constraints, we examined the mechanisms and functional interactions of RNase L and TTP to attenuate a mitogenic response. Mitogen stimulation of RNase L-deficient cells significantly increased TTP transcription and the induction of other mitogen-induced mRNAs. This regulation corresponded with elevated expression of serum-response factor (SRF), a master regulator of mitogen-induced transcription. RNase L destabilized the SRF transcript and formed a complex with SRF mRNA in cells providing a mechanism by which RNase L down-regulates SRF-induced genes. TTP and RNase L proteins interacted in cells suggesting that RNase L is directed to cleave TTP-bound RNAs as a mechanism of substrate specificity. Consistent with their concerted function in RNA turnover, the absence of either RNase L or TTP stabilized SRF mRNA, and a subset of established TTP targets was also regulated by RNase L. RNase L deficiency enhanced mitogen-induced proliferation demonstrating its functional role in limiting the mitogenic response. Our findings support a model of feedback regulation in which RNase L and TTP target SRF mRNA and SRF-induced transcripts. Accordingly, meta-analysis revealed an enrichment of RNase L and TTP targets among SRF-regulated genes suggesting that the RNase L/TTP axis represents a viable target to inhibit SRF-driven proliferation in neoplastic diseases.

Introduction

The cellular response to proliferative signals requires rapid reprogramming of gene expression, with transcripts encoding mediators of cell proliferation being induced within minutes of stimulation. Upon abrogation of the mitogenic stimulus, expression of the induced mRNAs is efficiently attenuated to restore differentiated tissues to a quiescent state (1, 2). The stringent regulation of this response is essential for the homeostasis and viability of the organism. For example, failure to respond to mitogenic stimuli can result in defective tissue repair, whereas failure to attenuate the response can lead to uncontrolled proliferation and neoplastic disorders, including cancer (3). Although the signaling pathways and gene products that are induced in response to mitogenic stimuli have been extensively studied, less is known about the mechanisms that attenuate this response. In this regard, early analyses of mitogen-induced genes revealed that antiproliferative effectors were induced in parallel with proliferation-stimulatory genes (4). These findings provided some of the first evidence of cell-encoded attenuators of the mitogenic response and suggested that they function in a negative feedback mechanism to limit proliferation. For example, platelet-derived growth factor induces the expression of interferon-β (IFNβ) and its downstream effector 2′,5′-oligoadenylate synthetase, both of which function in diverse antiproliferative activities (4). Similarly, tristetraprolin (TTP,² zinc finger protein 36 zfp36), an RNA-binding protein (RNABP) that enhances the decay of proliferation-stimulatory transcripts to mediate multiple antiproliferative programs (5–7), was first discovered as a serum-induced transcript (8, 9). The identification of these and other antiproliferative effectors established the critical function that endogenous constraints have on cell proliferation, regulating the mitogenic response and inhibiting tumorigenesis (10). Accordingly, understanding the mechanisms by which these feedback regulatory pathways restrict cell proliferation may reveal novel therapeutic targets for malignant diseases. Toward this goal, we and others have reported that, in contrast to the transcriptional induction of mitogen-stimulated genes, post-transcriptional mechanisms occupy a central role in attenuating this response (6, 7, 11–13). Here, we investigate the functional interaction of two pathways that limit the proliferative response following mitogen stimulation via mechanisms that regulate transcription and mRNA stability.

RNase L is the terminal component of a RNA cleavage pathway that was discovered as a mediator of IFN-induced antiviral activities (14, 15). However, it is now evident that this endoribonuclease has broader roles in the innate immune response and as a potent effector of diverse antiproliferative activities (16–22). For example, RNase L-deficient cells exhibit an increased proliferative rate and a diminished response to cell cycle inhibition (23). Ectopic expression or activation of RNase L can induce apoptosis or senescence in distinct cell types, whereas these responses are reduced in RNase L-deficient cells and mice (24–26). Consistent with a role for RNase L as an endogenous proliferative constraint, RNase L expression inhibited tumorigenesis in nude mouse xenografts (27), and RNase L knock-out (KO) mice exhibited a greater tumor burden in a model of colitis-associated cancer (28). Furthermore, the RNASEL gene mapped to the hereditary prostate cancer susceptibility locus (HPC1), and mutations in RNASEL are associated with an increased risk for prostate (29), head and neck (30), cervix (31), and breast cancers (32). The biologic activities of RNase L are thought to occur primarily through the cleavage of its single-stranded RNA substrates; consistent with this view, an RNase L mutant with a deletion in its catalytic domain acted as a dominant negative inhibitor of antiviral and antiproliferative activities (11). RNase L is expressed at low basal levels in a latent, inactive form in most cell types (33–35). Activation of RNase L is dependent on a family of 2′,5′-oligoadenylate synthetase enzymes that require double-stranded RNA (dsRNA) for enzymatic activity to polymerize ATP into 2′,5′-linked oligoadenylates (2–5A, p_x5′A(2′p5′A)_n; x = 1–3; n ≥2) (14, 33, 34, 36). RNase L binds 2–5A with high affinity (K_d = 40 pm; (37)) and induces conformational changes to form a dimeric structure (38) as modeled from a recent crystallographic analysis (39, 40). In the active dimeric form, the catalytic domain is exposed to mediate cleavage of single-stranded RNA targets, including viral genomic and messenger RNAs (mRNAs), and cellular ribosomal, mitochondrial, and specific mRNAs (17, 41).

