Suppressive Oligodeoxynucleotides Promote the Generation of Regulatory T Cells by Inhibiting STAT1 Phosphorylation

Abstract

Suppressive oligodeoxynucleotides (Sup ODN) express repetitive TTAGGG motifs that have proven useful in the treatment/prevention of numerous inflammatory and autoimmune diseases. The mechanism underlying the immunosuppressive activity of Sup ODN is incompletely understood. Regulatory T cells (T_reg) play a key role in are generated from controlling a variety of pathologic autoimmune responses. T_regs activated CD4⁺ T cells in a process that involves the phosphorylation of STAT family members. Current studies demonstrate that Sup ODN promote the differentiation of CD4⁺CD25⁻ T cells into functionally active iT_reg in vitro. When administered in vivo, Sup in response to peptide challenge. Central to this ODN promote the generation of iT_reg effect is the ability of Sup ODN to block the phosphorylation of STAT1. These findings clarify the mechanism underlying the therapeutic activity of Sup ODN and support their use in T_reg-based immunotherapy.

1 Introduction

DNA has multiple and complex effects on the immune system. Microbial DNA elicits a potent inflammatory response that helps protect the host from infection but can exacerbate autoimmune and inflammatory diseases [1]. Self DNA, in contrast, is anti-inflammatory and can down-regulate pathologic inflammatory responses [2]. The latter effect is mediated, at least in part, by repetitive TTAGGG motifs present at high frequency in mammalian telomeres. Synthetic single-stranded phosphorothioate oligodeoxynucleotides (ODN) expressing TTAGGG motifs mimic the ability of telomeric DNA to prevent/treat a variety of inflammatory and autoimmune diseases [3]. This was established in murine models of lupus, arthritis, encephalomyelitis, iritis and shock [4–7].

The mechanism underlying the anti-inflammatory properties of Sup ODN were initially attributed to their ability to inhibit the maturation of CD4⁺ T cells into Th1 effectors [7;8]. This was associated with the inhibition of STAT1 and STAT4 phosphorylation and the resultant reduction in IFNg production - a cytokine critical to the generation and maintenance of Th1 immunity. Yet those findings pre-dated the discovery of regulatory T cells (T_reg) that are now known to play a key role in restrain the host’s suppressing autoimmune and inflammatory diseases [9]. T_reg response to self Ags and thus are of enormous importance in the therapy of inflammatory/autoimmune diseases.

There are two broad categories of Tregs. nTreg arise naturally in the thymus while iTreg are induced in the periphery from CD4⁺CD25⁻ T cells [10,11]. Forkhead transcription factor (FoxP) 3 acts as the master transcriptional regulator of Treg development. Deficiency in FoxP3 results in fatal multi-organ autoimmune disease as observed in the scurfy mouse and in patients with immunodysregulation polyendocrinopathy enteropathy X-linked syndrome [10–15]. In vitro studies show that CD4⁺CD25⁻ T cells up-regulate FoxP3 and differentiate into functional iTreg when stimulated via their TCR in the presence of TGFß [16;17]. In vivo, exposure to Ag generates FoxP3⁺ iTreg in the periphery. For example, large numbers of FoxP3⁺ iTreg accumulate in the draining lymph nodes of mice carrying OVA-specific CD4 T cells following challenge with the _OVA323-339 peptide [18;19].

T_reg development is regulated by members of the STAT family. STAT5 binds to the FoxP3 promoter and drives FoxP3 transcription, thereby playing a critical role in T_reg generation [20;21]. In contrast, activation of STAT1-dependent pathways prevents FoxP3 expression and blocks T_reg development [21,22]. In murine models, unrestrained STAT1 activation results in the breakdown of immunological tolerance and culminates in Th1-mediated pathology [24]. In contrast, deletion of STAT1 promotes the T_reg expansion and reduces graft-versus-host disease [25]. These findings suggest that targeting STAT1 represents a promising strategy for therapies designed to improve T_reg generation.

