Gene Cluster Responsible for Secretion of and Immunity to Multiple Bacteriocins, the NKR-5-3 Enterocins

Abstract

Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter.

INTRODUCTION

Bacteriocins are ribosomally synthesized antimicrobial peptides that have bactericidal or bacteriostatic effects (1). Bacteriocin production has been observed in numerous species of lactic acid bacteria (LAB). Although Klaenhammer (1) and Nes et al. (2) previously classified LAB bacteriocins into three main groups, a new classification scheme for bacteriocins has been recently suggested by Cotter et al. (3). Class I bacteriocins, the so-called lantibiotics, contain unusual residues caused by amino acid posttranslational modification (4). Class II bacteriocins, the nonlantibiotic bacteriocins, are further divided into four subgroups. Class IIa consists of pediocin-like bacteriocins with strong antilisterial effects and a conserved N-terminal YGNGVXC consensus motif in the mature peptide (5, 6). Class IIb is made up of two peptides, both of which are required for full antimicrobial activity (7, 8). Class IIc consists of circular bacteriocins with a head-to-tail linkage (9), and class IId contains single-peptide, nonpediocin linear bacteriocins.

The gene cluster involved in the biosynthesis of class II bacteriocins consists of genes that encode a bacteriocin precursor peptide, an immunity protein, a dedicated ATP-binding cassette (ABC) transporter, and an accessory protein required for proper bacteriocin externalization (2). Specifically, ABC transporters have two characteristic functions in bacteriocin biosynthesis, namely, processing of the leader peptide in the bacteriocin precursor by the peptidase domain of the N-terminal region and ATP-dependent peptide translocation by the ATP-binding domain of the C-terminal region (2). ABC transporters for single-bacteriocin secretion were well characterized and demonstrated, which showed that the “single” bacteriocins are secreted by respective dedicated ABC transporters (10–12). In contrast, ABC transporters for multiple bacteriocins were identified on the basis of sequence similarity but have not been characterized and their functions have not yet been demonstrated. An additional biosynthetic event of consequence is the self-immunity conferred by producer strains. Class IIa bacteriocin producer strains have specific cytoplasmic immunity proteins. In general, class IIa bacteriocins attack a specific receptor that is a component of the mannose phosphotransferase system permease (EII^Man) (13–15). Therefore, the immunity proteins are presumed to act by binding to the cytoplasmic side of the receptor, preventing the receptor from interacting with active bacteriocin peptides (16, 17). In the case of class IIb bacteriocins, an immunity protein localized on the cell membrane is thought to protect against an attack by their own two-peptide bacteriocin (18, 19). Although some immunity proteins for class IIc and IId bacteriocins have been identified, their mechanisms have not been completely characterized. The production of most class II bacteriocins is regulated by a three-component regulatory system (TCS) comprising a secreted inducing peptide, a histidine kinase (HK), and a response regulator (RR) (2, 20, 21). The genes that encode these regulatory proteins are normally organized within a gene cluster containing several other bacteriocin biosynthetic genes.

Previous studies have described multiple-bacteriocin production by single LAB strains like those belonging to the genera Lactobacillus (21, 22), Enterococcus (23, 24), and Leuconostoc (25, 26). For example, Enterococcus faecium L50 produces three bacteriocins, enterocins L50, P, and Q (27). In general, each bacteriocin has a unique antimicrobial spectrum and strength of antimicrobial activity. Therefore, these multiple-bacteriocin-producing LAB strains are regarded as potentially useful in the control of various bacteria. For instance, they are considered to be useful antimicrobial starter cultures for food preservation (28–30). However, in multiple bacteriocins, biosynthetic mechanisms such as secretion and immunity have not been deeply understood and the information is quite limited.

E. faecium NKR-5-3 is a multiple-bacteriocin-producing LAB strain isolated from Thai fermented fish and is known to produce five bacteriocins termed enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z) (31). Except for Ent53B, the structural genes and amino acid sequences of these bacteriocins have been identified (31, 32). Ent53A and Ent53Z, components of a class IIb bacteriocin, show synergistic antimicrobial activity. Ent53C is a novel class IIa bacteriocin that contains a YGNVL motif sequence and two disulfide bridges. Ent53D, a class IId bacteriocin, shows high identity to an inducing peptide (IP-TX) produced by Lactobacillus sakei 5 (22). In addition, it has been demonstrated that the bacteriocin productivity of the strain is influenced by culture conditions like incubation temperatures and Ent53D (31, 33). Nevertheless, the DNA sequence information for strain NKR-5-3 was quite limited, and the biosynthetic mechanisms of the bacteriocins have not been unraveled.