Microarray studies have identified distinct profiles of RNase L-regulated RNAs in different cell types and physiologic settings (12, 19, 42–44). Among these, mRNAs that are stabilized in the absence of RNase L, and are present in an RNase L-mRNA protein complex, represent candidate substrates (45). The finding that RNase L regulates a discrete subset of RNAs provides evidence of its capacity to selectively target specific transcripts, the regulation of which is thought to mediate its diverse biologic activities. However, the mechanisms underlying this substrate specificity are not known. A current model for the control of eukaryotic mRNA decay involves the interaction of specific RNABPs with cognate cis elements on target mRNAs. In turn, this interaction can recruit or exclude mRNA decay enzymes leading to transcript destabilization or stabilization, respectively. In addition, regulatory RNAs such as microRNAs can play an important role to regulate mRNA stability via related mechanisms (46). By analogy to this paradigm, we hypothesized that targeted RNA cleavage by RNase L may also require an RNABP. In this regard, the recent finding that RNase L targeted the mRNA encoding the RNABP TTP (23) provided a clue to a potential RNA-targeting mechanism. Specifically, the observation that RNase L regulates TTP mRNA, and previous studies demonstrating that TTP autoregulates its own RNA (47, 48), suggested that RNase L and TTP may function in concert to degrade TTP mRNA and potentially other TTP targets. Consistent with this model, we determined that RNase L and TTP proteins associate in an immunoprecipitable complex in cells (45). TTP mediates its antiproliferative activities by promoting the degradation of labile mRNAs containing AU-rich elements (AREs) that are typically found in their 3′-untranslated regions (3′UTR) (49–51). Specifically, TTP binds AREs in target mRNAs and interacts with mRNA decay enzymes, such as the negative regulator of transcription (Not1)/chromatin assembly factor (Caf1) (52), 5′–3′-exoribonuclease 1 (Xrn1) (53), chemokine c-c motif receptor 4 (Ccr4) (53), decapping protein (54), and components of the exosome (55), to stimulate their decay. Established TTP targets include transcripts that encode mediators of cell proliferation such as c-Myc (56), hypoxia-inducible factor 1, α (HIF1-α) (57), cyclooxygenase 2 (Cox-2) (58), and proviral integration site 1 (59). Increased TTP-mediated turnover of these transcripts results in proliferation-inhibitory activities, including cell cycle arrest (60), senescence (61), apoptosis (5–7, 62), and tumor suppression in vivo (5, 63, 64). A subset of TTP targets exhibit RNase L-dependent regulation supporting a potential role for TTP in targeting RNase L substrate cleavage (45). However, the functional significance of this regulation and the biologic contexts in which it occurs are not known. The major biologic functions attributed to TTP occur following the induction of its expression or activity by diverse stimuli, including mitogens (7, 64, 65). In light of the overlapping roles for RNase L and TTP in antiproliferative and tumor suppressor activities, we examined the regulation of TTP by RNase L in the context of mitogen stimulation as a potential mechanism by which the proliferative response is attenuated.

Here, we report that RNase L post-transcriptionally down-regulated TTP by destabilizing its mRNA in unstimulated conditions, whereas it indirectly inhibited TTP transcription following mitogenic stimulation. This finding suggested that RNase L targeted a transcription factor required for induction of TTP mRNA following serum stimulation. A binding site for the serum-response factor (SRF), a master transcriptional regulator of serum-induced genes, was identified in the ZFP36 gene promoter. Furthermore, SRF mRNA was previously reported to be down-regulated by RNase L in IFNγ-stimulated mouse embryo fibroblasts (MEFs) (66). Together, these observations suggested that SRF mRNA is a direct target of RNase L and that this regulation may account for the RNase L-dependent regulation of TTP in mitogen-stimulated cells. Consistent with this prediction, RNase L destabilized the SRF transcript and formed a physical complex with SRF mRNA in cells. We hypothesized that RNase L and TTP function in concert to target SRF mRNA cleavage. Accordingly, we validated the association of RNase L and TTP in cells and identified an essential role for the RNase L pseudokinase domain in this interaction. SRF mRNA was degraded in a TTP-dependent manner and contains a consensus ARE TTP-binding site in its 3′UTR identifying SRF mRNA as a novel TTP target and RNase L substrate. We further determined that established TTP target mRNAs are also regulated by RNase L providing evidence of a broader role for this mechanism of RNase L substrate targeting. Proliferation was enhanced following mitogen stimulation of RNase L-deficient as compared with RNase L-competent cells, demonstrating its functional role in limiting the mitogenic response. Findings from this study thus identify a novel mechanism of RNase L substrate specificity through its association with TTP. RNase L functions via transcriptional and post-transcriptional mechanisms to attenuate the induction of TTP, and TTPs target mRNAs, following mitogen stimulation. As important regulators of the cellular response to mitogenic stimuli that function to constrain cell proliferation, the RNase L/TTP axis represents a potential therapeutic target for neoplastic diseases, including cancer.

EXPERIMENTAL PROCEDURES

Cell Culture and Transfections

MEF, HeLa, and HEK 293-T cells were cultured in DMEM containing 10% FBS and 1× antibiotic/antimycotic (Invitrogen) and maintained at 37 °C and 5% CO₂. Transfections in HeLa and 293-T cells were carried out using Lipofectamine 2000 according to supplier's directions (Invitrogen). MEFs were derived from RNase L^−/− and TTP^−/− mice and WT mice of the same genetic background (25, 67). All experiments with MEFs were performed with early and late passage cultures to ensure that results were not due to passage-associated changes. SNAP-control and SNAP-RNase L stable HeLa cell lines were generated by selection with neomycin.

Expression Constructs

pcDNA3-FLAG-RNase L and pCMV3B-Myc-RNase L constructs and deletion mutants were subcloned from pGEM-GST-RNase L constructs. RNase L deletion constructs were kindly provided by Beihua Dong and Robert Silverman, The Cleveland Clinic Foundation (33, 68). pcDNA-FLAG-TTP was generated by cloning TTP cDNA in pTRE2hyg vector (Clontech) downstream of 3×FLAG-CMV-10 (Sigma) and was generously provided by the Gerald Wilson laboratory. pcDNA-GFP-TTP and TTP deletion mutants were generated as described (69). SNAP-control and SNAP-RNase L stable cell lines were generated by cloning full-length RNase L into pSNAP tag plasmid downstream of the SNAP tag.

Western Blotting and Immunoprecipitation

Preparation of cell lysates, measurement of protein concentration, and Western blot (WB) analysis were performed as described previously (70). Antibodies were used at the following dilutions: anti-FLAG (Sigma) 1:1000; anti-Myc (Upstate Biotechnology) 1:2000; anti-actin (Sigma) 1:5000; anti-GAPDH (Thermo-Fisher Scientific) 1:1000; anti-SNAP (New England Biolabs) 1:500; anti-TTP (Abcam) 1:500; anti-SRF (Sigma) 1:5000; and anti-phospho-SRF (Sigma) 1:2000. For immunoprecipitation (IP), 500 μg of total protein was precleared for 1 h at 4 °C using 25 μl of protein G-agarose beads (Santa Cruz Biotechnology). Protein that nonspecifically bound to protein G-agarose was removed by centrifugation to generate the precleared cell lysate, and primary antibodies or isotype control (IgG) were then added and incubated at 4 °C for 2 h with rotation. To IP the antibody complexes, 30 μl of protein G-agarose was added and incubated overnight at 4 °C with rotation. The immunoreactive complex was pelleted by centrifugation at 4,000 rpm for 5 min. Supernatant was removed, and the pellet was washed using 1 ml of PBS four times. After the final wash, pellet was resuspended in 1× SDS loading buffer for WB analysis.