Recognizing the critical contribution of T_reg to the prevention and treatment of diseases that respond to Sup ODN therapy, we evaluated whether Sup ODN might promote T_reg development. Results show that Sup ODN enhance the generation of functional FoxP3⁺ iT_reg from naïve CD4⁺ precursors in vitro. When administered in vivo, Sup ODN promote the generation of FoxP3⁺ iT_reg in response to peptide challenge. These effects are linked to the ability of Sup ODN to block STAT1 phosphorylation following the activation of CD4⁺ T cells. These findings clarify the mechanism underlying the therapeutic activity of Sup ODN in autoimmune disease and provide a rationale for the use of Sup ODN in T_reg-based immunotherapy.

2 Materials and Methods

2.1 Mice

Female BALB/c and C57BL/6 mice were bred at the National Cancer Institute (Frederick, MD), FoxP3 eGFP reporter mice were obtained from Dr. Y. Belkaid (National Institute of Allergy and Infectious Diseases, Bethesda, MD), STAT1^−/− mice from Dr. D. Levy (NYU School of Medicine, New York, NY) and Rag2^−/− DO11.10 mice from Dr. M. Leonardo (National Institute of Allergy and Infectious Diseases, Bethesda, MD)[26;27]. All mice were studied at 6 – 10 wk of age and all experiments were approved by the Institutional Animal Care and Use Committee of the National Cancer Institute at Frederick.

2.2 Oligonucleotides

Phosphorothioate ODN were synthesized at the Core Facility of the Center for Biologics Evaluation and Research facility, Food and Drug Administration (Bethesda, MD). The following ODN were used: suppressive ODN A151 (5′ TTAGGGTTAGGGTTAGGGTTAGGG 3′) and control ODN 1612 (5′ GCTAGAGCTTAGGCT 3′). All ODN were free of detectable protein and endotoxin contamination.

2.3 Isolation of murine CD4⁺CD25⁻ T cells

CD4⁺ T cells were purified from single spleen cell suspensions by negative selection using magnetic beads. These CD4⁺ cells were then incubated with PE anti-CD25 and anti-PE beads used to isolate CD4⁺CD25⁻ T cells. The purity of these T cells typically exceeded 95% and contained fewer than 2% FoxP3⁺ cells. All reagents were obtained from Miltenyi Biotec, Auburn, CA.

2.4 In vitro generation of murine iT_reg

CD4⁺CD25⁻ T cells (10⁶/ml) were pre-incubated with 1 uM ODN for 2 h and then transferred to a 96 well plate coated with 3 ug/ml anti-CD3 (2C11; eBioscience, San Diego, CA). Cells were cultured in complete medium (RPMI 1640 supplemented with 10% FCS (both from Lonza, Walkersville, MD), 2 mM glutamine, 100 IU/ml penicillin, 100 ug/ml streptomycin, 25 mM HEPES buffer (all from Invitrogen, Carlsbad, CA), 0.0035% 2 ME (Sigma Aldrich, St. Louis, MO) and stimulated with 2 ug/ml soluble anti-CD28 (37.51; eBioscience) plus 20 ng/ml human TGFb1 (R&D Systems). 20 ng/ml of IL-2 (R&D Systems) was included to support the proliferation of T_regs from C57Bl/6 mice. This supplementation was not needed for T cells from BALB/c mice which intrinsically produce sufficient IL-2 when stimulated [28]. In experiments examining whether Sup ODN influenced the differentiation of iT_reg, only 5 ng of TGFβ1 was added during culture. At the indicated time points, cells were analyzed for FoxP3 expression by flow cytometry or used in functional assays.

2.5 In vitro generation of human T_reg

PBMC were isolated by density gradient centrifugation of buffy coats obtained from normal donors through an IRB approved protocol (NIH, Bethesda, MD). CD4⁺CD25⁻ T cells were isolated by negative selection over MACS using the naive CD4⁺ T cell isolation kit II (Miltenyi Biotec, Auburn, CA). FACS analysis showed the purity of these cells was >98%. These cells were then stimulated with anti-CD3/28 coated beads plus 2.5 ng/ml TGFβ1 and 500 IU/ml IL-2 (both from eBioscience, San Diego, CA) in the presence or absence of 3 uM suppressive ODN for 5 days. FoxP3 expression was monitored using a Treg detection kit (Miltenyi Biotec (Auburn, CA).