In this study, the NKR-5-3 enterocin gene cluster was identified and the DNA sequences around each structural gene were determined by using the strain NKR-5-3 genome library. In addition, a variety of heterologous expression and genetic disruption experiments were performed to evaluate the genetic requirement for the biosynthesis of NKR-5-3 enterocins.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. E. faecium NKR-5-3 was cultivated in M17 medium (Merck, Darmstadt, Germany) at 30°C for 24 h. Bacteriocin producer strains E. faecium JCM 5804^T, Pediococcus pentosaceus TISTR 536, and Leuconostoc pseudomesenteroides QU 15 were cultivated in MRS broth (Oxoid, Basingstoke, United Kingdom) at 30°C, and Brochothrix campestris NBRC 15547^T (= ATCC 43754) was cultivated in APT broth (BD, Sparks, MD) at 30°C. While indicator strain E. faecalis JCM 5803^T was cultivated in MRS broth at 37°C, the other indicators, Bacillus subtilis JCM 1465^T and Listeria innocua ATCC 33090^T, were cultivated in tryptic soy broth (BD) supplemented with 0.6% yeast extract (Nacalai Tesque, Kyoto, Japan) (TSBYE) at 30 and 37°C, respectively. Escherichia coli was cultivated in Luria-Bertani (LB) broth at 37°C, while E. faecalis JH2-2 and Lactococcus lactis NZ9000 were cultivated in M17 medium with 0.5% glucose (GM17; Nacalai Tesque) at 30°C. Agar media were prepared by adding 1.5% (wt/vol) agar to liquid broth media. Lactobacilli Agar AOAC (LAA; BD) was used as an overlay agar medium for antimicrobial activity assays. The antibiotics used in the selective media were added at the following concentrations: ampicillin (Amp; Nacalai Tesque), 100 μg ml⁻¹; chloramphenicol (Cm; Wako, Osaka, Japan), 12.5 μg ml⁻¹ (E. coli EPI-300), 30 μg ml⁻¹ (E. coli DH5α), or 10 μg ml⁻¹ (E. faecalis JH2-2 and L. lactis NZ9000); erythromycin (Em; Sigma-Aldrich, St. Louis, MO), 100 μg ml⁻¹ (E. coli) or 25 μg ml⁻¹ (E. faecium NKR-5-3).

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Description (bacteriocin classification)	Source and/or reference
Strains
E. faecium
NKR-5-3	Producer of NKR-5-3 enterocins	31
ΔenkT	enkT knockout mutant strain of NKR-5-3; Emra	This study
ΔenkRK	enkR and enkK knockout mutant strain of NKR-5-3; Emr	This study
JCM 5804T	Producer of enterocins A (IIa) and B (IId)	JCM,d 24
E. faecalis
JH2-2	Cloning host	48
JCM 5803T	Indicator sensitive to enterocins NKR-5-3	JCM
Bacillus subtilis JCM 1465T	Indicator sensitive to enterocin NKR-5-3B only	JCM
Listeria innocua ATCC 33090T	Indicator sensitive to enterocins NKR-5-3	ATCCe
Brochothrix campestris NBRC 15547T (= ATCC 43754)	Producer of brochocin C (IIb)	NBRC,f 41, 49
Pediococcus pentosaceus TISTR 536	Producer of pediocin PA-1 (IIa)	50
Leuconostoc pseudomesenteroides QU 15	Producer of leucocins A (IIa), N (IId), and Q (IId)	26
Lactococcus lactis NZ9000	Plasmid-free derivative of L. lactis subsp. cremoris MG1363; pepN::nisRK	51
Escherichia coli
DH5α	supE44 ΔlacU169 hsdR17 recA1 endA1 gyrA96 thi-1 relA1	Promega
EPI-300	Cloning host for genome library	Epicentre
Plasmids
pCC1FOS	Copy control fosmid vecter; Cmrb	Epicentre
pGEM-T	Cloning vector; lacZ Amprc	Promega
pG-TEm	Plasmid for enkT knockout cloned into pGEM-T; Emr Ampr	This study
pG-RKEm	Plasmid for enkR and enkK knockout cloned into pGEM-T; Emr Ampr	This study
pMG36c	Lactococcal expression vector; Cmr	52
pNK-T	pMG36c containing enkT	This study
pNK-TAZI	pNK-T containing enkA, enkZ, and enkIaz	This study
pNK-TAI	pNK-T containing enkA and enkIaz	This study
pNK-TCI	pNK-T containing enkC and enkIc	This study
pNK-TD	pNK-T containing enkD	This study
pNK-TZI	pNK-T containing enkZ and enkIaz	This study
pNK-AZI	pMG36c containing enkA, enkZ, and enkIaz	This study
pNK-AI	pMG36c containing enkA and enkIaz	This study
pNK-CI	pMG36c containing enkC and enkIc	This study
pNK-D	pMG36c containing enkD	This study
pNK-ZI	pMG36c containing enkZ and enkIaz	This study
pNK-IAZ	pMG36c containing enkIaz	This study
pNK-IC	pMG36c containing enkIc	This study

^aEm^r, Em resistance.