Measurement of mRNA

Purified total RNA from cells was isolated by TRIzol reagent (Invitrogen) according to the manufacturer's instructions. mRNA expression was measured by multiplex and quantitative real time reverse-transcription PCR (qRT-PCR) using the iTAq Universal SYBR Green one-step kit (Bio-Rad) and the CFX96 (Bio-Rad). All mRNAs were measured with control mRNA primer sets (PGK1, HPRT, and GAPDH) in parallel reactions. Each data point is taken as the mean ± S.D. from triplicate qRT-PCRs for each RNA sample. Quality control of primer sets used for qPCR was performed using melt curve analysis and appropriate controls, e.g. non-template and no reverse transcriptase. Primer sets are listed in Table 1.

TABLE 1.

qRT-PCR primer sets in mouse and human

Sequences of forward and reverse primers used to test the specified mRNA levels in mouse and human samples are shown.

qRT-PCR primer sets	Forward primer	Reverse primer
TTP mouse mRNA	CAAGGCCATTCGCGCCACCAT	CCTCCGTGGTCGGATGACAGG
TTP mouse primary transcript	GACTGGCAAGCTCGTGAAGT	CAGTCAGGCGAGAGGTGA
SRF mouse mRNA	ATCGACAACAAGCTGCGGCG	AATCAGCGCCTTGCCGGTCT
TTP human mRNA	CACCCCTCATGGCCAACCGT	GATGGCACGGGCACGTCAGG
SRF human mRNA	ATCGACAACAAGCTGCGGCG	AATCAGCGCCTTGCCGGTCT
Cox-2 mouse mRNA	CATCCCCTTCCTGCGAAGTT	CATGGGAGTTGGGCAGTCAT
VEGF mouse mRNA	AACGATGAAGCCCTGAGTG	GCGCTTTCGTTTTTGACCCT
TNF-α mouse mRNA	GACCCTCACACTCAGATCATCTTCT	CCACTTGGTGGTTTGCTACGA
p21CIP mouse mRNA	GCAGATCCACAGCGATATCCA	CATGAGCGCATCGCAATCAC
IL-1β mouse mRNA	CAGGCAGGCAGTATCACTCA	AGGCCACAGGTATTTTGTCG
HIF1-α mouse mRNA	CGGCGGCGAGAACGAGAAGAAA	GCTCACATTGTGGGGAAGTGGCAA
Pim-1 mouse mRNA	AGGTGGGGATGCTCCTGTCCA	TGCCAGAGTAGACCGAGCCGA
Pgk1 mouse mRNA	CGGCTGGACTGTCATCCTGC	TGGACAGTGAGGCTCGGAAAGC
Pgk1 human mRNA	GACGCTGGACAAGCTGGACGTT	GGACAGCAGCCTTAATCCTCTGGTT
Hprt human mRNA	AGACTTTGCTTTCCTTGGTCAGGC	CTTCGTGGGGTCCTTTTCACCAGC
MyoD mouse mRNA	CCATCCGCTACATCGAAGGT	CACTGTAGTAGGCGGTGTCG

Measurement of mRNA Decay Kinetics

Actinomycin D (actD) time course assays were used to determine the decay rates of SRF and TTP mRNAs. Briefly, 5 μg/ml actD was added to cell culture media to inhibit transcription, and total RNA was purified at specific times, thereafter limited to 4 h to avoid actD-enhanced apoptosis (71). SRF or TTP transcripts were measured by qRT-PCR and normalized to control mRNA as described above. To determine mRNA half-lives, first-order decay constants (k) were solved by nonlinear regression (PRISM) of the percentage of mRNA remaining versus the time of actD treatment. The half-lives were resolved by t_½ = ln2/k and are based on the mean ± S.D. of n (greater or equal to 3 or more) independent time course experiments.

Ribonucleoprotein Immunoprecipitations (RNP-IP) and Analysis of Bound RNA

Analysis of mRNA in RNase L RNP complexes was performed as adapted from a previously described protocol (72). HeLa cells stably expressing SNAP-control or SNAP-RNase L were washed by scraping in 5 ml of ice-cold PBS and centrifuged at 500 × g for 5 min. Cells were lysed in PLB buffer (10 mm HEPES, pH 7.5, 50 mm KCl, 5 mm MgCl₂, 0.3% Nonidet P-40) containing 25× protease inhibitor mixture/RNase-OUT (Invitrogen) and then incubated on ice for 10 min. Supernatant was collected by centrifugation at 10,000 × g for 15 min, and the protein concentration was determined (Bio-Rad). Supernatants were stored at −80 °C or used directly for IP. For RNP-IP, 3 mg of the supernatant was incubated with 70 μl of 50% (v/v) suspension of protein-A-Sepharose beads (Sigma) washed with NT2 buffer (50 mm Tris, pH 7.4, 150 mm NaCl, 1 mm MgCl, 10 mm HEPES, pH 7.0, 0.5% Nonidet P-40) and precoated with 15 μg of SNAP antibody (New England Biosciences) for 30 min at 4 °C. Beads were washed five times with NT2 buffer and sequentially treated with DNase I (30 °C for 15 min) and proteinase K (55 °C for 15 min). The RNA was extracted with phenol/chloroform and precipitated in 0.3 m sodium acetate, pH 5.5, with 2 volumes of ethanol at −20 °C. RNA was pelleted at 10,000 × g, washed in ethanol, and resuspended in diethyl pyrocarbonate-treated water for qPCR analysis to detect the presence of specific mRNAs in the immunoprecipitated complex. RNP-IPs in 293T cells were first co-transfected with RNase L and TTP constructs and then serum-starved (DMEM + 0.05% FBS) for 20 h; at 24 h after transfection, medium was exchanged with DMEM containing 10% FBS and 200 nm TPA for 1 h and then cells were washed with ice-cold PBS and harvested. Anti-IgG1, anti-Myc tag, or anti-FLAG antibodies were used to immunoprecipitate the respective proteins.