2.6 Flow cytometry

After blocking FcR with 2.4G2 Ab, cells were stained with PerCP–Cy5.5–anti-CD4 (RM4 5), PE–anti-CD25 (PC61), PE anti-DO11.10 TCR (KJ1-26, all from BD Biosciences, San Jose, CA) and/or APC anti-FoxP3 (FJK 16s, eBioscience). Fluorescence was monitored using a LSRFortessa cell analyzer (BD Biosciences). Intracellular staining was performed with the FoxP3 staining buffer kit, according to the manufacturer’s protocol (eBioscience). Events were collected and analyzed using FlowJo software (Tree Star, Ashland, OR).

2.7 RNA Isolation and Quantitative Real time PCR

Total RNA was isolated from T cells using the RNeasy Mini Kit (Quiagen, Valencia, CA). cDNA was synthesized with a QuantiTect Reverse Transcription kit according to the manufacturer’s instructions (Applied Biosystems, Carlsbad, CA). Gene expression levels (normalized to GAPDH) were analyzed using the StepOnePlus RT PCR system and all reagents were from(Applied Biosystems).

2.8 T_reg suppression assay

CD4⁺ T cells from FoxP3 eGFP reporter mice were isolated using a FACSAria II (BD Biosciences) and cultured in the presence of Sup ODN under T_reg polarizing conditions as described above. These FACS sorted CD4⁺CD25⁻ T cells were >97% pure. On day 3, T_reg that had matured in vitro were isolated by FACS based on their up-regulation of GFP. Simultaneously, naïve CD4⁺CD25⁻ responders (T_resp) were isolated from congenic C57BL/6 spleens and stained with 2.5 μM cell trace violet (Invitrogen, Carslbad, CA). 10⁵ T_resp were stimulated with 0.25 μg/mL soluble anti-CD3 Ab and then mixed with mitomycin C inactivated syngeneic T cell depleted splenocytes (5 × 10⁴) in 96 well round bottom plates for 3 days. T_reg generated in the presence of Sup ODN were added at the indicated ratios. Proliferation was measured by monitoring cell trace violet dilution by flow cytometry. The proliferation of stimulated T_resp was set to 100% and the percent suppression observed following the addition of T_reg calculated.

2.9 In vivo generation of iT_reg

CD4⁺CD25⁻ T cells were isolated from the spleens of Rag2^−/− DO11.10 mice and stained with 5 μM CFSE (Invitrogen, Carslbad, CA) for 5 min at RT. 3 × 10⁶ cells were injected i.v. into BALB/c mice. 24 hr later, these mice were immunized i.v. with 5 μg of OVA_323-339 peptide (Gift from Dr. A. Hurwitz, National Cancer Institute, Frederick, MD). Sup ODN (300 ug/mouse) was injected i.p. 3 h before OVA administration. Four days later, cells were isolated from axillary, brachial and inguinal lymph nodes, stained for expression of CD4, FoxP3, and the DO11.10 TCR and analyzed by flow cytometry as described above.

2.10 Flow cytometric analysis of phospho-STAT expression

CD4⁺CD25⁻ T cells were cultured under T_reg polarizing conditions ± 1 uM Sup ODN. Cells were fixed with BD Lyse/Fix Buffer for 10 min at 37° C, washed, permeabilized in ice cold BD Perm Buffer III for 30 min and then stained with PE anti-STAT1 (pY701) or PE anti-STAT4 (pY693) Ab (all reagents from BD Biosciences) for 30 min at RT. Flow cytometric analysis was performed on a LSRFortessa cell analyzer.

2.11 Statistical analysis

Statistical analyses were performed using GraphPad Prism 5 (GraphPad Software, La Jolla, CA). Student’s t test was used to examine all results. p values <0.05 were considered to be statistically significant.