^bCm^r, Cm resistance.

^cAmp^r, Amp resistance.

^dJCM, Japan Collection of Microorganisms (Wako, Japan).

^eATCC, American Type Culture Collection (Manassas, VA).

^fNBRC, National Institute of Technology and Evaluation Biological Resource Center (Chiba, Japan).

Screening of the NKR-5-3 enterocin gene locus with a genome library.

Total DNA was extracted from E. faecium NKR-5-3 as previously described (31, 34). The fosmid library was constructed with the CopyControl Fosmid Library Production kit (Epicentre, Madison, WI) according to the manufacturer's instructions. Briefly, the DNA was treated enzymatically to repair the ends and make blunt them, and the DNA fragments (33 to 48 kb) were then ligated into the fosmid vector (CopyControl pCC1FOS; Epicentre) with T4 DNA ligase (TaKaRa, Shiga, Japan). The resulting plasmids were packaged in lambda phage by an in vitro packaging system with MaxPlax Lambda Packaging Extract (Epicentre), which was termed NKR-5-3 phage library solution (phage solution). One microliter of the phage solution was added to a culture (100 μl, optical density at 600 nm of 0.7) of E. coli EPI-300 (Epicentre) cultivated in LB broth with 1 M MgSO₄ (Sigma-Aldrich) and 20% (wt/vol) maltose (Nacalai Tesque) and then incubated at 37°C. After 1 h, it was plated on LB agar medium with 12.5 μg ml⁻¹ of Cm and the colonies generated, termed the NKR-5-3 genome library, were used for colony PCR with the respective primers, to obtain the positive colonies with NKR-5-3 enterocin structural genes enkA (ent53A), enkC (ent53C), and enkD (ent53D). Taq DNA polymerase was used for colony PCR according to the standard protocol (35). Positive colonies were cultivated in LB broth with 12.5 μg ml⁻¹ of Cm, and plasmid extraction was carried out with the Exprep Plasmid SV minikit (GeneAll Biotechnology, Seoul, South Korea). The plasmids were sequenced, and custom sequencing primers were used for primer walking when necessary.

Plasmids construction for heterologous expression.

The plasmids and primers used in this study are listed in Tables 1 and 2, respectively, and molecular cloning was performed as described by Sambrook and Russell (35). KOD-Plus-Ver.2 polymerase (Toyobo, Osaka, Japan) and Quick Taq HS polymerase (Toyobo) were used for PCR and colony PCR, respectively, and DNA fragments were purified with Expin PCR SV (GeneAll Biotechnology). Bacteriocin structural, immunity, and transporter genes were amplified individually with specific primers (Table 2). The splicing by overhang extension (SOEing) PCR technique was used to fuse PCR products (36). Fused PCR products containing one or two structural genes, enkA and/or enkZ, and a respective immunity gene (except for enkD) downstream of enkT were ligated into the PstI (Roche, Basel, Switzerland) and SphI (Roche) sites downstream of the P₃₂ promoter in pMG36c, and the resulting plasmids were termed pNK-TAZI, pNK-TCI, and pNK-TD. pNK-AZI, pNK-CI, and pNK-D were constructed from pNK-TAZI, pNK-TCI, and pNK-TD, respectively, by inverse PCR and subsequent self-ligation of the PstI restriction site to delete enkT. Plasmids pNK-TAI and pNK-TZI were constructed from pNK-TAZI, and plasmids pNK-AI and pNK-ZI were constructed from pNK-AZI by inverse PCR. These plasmids were first cloned into E. coli DH5α and then transferred into L. lactis NZ9000. To characterize the immunity genes, plasmids pNK-I_AZ and pNK-I_C lacking the respective structural genes were constructed from pNK-AZI and pNK-CI, respectively, by inverse PCR and then introduced into E. faecalis JH2-2.

TABLE 2.