Cell Proliferation Assay

MEF WT and KO RNase L cells were seeded into 96-well plates at 5000 cells per well, allowed to attach for 18 h, and then serum-starved for 20 h in DMEM containing 0.5% FBS. Cells were then treated with 200 nm TPA and restored DMEM containing 10% FBS for 1 h. Viable cells were quantified by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay (Promega). Values from each time point were normalized to serum-starved or time 0 values. Each value is a mean of 4–6 identical wells ± S.D.

Data Analysis and Statistics

Values of data points in figures are the mean of at least three measurements ± S.D. unless otherwise indicated in the legend. p values given were determined by the unpaired t test. Differences yielding p < 0.05 were considered significant. Qualitative analyses shown (i.e. WB and IP) are representative of three independent experiments.

RESULTS

RNase L Regulates TTP by Distinct Mechanisms in Resting and Mitogen-stimulated Conditions

ZNF36/TTP was originally discovered as a mitogen-induced transcript (8, 9), and subsequent studies have demonstrated that it is also induced in response to diverse stress stimuli, including proinflammatory cytokines (73–75) and microbial pathogens (7, 65). In stimulated conditions, TTP is rapidly induced in parallel with immediate early genes and functions in a feedback loop to attenuate expression of stimulus-induced transcripts (59, 76). TTP expression and activity are tightly controlled by transcriptional and post-transcriptional mechanisms (7, 77), and RNase L was recently reported to contribute to this regulation (23). In light of the established antiproliferative activities of both RNase L and TTP, we hypothesized that RNase L-mediated regulation of TTP may be important in the context of mitogen stimulation that is relevant to their biologic roles as endogenous constraints on cell proliferation. To test this hypothesis, mouse embryonic fibroblasts (MEFs) derived from knock-out (KO; RNase L^−/−) and wild type (WT; RNase L^+/+) mice (25) were cultured in 0.5% serum for 20 h (serum starvation) and then treated with 10% serum, 200 nm 12-O-tetradecanoylphorbol-13-acetate (TPA) to induce proliferation. This regimen of combining serum with a phorbol ester mitogen is a well established system to study mitogen-induced gene expression that results in a robust induction of TTP and is referred to as “mitogen stimulation” in the subsequent text (78, 79). Mitogen stimulation resulted in a rapid induction of steady-state TTP mRNA in WT cells that was increased 8–9-fold over unstimulated cells by 1 h post-stimulation and returned to basal levels by 4 h (Fig. 1A). Strikingly, although the kinetics of TTP mRNA induction in KO MEFs paralleled those in WT MEFs, the magnitude of TTP mRNA induction in KO MEFs was much greater than that observed in WT MEFs, increasing 49-fold over its expression in unstimulated cells at 1 h post-stimulation (Fig. 1A). These findings demonstrate an important role for RNase L in the regulation of mitogen-induced TTP expression.

FIGURE 1.

RNase L regulates TTP mRNA in basal and mitogen-stimulated conditions. A, steady-state TTP mRNA in WT and RNase L KO MEFs was measured after mitogenic stimulation for the indicated times by qRT-PCR. Bars represent the mean ± S.D. of five independent experiments normalized to HPRT mRNA. Induced values are relative to expression in unstimulated conditions, which was set to 1 for each cell type.*, p < 0.05; **, p < 0.01. B, steady-state RNase L and TTP mRNA levels in HeLa cells stably transfected with control vector (SNAP) or epitope-tagged RNase L expression vector (SNAP-RNase L). Bars represent the mean ± S.D. of three independent experiments normalized to HPRT mRNA. C, TTP mRNA decay kinetics were measured by actD time courses in WT and RNase L KO MEFs in resting (unstimulated) conditions. TTP mRNA half-lives were calculated from four independent experiments, and representative data points from one experiment are shown (mean ± S.D. of three independent samples). D, presence of TTP mRNA in a complex with RNase L was analyzed by RNP-IP. RNase L was IP from HeLa cells stably transfected with control vector (SNAP) or epitope-tagged RNase L expression vector (SNAP-RNase L) in resting (rest) and 1-h mitogen-induced (ind) conditions, and RNA was isolated. IP with IgG was included as a control to detect nonspecific interaction with the antibody. TTP and control HPRT mRNAs in the IP complex were measured by qRT-PCR and normalized to PGK1 mRNA. Bars represent mean ± S.D. of three independent experiments. E, TTP mRNA decay kinetics were measured by actD time courses in WT and RNase L KO MEFs at 1 -h post-mitogen stimulation. TTP mRNA half-lives were calculated from at least six independent experiments, and representative data points from one experiment are shown (mean ± S.D. of three independent samples) (p < 0.01).

RNase L-dependent regulation of gene expression may occur via direct cleavage of target RNAs or via indirect mechanisms that are downstream of the primary substrate. To investigate the mechanism by which RNase L down-regulates TTP, we determined whether RNase L directly targets TTP mRNA to decrease its half-life. Analysis of TTP mRNA turnover following inhibition of transcription by ActD revealed a significant stabilization of TTP mRNA in RNase L KO as compared with WT MEFs in unstimulated conditions (Fig. 1C). In further support of the direct targeting of TTP mRNA by RNase L, TTP mRNA associated with RNase L in transfected cells as analyzed by RNP-IP (Fig. 1D). Specifically, TTP mRNA was enriched in RNP complexes isolated with RNase L but not isotype control antibody. In contrast, similar amounts of the abundant HPRT mRNA were present in both RNase L and IgG IP complexes and served as a control for equivalent RNP precipitation and RNA yield in the different samples. In further support of this regulation, ectopic expression of RNase L in HeLa cells, which express low endogenous RNase L (23), resulted in a reduction in TTP mRNA (Fig. 1B). These findings indicate that RNase L directly targets the TTP transcript in basal conditions in agreement with a previous report (23). To determine whether RNase L-mediated destabilization of TTP mRNA could account for the increase in steady-state TTP transcript observed in mitogen-stimulated MEFs, we determined the TTP mRNA half-life in WT and RNase L KO MEFs at 1 h post-mitogen stimulation when TTP induction was maximal. However, TTP mRNA did not exhibit RNase L-dependent destabilization in mitogen-stimulated conditions. In contrast, TTP mRNA half-life increased from 20 min in RNase L KO MEFs to 1.2 h in WT MEFs following serum stimulation (Fig. 1E). This discordance between the steady-state expression of TTP mRNA and its half-life may reflect an enhanced autoregulation by TTP of its own mRNA turnover via an RNase L-independent mechanism (47, 48). Most strikingly, our results indicate that mitogen stimulation resulted in a dramatic 6-fold increase in steady-state TTP mRNA in RNase L KO as compared with WT MEFs despite a decrease in its half-life. These findings suggested that the regulation of TTP by RNase L in mitogen-stimulated conditions occurs through an indirect mechanism to down-regulate TTP transcription.