3. Results

3.1 Suppressive ODN enhance the generation of murine and human T_reg in vitro

The ability of Sup ODN to reduce the duration and strength of inflammatory and autoimmune diseases [3] led us to examine their effect on the generation of T_reg. To enable the detection of either a positive or negative effect of Sup ODN on T_reg differentiation, splenic CD4⁺CD25⁻ precursors were incubated in vitro under conditions that induced a significant but suboptimal increase in iT_reg frequency. These ‘suboptimal’ conditions involved conventional stimulation with anti-CD3 plus anti-CD28 Abs but lower concentrations of TGFβ (see section 2.8).

As seen in Fig 1, ≈1% of CD4⁺CD25⁻ T cells differentiated into iT_reg when incubated for 3 – 5 days in medium alone. The frequency of iT_reg increased 5-fold when conditions supporting the suboptimal generation of T_reg were used during culture (p < 0.01). Of importance, >35% of cultured cells differentiated into CD4⁺CD25⁺FoxP3⁺ T cells under the same conditions when supplemented with Sup ODN (p < 0.001). This effect was sequence specific, as control ODN lacking suppressive TTAGGG motifs had no significant effect on iT_reg generation (Fig 1). Sup ODN increased both the percentage and absolute number of iT_reg generated in vitro (Fig 1C), a finding confirmed by the increase in FoxP3 mRNA levels detected by RT PCR (Fig 1D; p < 0.05). To determine whether Sup ODN had an effect on nTregs, CFSE-labeled CD4⁺CD25⁺ T cells were incubated with IL-2 and the proliferation of FoxP3⁺ cells monitored by flow cytometry. The inclusion of Sup ODN had no effect on the proliferation of CD4⁺FoxP3⁺ Tregs (Supplemental Fig 1). These data indicate that Sup ODN selectively facilitate the differentiation of naive T cells into iTregs.

Figure 1. Suppressive ODN promote the generation of iT_reg in vitro.

CD4⁺CD25⁻ T cells were isolated from female BALB/c mice by negative selection. They were incubated for 2 h with 1 uM of suppressive or control ODN and then cultured under T_reg polarizing conditions (3 ug/ml of anti-CD3, 2 ug/ml of anti-CD28 and 5 ng/ml of TGFβ) for 5 days. iT_reg were identified based on their expression of CD4 and FoxP3 by flow cytometry. B, C) Combined results from 4 independent experiments showing the frequency and absolute number of CD4⁺ FoxP3⁺ T_reg (mean + SE) generated by each type of treatment over 3–5 days. (D) mRNA was isolated after 5 days of culture and analyzed for FoxP3 gene expression by RT PCR. Relative mRNA levels were calculated by comparison to cells cultured under the same conditions in the absence of ODN. Results from each group were normalized to GAPDH mRNA levels. Each bar represents the mean + SE of 3 independent experiments.

*, p<0.05; **, p<0.01; ***, p<0.001

To examine whether results from these murine studies were relevant to humans, the effect of Sup ODN on the generation of human iT_regs was examined. CD4⁺CD25⁻ T cells were isolated from the peripheral blood of normal healthy volunteers. These were stimulated with IL-2, anti-CD3 and anti-CD28 plus a suboptimal amount of TGFβ1 (identified in preliminary studies). After 5 days, cells were analyzed for FoxP3 expression by FACS. As seen in Fig 2, the inclusion of Sup ODN led to a significant increase in both the percentage and absolute number of human CD4⁺CD25⁺FoxP3⁺ T cells generated in vitro (p < 0.05 and p < 0.01 respectively)

Figure 2. Suppressive ODN promote the generation of human iT_reg in vitro.

CD4⁺CD25⁻ T cells were isolated from normal healthy volunteers (N=3) and incubated for 2 h with 3 uM of suppressive ODN in medium supplemented with IL-2, anti-CD3/CD28 and TGFβ1 as described in the methods section. The cells were stained to detect expression of CD4 and FoxP3 and analyzed by FACS on day 5. Each donor was analyzed independently on a different day and results show the mean + SD of all samples.