Primers used in this study

Primer	Nucleotide sequence (5′–3′)a	Purpose
enkT-F1	TTAAGCGCTGCAGAAGGTGTAG	Amplification of enkT
enkT-R1	AACAAGGATCCATAAAAATAGGCAGGGTGTTTAAAGCAATC	Amplification of enkT
enkT-R2	GCAGGGTGTTTAAAGCATGCTAT	Amplification of enkT
enkAZI-F-OR	TATTTTTATGGATCCTTGTTTGAGAGGGAGTTTTATTATGC	Amplification of enkA, -Z, and -Iaz
enkAZI-R	CAATACAAATCCATGATGCATGCT	Amplification of enkA, -Z, and -Iaz
enkCI-F-OR	TATTTTTATGGATCCTTGTTGTATCGCTAGCTTAAAAGTG	Amplification of enkC and -Ic
enkCI-R	CTTCAGTTCTTAACCGCATGCTTT	Amplification of enkC and -Ic
enkD-F-OR	TATTTTTATGGATCCTTGTTATCAATTAGAAGGAGAGTGG	Amplification of enkD
enkD-R	TTCTGCATGCTTCTCTCTCCAC	Amplification of enkD
Em-F	AAGAGTGTGTTGATAGTGCAG	Amplification of Emr gene
Em-R	CTTGGAAGCTGTCAGTAGTAT	Amplification of Emr gene

^aRestriction enzyme (PstI [CTGCAG] or SphI [GCTGC]) cleavage sites are in italics. Overlap regions (ORs) for SOEing PCR are underlined.

Partial purification of bacteriocins from transformants.

Transformants containing individual plasmids (Table 1) were cultivated in 100 ml of GM17 at 30°C for 18 h. Bacteriocins in the cell-free culture supernatants were partially purified with Amberlite XAD-16 (Sigma-Aldrich) as previously described (31). The active eluted fraction was subjected to rotary evaporation to remove isopropanol, followed by complete solvent removal by lyophilization. The resulting powder was dissolved in MilliQ water with 10% (vol/vol) dimethyl sulfoxide (Nacalai Tesque), and this partially purified solution was used as a working sample.

Bacteriocin activity assays.

Bacteriocin activities in culture supernatants and the partially purified solutions were determined by the agar well diffusion assay (37) or the spot-on-lawn assay (38). The agar well diffusion assay was performed as follows. A 50-μl volume of the partially purified solution was added to wells (8 mm in diameter) in 15 ml of MRS broth with 0.8% agar inoculated with 150 μl of the culture of an indicator strain, E. faecalis JCM 5803^T. After overnight incubation, the inhibition zones generated were checked for antimicrobial activity. In contrast, the spot-on-lawn assay was performed as follows. Ten-microliter volumes of 2-fold dilutions of a bacteriocin preparation were spotted onto a double layer consisting of 10 ml of LAA inoculated with 50 μl of culture of an indicator strain (10⁷ CFU ml⁻¹) as the upper layer and 10 ml of MRS as the bottom layer. After overnight incubation, the bacterial lawns were checked for inhibition zones. The activity titer, expressed in arbitrary activity units (AUs) per milliliter of bacteriocin preparation, was defined as the reciprocal of the highest dilution causing a clear zone of growth inhibition in the indicator lawn. E. faecalis JCM 5803^T, B. subtilis JCM 1465^T, and L. innocua ATCC 33090^T were used as indicator strains for the spot-on-lawn assay.

Construction of ΔenkT and ΔenkRK mutant strains of E. faecium NKR-5-3.

The plasmids used to construct knockout mutant strains were prepared with the pGEM-T vector (Promega, Madison, WI). The fragments of enkT and enkRK were amplified with their respective primers and ligated into the pGEM-T vector. Subsequently, these genes were partially replaced with the Em^r gene amplified from pGh9:ISSI (39) by inverse PCR. The resulting plasmids were cloned into E. coli DH5α and termed pG-TEm and pG-RKEm, respectively. enkT and enkRK mutant strains were constructed by double crossover (40), which replaced the Em^r gene with the target gene in the plasmids. E. faecium NKR-5-3 containing pG-TEm or pG-RKEm was cultivated for 48 to 72 h at 30°C in GM17 with 25 μg ml⁻¹ of Em. ΔenkT and ΔenkRK mutant strains were selected by colony PCR.

ESI-LC/MS analysis.

E. faecium NKR-5-3 (wild-type) and ΔenkT mutant strains were cultivated in 10 ml of M17 medium at 30°C for 24 h. Bacteriocins in the cell-free culture supernatants were partially purified by the procedure described above. These partially purified solutions were used as working solutions for liquid chromatography-mass spectrometry (LC/MS) analysis to confirm bacteriocin production. LC/MS analysis was conducted with the Agilent 1100 high-performance liquid chromatography system (Agilent Technologies, Palo Alto, CA) equipped with a JMS-T100LC (JEOL, Tokyo, Japan) electrospray ionization (ESI) time of flight mass spectrometer according to previously described methods, with minor modifications (33). A styrene divinyl benzene copolymer analytical column (150 by 2.1 mm; 5-μm particle size; Varian Inc., Shropshire, United Kingdom) was used for chromatographic separation at 30°C.

Immunity assay.