RNase L Down-regulates Mitogen-induced TTP Transcription via Direct Regulation of SRF

To investigate the impact of RNase L on TTP transcription as a potential mechanism by which it down-regulates steady-state TTP mRNA following mitogen stimulation, unprocessed TTP transcripts were measured using primers that detect the single TTP intron as an indication of TTP transcriptional activity (80). Similar to the enhanced induction of steady-state TTP mRNA levels in RNase L KO MEFs, TTP primary transcripts were also increased in RNase L KO as compared with WT MEFs at 1 h of mitogen stimulation and were elevated at all post-stimulation time points (Fig. 2A). This result demonstrated the RNase L-dependent down-regulation of TTP transcription (81, 82) in mitogen-stimulated MEFs and suggested that RNase L directly targets a transcription factor that mediates TTP induction by mitogens. Consistent with this model, SRF is a master transcriptional regulator of serum-induced genes that was previously reported to be regulated by RNase L in IFNγ-stimulated smooth muscle cells (66). Furthermore, analysis of the ZFP36/TTP gene promoter revealed a serum-response element, the site at which SRF binds to induce transcription of mitogen-induced genes, at positions −281 to >264 relative to the ZFP36/TTP transcription start site (83). Additionally, TTP was identified in a genomic screen for actin-MAL-SRF-induced genes in NIH3T3 fibroblasts (84). Based on these findings, we hypothesized that RNase L directly targets SRF mRNA to limit the induction of TTP and potentially other serum-induced transcripts, following mitogen stimulation. Consistent with this prediction, steady-state SRF mRNA was induced to a higher level following mitogen stimulation of RNase L KO as compared with WT MEFs (Fig. 2B). SRF mediates transcriptional induction in a complex with co-factors, including the ternary complex factors (82, 83); however, only SRF exhibited RNase L-dependent regulation demonstrating the selective targeting of SRF mRNA in mitogen-stimulated conditions (data not shown). The RNase L-dependent expression profiles of SRF and TTP in response to mitogen were similar and support our model in which RNase L directly regulates SRF upstream of its indirect effect on TTP mRNA. Analysis of SRF mRNA stability revealed that its half-life was increased 2-fold in RNase L KO as compared with WT MEFs following mitogen stimulation as predicted for a direct RNase L target (Fig. 2C). RNase L-dependent regulation of SRF mRNA was also observed in unstimulated cells (data not shown), and SRF mRNA was present in an RNP-IP complex with RNase L that increased in response to mitogen stimulation (Fig. 2D). Together, these data identify SRF mRNA as a direct target of RNase L regulation and provide a potential mechanism by which it regulates TTP transcription in mitogen-stimulated conditions. However, we cannot rule out an alternative indirect impact of SRF on TTP expression at this time.

FIGURE 2.

RNase L directly regulates SRF mRNA to down-regulate TTP transcription following mitogen stimulation. A, TTP primary transcripts were measured at the indicated times post-mitogen stimulation of WT and RNase L KO MEFs by qRT-PCR using intronic primers to detect unspliced transcripts. Bars represent the mean ± S.D. of four independent experiments normalized to HPRT mRNA. B, SRF mRNA was measured at the indicated times post-mitogen stimulation of WT and RNase L KO MEFs by qRT-PCR. Bars represent the mean ± S.D. of five independent experiments normalized to HPRT mRNA. C, SRF mRNA decay kinetics were measured by actD time courses in WT and RNase L KO MEFs at 1-h post-mitogen stimulation. SRF mRNA half-lives and S.D. shown were calculated from the indicated number of independent experiments; representative data from one experiment are shown (mean ± S.D. of three independent samples) (p < 0.001). D, presence of SRF mRNA in a complex with RNase L was analyzed by RNP-IP as described in Fig. 1C. Bars represent mean ± S.D. of three independent experiments; *, p < 0.05.

RNase L and TTP Proteins Functionally Interact to Target SRF mRNA Turnover

The RNase L-dependent regulation of SRF mRNA stability and the physical association of SRF mRNA and RNase L protein provide evidence that SRF mRNA is an authentic RNase L substrate. However, the mechanism by which SRF mRNA, and other candidate RNase L substrates, is targeted for cleavage is not known. We previously determined that RNase L and TTP proteins associate in cells suggesting that TTP may function to recruit RNase L to its substrates, including SRF mRNA. To further examine the RNase L-TTP interaction and its functional impact on SRF mRNA turnover, we first mapped domains required for their association in cells. Amino- and carboxyl-terminal deletions of RNase L were expressed with full-length TTP in cells, and their association was analyzed by co-immunoprecipitation (68). This analysis indicated that deletion constructs that remove the amino-terminal 342 amino acids precipitated with TTP in proportion to their level of expression and were thus dispensable for TTP interaction (Fig. 3A). However, deletion of the carboxyl-terminal 399 amino acids abrogated RNase L co-immunoprecipitation with TTP indicating that amino acids 343–662 of the pseudokinase domain were required for TTP interaction (Fig. 3A). Interestingly, the pseudokinase domain is also required for RNase L dimerization (39) suggesting that it serves as an important platform for RNase L-protein interactions. A complementary analysis of TTP deletion mutants revealed that no single deletion abolished immunoprecipitation with full-length RNase L and that the 77-amino acid RNA-binding domain constituted a minimal interaction region (Fig. 3B). This finding suggested that multiple TTP domains contribute to its association with RNase L; however, further mapping is required to precisely define the interacting region. The low basal expression of RNase L and TTP and the lack of antisera that efficiently immunoprecipitate these proteins precluded analysis of an interaction between both endogenous proteins; therefore, we assessed the ability of transfected RNase L or TTP to co-IP with endogenous TTP and RNase L, respectively. This approach demonstrated an interaction of either ectopically expressed component of this complex with their respective endogenous partner, providing further support for their interaction in cells (Fig. 3C). Together, these results identify TTP as a novel component of an RNase L-associated complex in cells and provide a potential mechanism for RNase L-substrate targeting.