*, p<0.05; **, p<0.01

3.2 iT_reg functional activity

Further study focused on the activity of the murine iT_regs generated in the presence of Sup ODN. To eliminate any possibility that mature T_reg were contaminating the CD4⁺CD25⁻ T cell pool, FoxP3 GFP knock-in mice were used as cell donors [26]. All T_reg from these animals are GFP⁺, so FACS isolation of CD4⁺GFP⁻ T cells insures that no T_reg are present in the starting population. The cells were then cultured under the T_reg polarizing conditions described above. Consistent with results obtained above using cells from WT mice (Fig 1), the addition of Sup ODN resulted in a >4-fold increase the frequency of CD4⁺GFP⁺FoxP3⁺ T_reg generated (from 3.1 ± 0.4 ×10⁵ to 12.8 ± 1.3 ×10⁵).

The functional activity of these iTreg was evaluated based their ability to inhibit the proliferation of activated T cells. Consistent with previous reports, T_reg suppressed the proliferation of syngeneic T cells in a dose dependent manner (Fig 3 and [29]). The suppressive activity of the T_reg generated in the presence of Sup ODN was nearly identical to that of control T_reg on a per cell basis (Fig 3). These findings indicate that Sup ODN promote the generation of functionally active iT_reg.

Figure 3. Suppressive ODN enhance the generation of functional iT_reg.

CD4⁺FoxP3⁻ T cells were FACS isolated from the spleen of FoxP3 GFP knock-in mice and induced to differentiate under T_reg polarizing conditions for 3 days as described in Fig 1. The CD4⁺ FoxP3⁺ T_reg generated in vitro were purified and mixed with CD4⁺CD25⁻ responders (T_resp) labeled with cell trace violet and stimulated with anti-CD3 plus mitomycin C treated APCs. A) Absolute number of iT_reg generated. B) Effect of T_reg on the proliferation of activated T_resp at a 1 : 1 ratio. C) Effect of T_reg frequency on the proliferation of T_resp. All data represent the mean of two independent experiments using T_reg generated in the presence or absence of Sup ODN. *, p<0.05.

3.3 Suppressive ODN promote the generation of T_reg in vivo

To determine whether Sup ODN support the generation of T_reg under physiologically relevant conditions, a well established murine model of peripheral tolerance was used [18]. CD4⁺CD25⁻ T cells were isolated from Rag2 KO donors expressing the DO11.10 TCR (such T cells are specific for OVA). These T cells were labeled with CSFE and transferred into WT recipients. The recipients were then injected with soluble OVA_323-339 peptide and the CFSE-labeled FoxP3⁺ cells monitored. Consistent with previous findings, CD4⁺CD25⁻ T cells from Rag2 KO / DO11.10 donors differentiated into iT_reg when exposed to OVA peptide in vivo (Fig 4 [19;30]). When the recipient mice were treated with Sup ODN, the number of T_reg generated rose by >3-fold (from 4.8 ± 1.1 ×10³ to 15.7 ± 3.9 ×10³, p < 0.05).

Figure 4. Suppressive ODN increase the number of Ag-specific iT_reg generated in vivo.

FoxP3⁻ T cells were isolated from Rag2^−/− / DO11.10 mice, labeled with CSFE, and injected i.v. into syngeneic BALB/c mice. Recipients were treated on day 1 with 5 ug of OVA_323-339 peptide ± 300 ug of Sup ODN. On day 5, peripheral lymph nodes were isolated and FACS analyzed for the presence of CFSE⁺ donor cells. A) The percent of transferred cells maturing into FoxP3⁺ T_reg in vivo and B) the absolute number of T_reg (defined as CD4⁺ FoxP3⁺CFSE⁺KJ1-26⁺ cells). Data represent the mean + SD of three independent experiments involving 4 independently studied mice/group.