Immunity was determined by the agar well diffusion assay against target strain E. faecalis JH2-2 containing pNK-I_AZ or pNK-I_C. These transformants were cultivated in GM17 with 0.8% agar and 10 μg ml⁻¹ of Cm and then exposed to 50 μl of the partially purified solution containing Ent53A-Ent53Z or Ent53C. The culture supernatants of P. pentosaceus TISTR 536 (pediocin PA-1 producer strain), E. faecium JCM 5804^T (enterocin A and B producer strain), and B. campestris NBRC 15547^T (brochocin C producer strain) were used for the (cross) immunity assay with E. faecalis JH2-2 containing pNK-I_AZ or pNK-I_C. Leucocin A purified from L. pseudomesenteroides QU 15 (26) was also used for this assay.

Bacteriocin induction assay.

Bacteriocin induction assay of the wild-type and ΔenkRK mutant strains was performed by the previously described method (31). Briefly, the TSBYE culture inoculated with 1% of the preculture of strain NKR-5-3 was incubated at 30°C and 0.23 μM purified Ent53D was added to the culture 4 h after inoculation. The bacteriocin activity in the culture supernatant obtained after 24 h of incubation postinoculation was assayed by the spot-on-lawn method with the indicator strains E. faecalis JCM 5803^T, B. subtilis JCM 1465^T, and Listeria innocua ATCC 33090^T. The TSBYE culture without addition of Ent53D was used as a negative control.

DNA sequencing and computer analysis of DNA sequence.

The sequences of plasmids were confirmed by DNA sequencing carried out by FASMAC Co. Ltd. (Kanagawa, Japan). The DNA sequences obtained were analyzed with the GENETYX-WIN software ver. 8.0.1 (GENETYX, Tokyo, Japan), and database searching was conducted with NCBI BLAST (http://www.ncbi.nlm.nih.gov/).

Nucleotide sequence accession number.

All DNA sequences were deposited in GenBank under accession number AB908994.

RESULTS

DNA sequence analysis and database searching.

Three positive colonies containing enkC and -D and one positive colony containing enkA, -C, and -D were obtained from the NKR-5-3 genome library (a total of about 800 colonies) by colony PCR (data not shown). Following plasmid extraction from the latter positive colony, the DNA sequences around the enkA, -C, and -D genes were determined by primer walking. Since enkZ was found to be situated downstream of enkA, the DNA sequence of the gene cluster termed the enterocin NKR-5-3ACDZ (Ent53ACDZ) gene cluster was determined (approximately 13 kb in length), and its map is illustrated in Fig. 1. Genes responsible for production of the other bacteriocins, including Ent53B, were not found around this cluster. Therefore, it was inferred that the Ent53B gene cluster is located at least 20 to 35 kb away from the Ent53ACDZ gene cluster, since each plasmid of the NKR-5-3 genome library contains 33- to 48-kb-long DNA fragments. A database analysis of the open reading frames (ORFs) obtained was used to predict their functions, which are listed in Table 3. The putative bacteriocin immunity genes termed enkIaz (for Ent53A-Ent53Z) and enkIc (for Ent53C) were found downstream of enkZ and enkC and showed 71% identity to brcI of Brochothrix campestris ATCC 43754 (41) and 63% identity to dvnI of Carnobacterium divergens V41 (42, 43), respectively. However, no putative bacteriocin immunity gene for Ent53D was identified at this locus. The ORFs around enkD share substantial identity with members of the sakacin TX gene cluster in Lactobacillus sakei 5 (22). enkR, enkK, and enkT showed 96, 94, and 95% identities to stxR (RR), stxK (HK), and stxT (ABC transporter), respectively. In the N-terminal region of EnkT encoded by enkT, a putative peptidase domain was identified. In addition, while ORF7 showed 98% identity to sakI_T, which encodes the immunity protein for sakacin T, no sakacin T-like bacteriocins were found in strain NKR-5-3. Although some additional ORFs, such as ORF1, ORF10, and ORF11, were found in this gene cluster, database search results suggested that they are not associated with bacteriocin biosynthesis.

FIG 1.

Schematic representation of the enterocin NKR-5-3ACDZ gene cluster. A total of 14 identified ORFs are depicted. The structural and immunity genes for NKR-5-3 enterocins are indicated by black and gray arrows, respectively. Putative sections proposed to be involved in regulation and secretion are indicated by double-pointed arrows.

TABLE 3.