FIGURE 3.

RNase L and TTP co-immunoprecipitate in a complex from transfected cells. A, Myc-RNase L deletion constructs (top panel) and full-length FLAG-TTP were transfected into 293T cells. Myc-RNase L proteins present in a FLAG-TTP IP complex were isolated at 24 h post-transfection and measured by WB (lower panel; expression in 1/10 of input is shown below the IP). B, GFP-TTP deletion constructs (top panel) and full-length FLAG-RNase L were transfected into 293T cells. GFP-TTP proteins present in a FLAG-RNase L IP complex were isolated at 24 h post-transfection and measured by WB (lower panel; expression in 1/10 of input is shown below the IP). C, FLAG-TTP (left panel) or myc-RNase L (right panel) was transfected into 293T cells, and an antibody to the transfected protein was used for IP. The presence of endogenous RNase L or TTP in the IP complex was measured by WB. KEN, kinase extension nuclease domain; FL, full length; Nd, NH₂-terminal amino acids deleted; Cd, COOH-terminal amino acids deleted; NTD, NH₂-terminal domain; RBD, RNA binding domain; CTD, COOH-terminal domain.

We hypothesized that TTP recruits RNase L to cleave TTP-bound substrate RNAs. Therefore, in light of our data indicating that SRF mRNA is an RNase L substrate (Fig. 2) and that RNase L and TTP proteins form a complex in cells (Fig. 1D), we predicted that TTP will interact with SRF mRNA. Indeed, TTP formed an RNP-IP complex with SRF mRNA in cells (Fig. 4A). Consistent with the identification of SRF mRNA as a novel TTP target, a consensus ARE (UUAUUUAUU) TTP-binding sequence was identified at bases 1929–1937 in the 3′UTR of SRF mRNA (85). In our model of TTP-mediated RNase L substrate targeting, RNase L and TTP function in concert to direct the degradation of SRF mRNA. As shown previously in Fig. 2C, deletion of RNase L stabilized SRF mRNA; therefore, we hypothesized that a similar increase in SRF mRNA half-life will be observed in cells lacking TTP. To test this prediction, we analyzed the turnover of SRF mRNA in MEFs derived from WT and TTP KO mice. SRF mRNA half-life increased from 1.3 h in WT MEFs to 3.1 h in TTP KO MEFs (Fig. 4B) and closely matched its stabilization in RNase L KO MEFs (Fig. 2C). Thus, consistent with our model, deletion of either RNase L or TTP resulted in a comparable increase in SRF mRNA half-life, identifying SRF as a novel target of regulation by RNase L and TTP.

FIGURE 4.

SRF mRNA is a novel target of TTP regulation. A, presence of SRF mRNA in a complex with TTP was analyzed by RNP-IP in resting cells (rest) and at 1-h post-mitogen stimulation (ind) as described in Fig. 1C. IP with IgG is included as a control to detect nonspecific interaction with the antibody. Bars represent mean ± S.D. of three independent experiments. B, SRF mRNA decay kinetics were measured by actD time courses in WT and TTP KO MEFs at 1-h post-mitogen stimulation. SRF mRNA half-lives and S.D. shown were calculated from the indicated numbers of independent experiments, and representative data from one experiment are shown (mean ± S.D. of three independent samples) (p < 0.01).

RNase L and TTP Function to Down-regulate the Expression of Mitogen-induced Transcripts and Attenuate the Proliferative Response

In response to mitogen stimulation, SRF induces the transcription of many immediate early genes to promote cell proliferation (81, 82). TTP is also induced by mitogens and functions to attenuate the expression of a subset of mitogen-induced ARE-containing transcripts (64, 65). Our data suggest that RNase L functions in association with TTP to degrade SRF mRNA providing a mechanism to limit SRF-induced transcription. In addition, we hypothesized that RNase L, via its association with TTP, may act to post-transcriptionally down-regulate a subset of TTP target mRNAs. To test this hypothesis, we examined a panel of established TTP target mRNAs for RNase L-dependent regulation. Specifically, Cox-2 (58), vascular endothelial growth factor (VEGF) (86, 87), TNF-α (67, 74), and cyclin-dependent kinase inhibitor 1 (p21CIP) (23) mRNAs were expressed to higher levels in RNase L KO as compared with WT MEFs following mitogen stimulation (Fig. 5A). However, IL-1β (88), HIF1-α (89), and PIM-1 (59) transcripts that are also known TTP target mRNAs (7, 64) were not significantly affected by RNase L deficiency (Fig. 5B). These findings indicate that RNase L regulates a subset of TTP target mRNAs and suggest that additional components of an RNase L-TTP mRNA protein complex or sequence determinants on mRNA targets may contribute to substrate selection (Table 2). RNase L thus functions to limit the expression of mitogen-induced mRNAs via transcriptional and post-transcriptional mechanisms which, in turn, may contribute to its antiproliferative activity. Consistent with this prediction, RNase L KO MEFs displayed a more robust proliferative response to mitogen stimulation as compared with that observed in WT MEFs (Fig. 5C). Together, our findings support a model in which RNase L and TTP function in concert to regulate mitogen-induced transcripts and attenuate the proliferative response.

FIGURE 5.

RNase L regulates a subset of TTP targets and reduces the proliferative response in mitogen-stimulated cells. Steady-state mRNA expression of Cox-2, TNF-α, VEGF, and cyclin-dependent kinase inhibitor 1 mRNAs (A) or HIF-1α, PIM-1, and IL-1β mRNAs (B) was measured by qRT-PCR in WT and RNase L KO MEFs at the indicated times post-mitogen stimulation. Bars represent the mean ± S.D. of three independent experiments normalized to HPRT mRNA. C, proliferation of WT and RNase L KO MEFs was determined by measuring the viable cells (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay) at the indicated times after mitogenic stimulation. Each point represents the mean ± S.D. of three independent experiments.

TABLE 2.

Shared targets of SRF, TTP, and RNase L

The abbreviations used are as follows: V = validated target; P = predicted target, X = not a validated or predicted target.