Characteristics of ORFs in the Ent53ACDZ gene cluster and the surrounding region

Gene and/or ORF	Protein size (amino acids)	% gene identity	% protein identity	Proposed function	Identificationa	Accession no.b
ORF1	304	67	65	Autolysin	Cell wall autolysin of E. faecium DO	AAAK03000009
ORF2	172	65	61	Transport accessory protein	AvcD of E. avium XA83	FJ851402.1
enkD (ORF3)	45	94	91	Inducing peptide (bacteriocin)	StxP of L. sakei 5	AY206863
enkR (ORF4)	252	96	95	RR	StxR of L. sakei 5	AY206863
enkK (ORF5)	437	94	92	HK	StxK of L. sakei 5	AY206863
enkT (ORF6)	723	95	95	ABC transporter	StxT of L. sakei 5	AY206863
ORF7	112	98	98	Bacteriocin immunity protein	SakIT of L. sakei 5	AY206863
enkC (ORF8)	61	67	58	Bacteriocin	DvnV41 of C. divergens V41	AJ224003
enkIc (ORF9)	105	63	61	Bacteriocin immunity protein	DvnI of C. divergens V41	AJ224003
ORF10	72	61	57	Unknown	Hypothetical protein of E. faecalis TX0104	NZ_GG668931
ORF11	341	64	57	Peptidase	Peptidase of S41 family of E. faecalis TX1467	GL884092
enkIaz (ORF12)	52	71	58	Bacteriocin immunity protein	BrcI of B. campestris ATCC 43754	AF075600
enkZ (ORF13)	60	80	87	Bacteriocin	BrcB of B. campestris ATCC 43754	AF075600
enkA (ORF14)	77	83	90	Bacteriocin	BrcA of B. campestris ATCC 43754	AF075600

^aOnly the best matches are shown.

^bAccession number of the sequence deposited in the GenBank database.

Identification of ABC transporter for NKR-5-3 enterocins.

The plasmids containing the structural genes and the respective immunity genes with and without enkT were introduced into a heterologous host strain, L. lactis NZ9000, and the resulting transformants were assayed for antimicrobial activity. While transformants with enkT, containing pNK-TAZI, pNK-TAI, pNK-TZI, and pNK-TCI, showed antimicrobial activity (Fig. 2), those lacking enkT, containing pNK-AZI, pNK-AI, pNK-ZI, and pNK-CI, showed no such activity. These results indicated that Ent53A, Ent53Z, and Ent53C were secreted by EnkT. In contrast, secretion of Ent53D by the transformants containing pNK-TD or pNK-D was not confirmed by the antimicrobial-activity assay since the concentration of Ent53D in the solution was not enough for its antimicrobial activity against the indicator strain (Fig. 2). However, Ent53D was detected in the partially purified solution from culture supernatant of the transformant containing pNK-TD but not from pNK-D, as found by ESI-LC/MS analysis (data not shown). On the other hand, the ΔenkT mutant strain did not secrete Ent53A, Ent53C, or Ent53D, indicating that Ent53D was also secreted by EnkT (Fig. 3). Ent53Z was not detected in either the wild-type or the ΔenkT mutant strain, as the detection of Ent53Z by LC/MS has not been optimized (33). Moreover, Ent53B was still found to be produced by the ΔenkT mutant strain (Fig. 3). Transcription of the structural genes and enkRK was also confirmed in the ΔenkT mutant strain (data not shown).

FIG 2.

Antimicrobial activity assays with partially purified solutions from the culture supernatants of transformants. Inserts containing the bacteriocin structural and immunity genes with (a) and without (b) enkT were ligated downstream of the P₃₂ promoter in pMG36c, and the resulting plasmids were cloned into L. lactis NZ9000. Their antimicrobial activities were evaluated by agar well diffusion assays with partially purified solutions from culture supernatants of the transformants. Synergistic-activity assays for transformants containing pNK-TAI, pNK-TZI, pNK-AI, and pNK-ZI were performed. E. faecalis JCM 5803^T was used as the indicator strain.

FIG 3.

Mass chromatograms of the partially purified solutions from culture supernatants of wild-type and ΔenkT mutant strains. Selected ion chromatograms of enterocins NKR-5-3A, -B, -C, and -D (Ent53A, -B, -C, and -D) are shown. The partially purified solutions from the culture supernatants of the wild-type (a) and ΔenkT mutant (b) strains were analyzed by LC/MS. Respective dominant ion species (m/z) are indicated. Specific peaks of individual bacteriocins are indicated by vertical arrows.

Characterization of immunity proteins for enterocins NKR-5-3A, -C, and -Z.

Putative immunity genes enkIaz and enkIc were found in the Ent53ACDZ gene cluster. In order to characterize their functions, an immunity assay was performed with the transformants containing pNK-I_AZ or pNK-I_C in E. faecalis JH2-2. Consequently, the transformants expressing enkIaz or enkIc were found to possess self-immunity to Ent53A-Ent53Z or Ent53C, respectively (Fig. 4). However, these transformants did not show cross-immunity to each other. When cross-immunity to other bacteriocins was evaluated, enkIaz showed cross-immunity to brochocin C, which consists of brochocins A (100% identical to Ent53A) and B (95.3% identical to Ent53Z), and is produced by B. campestris. In addition, enkIc showed cross-immunity to enterocin A (55.8% identical to Ent53C) and enterocin B (class IId bacteriocin) produced by E. faecium JCM 5804^T. However, enkIc did not show cross-immunity to pediocin PA-1 (32.6% identical to Ent53C) and leucocin A (23.3% identical to Ent53C).

FIG 4.

Immunity assays of E. faecalis JH2-2 transformants expressing enkIaz or enkIc. Transformants containing pMG36c (36c), pNK-I_AZ (I_AZ), and pNK-I_C (I_C) were cultivated in GM17 with Cm. These transformants were exposed to enterocins NKR-5-3AZ (Ent53AZ), enterocin NKR-5-3C (Ent53C), brochocin C (BrcC), enterocin A (EntA), enterocin B (EntB), pediocin PA-1 (PA-1), and leucocin A (LeuA) and evaluated for self- and cross-immunity. In addition, assays of self- and cross-immunity to their own bacteriocins, Ent53AZ and -C (a), assays of I_AZ cross-immunity to BrcC (b), and assays of I_C immunity to other class IIa bacteriocins (EntA, PA-1, and LeuA) and class IId bacteriocins (EntB) (c) were performed. Well diameter, 8 mm.

Identification of three-component regulatory proteins.

Putative regulatory genes enkR and enkK were found in the Ent53ACDZ gene cluster. Hence, the induction activity assay was performed with the wild-type and ΔenkRK mutant strains. Addition of Ent53D enhanced NKR-5-3 enterocin production by the wild-type, but not the ΔenkRK mutant, strain in TSBYE (Table 4). The ΔenkRK mutant strain showed activity only against B. subtilis, which is sensitive only to Ent53B among the NKR-5-3 enterocins. These results indicated that EnkR and EnkK are regulatory proteins that mediate the induction of bacteriocin production by Ent53D and that together they constitute a TCS.

TABLE 4.

Induction assay of ΔenkRK mutant strain^a

Strain (addition)	Activity (AU ml−1) in culture supernatant against:
	E. faecalisc	B. subtilisd	L. innocuae
WT	0	400	0
WT (Ent53D)b	6,400	400	3,200
ΔenkRK	0	400	0
ΔenkRK (Ent53D)b	0	400	0

^aAll strains were cultured in TSBYE at 30°C for 24 h. WT, wild type; ΔenkRK, ΔenkRK mutant. Data are mean results of three independent experiments.

^bPurified Ent53D was added at 0.23 μM to the culture after 4 h of inoculation.

^cE. faecalis JCM 5803^T.

^dB. subtilis JCM1465^T (sensitive only to Ent53B).

^eL. innocua ATCC 33090^T.

DISCUSSION

In this study, the sequence of the Ent53ACDZ gene cluster was determined with an NKR-5-3 genome library. The approximately 13-kb-long gene cluster involves not only the structural genes of each enterocin NKR-5-3 but also genes required for immunity, regulation, and secretion.

Although we expected that the Ent53ACDZ gene cluster would contain genes homologous to the bacteriocin gene clusters, sakacin TX (17.2 kb) (22), divercin V41 (6.0 kb) (42), and brochocin C (4.3 kb, albeit incomplete) (41), which show substantial identities with each NKR-5-3 enterocin, our results showed that this was not the case. In the Ent53ACDZ gene cluster, ORF2, enkD, enkR, enkK, enkT, and ORF7 showed high identity to the members of the sakacin TX gene cluster, while the genes corresponding to sakT_α, sakT_β, and sakX were completely absent (22). ORF7 showed 98% identity to sakI_T, which encodes the immunity protein for sakacin T consisting of sakacin Tα and Tβ, but its putative protein has no identity to those encoded by enkIaz and enkIc. On the other hand, enkC shows 67% identity to dvnV41, while enkIc, located downstream of enkC, shows 63% identity to dvnI. The cognate transporter gene (dvnT1) and regulatory genes (dvnR and dvnK) located just downstream of dvnV41 in the divercin V41 gene cluster (42, 43) are absent from the Ent53ACDZ gene cluster. Moreover, enkA and enkZ are 83 and 80% identical to brcA and brcB in the brochocin C gene cluster, respectively, but the gene corresponding to brcT, which has been partially identified, is also absent (41).