SRF target	TTP target	RNase-L target
SRF (104)	Va	Va
TTP (83, 84)	V (47, 48)	Va (23)
MyoD (85)	V (105)	V (12, 106)
Cox-2 (107)	V (101)	P (108)
IL-6 (107)	V (109)	P (108)
Cyr61 (95)	Pb	P (12)
Slc2a1 (110)	Pb	P (43)
Ereg (95)	Pb	P (43)
Klf6 (111)	Pb	P (12)
cFos (112)	V (113)	X
p21CIP (114)	V (23)	X
Tera (94)	V (115)	X
Junb (95)	V (116)	X

^a This was validated in this study.

^b Predicted TTP target was based on minimum consensus TTP target sequences of UAUUUAU (117).

DISCUSSION

The cellular response to mitogenic stimulation must be tightly regulated to prevent the deleterious effects of uncontrolled proliferation. Therefore, understanding the mechanisms by which this response is regulated is essential to identify therapeutic targets for neoplastic disorders. RNase L functions as an endogenous proliferative constraint (23–26), and TTP is induced by mitogenic stimulation as a feedback mechanism to attenuate the proliferative response (76, 90). In light of recent findings demonstrating the regulation of TTP mRNA by RNase L (23), and the interaction of RNase L and TTP proteins (45), we sought to investigate the RNase L-mediated regulation of TTP following mitogen stimulation that is relevant to their roles as antiproliferative effectors and to their mechanisms of action in the post-transcriptional control of target mRNA turnover. Mitogen treatment of RNase L KO MEFs resulted in a striking 6-fold increased induction of TTP mRNA as compared with that observed in WT MEFs (Fig. 1A). Although RNase L-dependent TTP mRNA decay has been previously reported (23), the increase in steady-state TTP mRNA following mitogen stimulation did not reflect a stabilization of TTP mRNA but corresponded with an increase in TTP transcription (Fig. 2A). This finding indicated that RNase L regulated TTP by distinct direct and indirect mechanisms in resting and mitogen-stimulated conditions, respectively, and suggested that RNase L targeted a mitogen-induced regulator of TTP transcription.

SRF is a master transcriptional regulator of serum-induced genes (81, 82, 91), and RNase L was previously reported to regulate SRF in IFNγ-treated smooth muscle cells (66). Furthermore, an SRF-binding site was identified in the ZFP36 gene promoter (84, 85). These findings suggested that RNase L may down-regulate SRF mRNA to inhibit mitogen-induced transcription of TTP. Consistent with this hypothesis, the magnitude of SRF mRNA induction was higher in RNase L KO as compared with WT MEFs (Fig. 2B). Moreover, RNase L deficiency-stabilized SRF mRNA and SRF mRNA was enriched in RNase L immunoprecipitates indicating that it is an authentic RNase L substrate (Fig. 2, C and D). Interestingly, a recent study demonstrated that the induction of type 1 IFN-stimulated genes was diminished in SRF-deficient macrophages thus identifying a novel role for SRF in IFN signaling (92). In light of the established role of RNase L as an IFN-regulated effector, and our data identifying SRF mRNA as an RNase L target, RNase L-mediated down-regulation of SRF may serve as a feedback mechanism to attenuate expression of IFN-stimulated genes. As TTP is also induced by IFN (75), RNase L and TTP may serve analogous functions to limit the expression of transcripts induced by mitogens and IFN. This broader role for RNase L and TTP as feedback inhibitors of transcripts induced by diverse stimuli is the subject of ongoing investigation. Our results thus identified SRF as a novel RNase L substrate and provided a mechanism by which it may indirectly impact the expression of mitogen-induced transcripts, including TTP.

RNase L-dependent regulation of SRF mRNA occurred in the absence of global changes in mRNA turnover; however, the mechanism(s) by which it selectively targeted the SRF transcript are not known. Considering our previous data indicating that RNase L associated with TTP in cells (45), and published studies demonstrating that TTP autoregulates its own mRNA (47, 48), we hypothesized that interaction with TTP may recruit RNase L to specific mRNAs as a mechanism of substrate targeting. To further study this interaction, we used deletion mapping to identify the pseudokinase domain of RNase L as a region that is required for TTP interaction (Fig. 3). The analysis of RNase L and TTP protein interaction was done by immunoprecipitation to assess their association in a cellular context; however, further studies using recombinant proteins are required to determine whether the interaction is direct. Interestingly, the RNase L pseudokinase domain is critical for coordinating 2–5A binding (39, 40) and homodimerization (33, 34) that occur upon its activation. Furthermore, the ATP competitive kinase inhibitor sunitinib was recently shown to bind the ATP pocket within this domain and inhibit RNase L activation (93). Together, these studies establish a central role for the pseudokinase domain in RNase L activation and suggest that heterologous proteins that interact in this domain may positively or negatively impact RNase L activity as a novel mechanism to modulate its biologic functions. Future studies to determine the specific residues involved in these interactions, and their biophysical properties in the presence and absence of 2–5A, will provide insights into the mechanisms regulating RNase L activity. In this regard, recent crystal structures of RNase L suggest that multiple residues in the pseudokinase domain are exposed in the active dimeric conformation and may constitute a critical platform for regulatory interactions (39, 40). Current modeling studies with RNase L and TTP will permit informed mutagenesis to test this hypothesis.