During the biosynthesis of bacteriocins, ABC transporters are employed for bacteriocin secretion. Each bacteriocin requires a dedicated ABC transporter (2). However, in the Ent53ACDZ gene cluster, only a single putative ABC transporter gene, enkT, has been identified. Heterologous expression and gene disruption experiments involving enkT showed that Ent53A, Ent53C, Ent53D, and Ent53Z are secreted by EnkT without any accessory protein. Interestingly, the precursors of Ent53A, Ent53C, Ent53D, and Ent53Z showed no similarities to each other, except for the cleavage sites and the lengths of their leader peptides (Fig. 5). These suggest that EnkT is a wide-range ABC transporter capable of secreting bacteriocins belonging to three different subclasses (IIa, IIb, and IId). Although some multiple-bacteriocin-producing strains have been identified, ABC transporters associated with the secretion of multiple bacteriocins remain uninvestigated. For example, plnG of Lactobacillus plantarum C11 (plantaricin A, EF, and JK producer) and stxT of L. sakei 5 (sakacin T, X, and P producer), which encode ABC transporters, were found in each gene cluster. However, an experimental characterization of these transporters has not been performed (22, 44). On the other hand, genes that encode accessory or supporter proteins for bacteriocin secretions are known to be located near respective transporter genes (10, 11). In the Ent53ACDZ gene cluster, ORF2 shows identity to a gene that encodes a putative accessory protein. However, ORF2 is farther away from enkT (Fig. 1 and Table 3) and is dispensable for heterologous bacteriocin secretion (Fig. 2). These data indicate that ORF2 is not necessary for the biosynthesis of Ent53ACDZ while employing EnkT as a transporter.

FIG 5.

Amino acid sequences of the precursors of enterocins NKR-5-3A, -C, -D, and -Z (EnkA, EnkC, EnkD, and EnkZ). The cleavage sites (double-glycine sites) of the leader peptides of EnkA, EnkC, EnkD, and EnkZ are indicated by the vertical arrow.

The Ent53ACDZ gene cluster contains two putative immunity genes (enkIaz and enkIc). Since the transformants expressing each gene showed self-immunity to Ent53A-Ent53Z or Ent53C, it was concluded that the enkIaz and enkIc genes are responsible for self-immunity to the respective bacteriocins. In addition, EnkIaz showed cross-immunity to brochocin C, suggesting that Ent53A and Ent53Z have properties similar to those of brochocin C. In fact, these two peptides have high sequence identity to brochocins A and B and show synergistic activities similar to those of brochocins A and B (Fig. 2, pNK-TAI and pNK-TZI) (41). EnkIc showed cross-immunity to enterocin A but not to pediocin PA-1 and leucocin A. Fimland et al. have proposed that class IIa bacteriocin immunity proteins can be divided into three groups on the basis of their amino acid sequences and that cross-immunity can occur in situations where either bacteriocins or immunity proteins belong to subgroups with similar sequences (45). As exceptional results, although immunity proteins for enterocin A, pediocin PA-1, and leucocin A belong to the same subgroup, the immunity protein (EntA-im) for enterocin A did not show cross-immunity to pediocin PA-1 and leucocin A (45). EnkIc shows 75% similarity to and belongs to the same subgroup as EntA-im. Therefore, it is reasonable that EnkIc shows no cross-immunity to pediocin PA-1 and leucocin A.

With the bacteriocin induction activity assay of the ΔenkRK mutant strain, EnkR and EnkK have been identified as regulatory proteins responsible for transcriptional induction by Ent53D as an extracellular signal. Many bacteriocin producer strains commonly utilize a TCS (2, 46). Previous reports have shown that bacteriocin production is enhanced by the interaction between an inducing peptide and a specific HK as a signal and by an RR via phosphorylation bound to particular DNA sequences upstream of some promoters. In addition, some studies have indicated that an inducing peptide regulates some promoters in a biosynthetic gene cluster (44, 47). Therefore, the TCS consisting of Ent53D, EnkR, and EnkK may potentially control many genes in the Ent53ACDZ gene cluster. In fact, Perez et al. have demonstrated that the enterocin production of strain NKR-5-3 is influenced by some culture conditions and that at least 2 nM Ent53D triggers the production of enterocins, except for Ent53B (33). Additionally, Vaughan et al. have identified the respective promoters of sakT_α, stxT, and stxP in the sakacin TX gene cluster and shown that the transcription of genes located downstream of these promoters is enhanced by IP-TX, an inducing peptide (47). These results imply that biosynthetic genes such as enkT in the Ent53ACDZ gene cluster, as well as bacteriocin structure genes, are controlled by the TCS.

In this study, we have demonstrated that the biosynthesis of Ent53ACDZ is governed by several members of the Ent53ACDZ gene cluster. We have also identified enkA, enkC, enkD, enkZ, enkIaz, enkIc, enkT, enkR, and enkK as the minimal gene sequence required for the biosynthesis of Ent53ACDZ. To our knowledge, this is the first report that demonstrates the secretion of multiple bacteriocins by a wide-range ABC transporter such as EnkT.