The interaction of RNase L with TTP and the identification of a consensus ARE TTP-binding site in the SRF mRNA 3′UTR suggested that the SRF transcript may be regulated by the coordinate action of RNase L and TTP. Consistent with this prediction, SRF mRNA was stabilized to a nearly identical degree in MEFs lacking either RNase L or TTP (Figs. 2C and 4B); furthermore, both RNase L and TTP formed a complex with SRF mRNA in cells (Figs. 2D and 4A). The direct regulation of SRF by RNase L and TTP was, in turn, predicted to indirectly impact the transcription of SRF-induced genes. In fact, a meta-analysis of SRF-regulated genes from four studies (94–97) revealed that 84% of their encoded transcripts contained an ARE (Table 2) (85). This frequency of ARE-containing mRNAs represents a 12-fold enrichment over their occurrence in the global mRNA population (∼7% ARE-positive (98)) and suggests that ARE-mediated regulation is important for SRF-induced genes. Notably, 50% of the ARE-positive SRF-regulated transcripts are validated TTP targets or contain a consensus TTP-binding site. These data point to a central role for TTP, as opposed to other ARE-binding proteins, in control of the SRF transcriptome. In support of our model in which a subset of SRF mRNA and SRF-induced transcripts are regulated by the concerted action of RNase L and TTP (Fig. 6), 16% of the SRF-regulated transcripts that contain a consensus TTP-binding site or are validated targets are also predicted or validated RNase L substrates (Table 2). Consistent with this analysis, four of seven established TTP targets tested were regulated by RNase L in mitogen-stimulated MEFs (Fig. 5, A and B). Together, these data indicate that the regulation of mitogen-induced transcripts by RNase L and TTP can occur through both transcriptional and post-transcriptional mechanisms. Accordingly, the extent to which one or both of these mechanisms function to regulate a given transcript will dictate its specific pattern of expression following mitogen stimulation. Indeed, two distinct expression profiles were observed for the TTP targets that we determined to be regulated by RNase L. Specifically, although steady-state expression of Cox2 and VEGF mRNAs continued to increase through 8 h post-mitogen stimulation (Fig. 5A), SRF, TNFα, and cyclin-dependent kinase inhibitor 1 mRNAs peaked at 1–2 h after mitogen stimulation and then declined (Fig. 5B). As all of these transcripts are also SRF targets, failure to either attenuate transcription and/or increase turnover may account for the dysregulation observed in RNase L KO MEFs. Future studies will focus on identifying the direct targets of RNase L cleavage within the population of RNase L-regulated transcripts to define the cis- and trans-acting factors that mediate substrate recognition.

FIGURE 6.

Model depicting the roles of RNase L and TTP in regulating mitogen-induced gene expression to attenuate a proliferative response. In WT cells (left panel), mitogen stimulation (1) induces the transcription of SRF-regulated genes that function in feedback regulation (2a) and induce proliferation (2b). RNase L and TTP function to down-regulate SRF-induced transcription (3a) and destabilize proliferation-stimulatory transcripts (3b) to attenuate the proliferative response (4). In the absence of RNase L (right panel), mRNAs encoding a subset of proliferation-stimulatory gene products, including SRF, are stabilized resulting in dysregulated proliferation. TTP targets regulated independently of RNase L (e.g. HIF-1α, PIM-1) are unaffected in RNase L-deficient cells. TTP autoregulation occurs by alternative mechanisms in the absence of RNase L. Mitogen-induced phosphorylation and activation of SRF protein are not shown.

Our analysis (Table 2 and Fig. 5) and microarray data (12, 17, 42–44) indicated that only a subset of TTP targets exhibit RNase L-dependent regulation (45). This lack of complete correspondence between RNase L-regulated transcripts and TTP targets suggests that these transcripts are regulated by different mechanisms in distinct physiologic settings. Our data on TTP regulation in the presence and absence of mitogen stimulation provide an example of this context-specific regulation. Specifically, RNase L-deficiency stabilizes TTP mRNA in unstimulated cells, whereas the TTP transcript is destabilized following mitogen stimulation of RNase L KO MEFs (compare B and D in Fig. 1). These distinct outcomes may reflect mitogen-induced changes in TTP activity and a corresponding impact on its autoregulation (23, 99). In addition, alternative decay mechanisms mediated by distinct factors may contribute to the differential regulation observed in these settings. In agreement with this prediction, TTP interacts with established RNA decay enzymes to promote deadenylation and mRNA turnover (e.g. Ccr4/Caf1/Not1 (52, 53)) that may represent a default mechanism when RNase L is not expressed. In addition, the interaction of TTP and AUF1 was recently shown to influence target RNA selection (100) providing further evidence that the combination of RNABPs and decay factors present in different conditions are likely to influence TTP-directed mRNA degradation. Our results support a model in which RNase L functions in a complex with TTP to regulate a subset of mitogen-induced transcripts (Fig. 6). A global comparison of transcripts and proteins bound to both RNase L and TTP will provide a more complete picture of the factors that mediate RNase L substrate targeting in the context of mitogen stimulation.

RNase L mediates diverse antiproliferative activities, including quiescence (11), senescence (24), and apoptosis (25, 26). Our results demonstrated that RNase L down-regulates mitogen-induced gene expression via transcriptional and post-transcriptional mechanisms suggesting that it plays a functional role to attenuate the proliferative response. Consistent with this prediction, proliferation was significantly increased following mitogen stimulation of RNase L KO as compared with WT MEFs (Fig. 5C). The enhanced proliferation observed in mitogen-stimulated RNase L KO MEFs corresponded with increased expression of TTP. This phenotype was unexpected as TTP expression is typically associated with antiproliferative activities (6, 13). These data suggested that elevated TTP expression in the absence of RNase L was insufficient to attenuate a proliferative response; however, the activity of TTP in this setting remains to be examined. For example, post-translational modifications and interacting proteins that impact the stability and RNA binding activity of TTP protein in response to inflammatory stimuli are well established (7, 99) and similar regulation may occur following mitogen treatment. In addition, little is known about the regulation of RNase L activity beyond its requirement for conversion to an enzymatically active dimer, as sensitive methods to detect its activity in cells are lacking. Given the critical nature of rapid induction and efficient attenuation in the physiologic outcome of a mitogenic response, the temporal regulation of RNase L and TTP activities is likely to be particularly important and represents a key area for future investigation.

Taken together, our study identifies an important role for RNase L in attenuating the mitogenic response through the transcriptional and post-transcriptional regulation of TTP and SRF. The physical association of RNase L with TTP in cells, and its regulation of a subset of established TTP target mRNAs, supports a model in which the interaction of RNase L with TTP, and possibly other RNABPs, dictates its substrate profile and hence biologic activity. Accordingly, this regulation and its associated impact on mitogen-induced proliferation are reduced in RNase L-deficient cells (Fig. 6). Both RNase L and TTP mediate antiproliferative and tumor suppressor activities (6, 7, 20, 23–26, 64); accordingly, genetic disruption or inactivating mutations in either protein lead to a transformed phenotype in vitro and tumorigenesis in vivo (27, 28, 101). Furthermore, mutations in RNase L and TTP are correlated with poor prognosis in several human cancers (6, 29–32, 102). Increased proliferative signaling is an established hallmark of cancer (103), and our data identify RNase L and TTP as endogenous constraints on the proliferative response; therefore, strategies to enhance the activities of RNase L and TTP represent a potential therapeutic approach for proliferative disorders.