*, p<0.05

3.4 Role of STAT1 in the generation of iT_reg by Sup ODN

Previous studies established that i) Sup ODN can bind to and prevent the phosphorylation of STAT1 and STAT4 in Th1 cells [8] and ii) the phosphorylation of STAT1 and STAT4 can inhibit T_reg generation [22]. These observations led us to examine the effect of Sup ODN on STAT phosphorylation in CD4⁺CD25⁻ T cells. In the absence of stimulation, STAT phosphorylation was nearly undetectable (Fig 5A). When CD4⁺CD25⁻ T cells were cultured under suboptimal T_reg polarizing conditions, the phosphorylation of STAT1 and STAT4 rose rapidly to 45% and 85%, respectively (Fig 5A, B). The addition of Sup ODN reduced the phosphorylation of STAT1 in these cells by >75% (p <0.05) but had no effect on the phosphorylation of STAT4 (Fig 4A, B). This effect of Sup ODN was sequence specific as control ODN did not significantly alter STAT phosphorylation.

Figure 5. Effect of Suppressive ODN on STAT 1 phosphorylation and iT_reg generation.

A,B) CD4⁺CD25⁻ T cells from BALB/c mice were induced to differentiate under T_reg polarizing conditions as described in Fig 1. The level of STAT1 and STAT4 phosphorylation was determined by flow cytometry using phospho-specific Abs at 4 h (A). The mean + SE level of STAT phosphorylation from 4 independent experiments (B). C,D) CD4⁺CD25⁻ T cells from C57Bl/6 or STAT1-deficient C57Bl/6 mice were induced to differentiate under T_reg polarizing conditions. T_reg were identified on day 3 on the basis of CD4 and FoxP3 expression (C). The fold increase in CD4⁺ FoxP3⁺ T_reg frequency was calculated by comparison to cells from WT mice cultured under optimized conditions but in the absence of Sup ODN (D). Data represent the mean + SE of 3 independent experiments. **, p<0.01

To explore whether the inhibition of STAT1 phosphorylation represented the mechanism by which Sup ODN promoted the generation of iT_reg, the response of T cells from WT and STAT1-deficient mice was compared [27]. When CD4⁺CD25⁻ T cells were cultured under identical conditions, ≈ 2.5-fold more iT_reg were generated from STAT1-deficient vs WT donors (Fig 5C,D; p < 0.01). Adding Sup ODN to these cultures increased the frequency of T_reg generated from WT precursors to that observed in the STAT1 KOs (Fig 5C,D; p < 0.01). Consistent with the inhibition of STAT1 phosphorylation being the mechanism by which Sup ODN support the generation of T_reg, Sup ODN did not further boost the generation of T_reg from targets deficient in STAT1.

4. Conclusions

One attractive strategy for treating autoimmune and inflammatory diseases is to capable of down-regulating these pathological immune responses. This provide T_reg study examines the effect of synthetic ODN expressing immunosuppressive TTAGGG motifs on iT_reg generation. Results indicate that Sup ODN promote the differentiation of both human and murine CD4⁺CD25⁻ T cells into functionally active iT_reg under conditions in which either TGFβ or IL-2 is limiting (Figs 1–4). Evidence that Sup ODN inhibits the STAT1 phosphorylation of activated T cells provides insight into the mechanism underlying this effect (Fig 5).

Sup ODN contain multiple TTAGGG motifs identical to those found at high frequency in mammalian telomeres and mimic the ability of telomeric DNA to reduce inflammation and autoimmune reactions [5;6;31–33]. Previous studies found that Sup ODN inhibited the differentiation of naive CD4⁺ cells into Th1 effectors [7;8]. That effect was postulated to explain their therapeutic utility [8] as the importance of T_reg in modulating immune activation and suppressing pathological immune responses had not yet been discovered. Current findings establish that in addition to altering the balance between Th1, Th2 and Th17 [7;8;34] cells that Sup ODN also promote the differentiation of CD4⁺CD25⁻ T cells into iT_reg.

Naive CD4⁺ T cells can differentiate into a diverse array of effector phenotypes under appropriate conditions [35]. For example, CD4 T cells in a pro-inflammatory environment differentiate into Th17 cells when exposed to TGFβ while the same cells exposed to TGFβ in the absence of inflammatory cytokines differentiate into T_reg [36]. Our group recently showed that the addition of Sup ODN to CD4 T cells facilitated their maturation into Th17 cells under pro-inflammatory Th17 polarizing conditions [34]. Results from the current work show that adding Sup ODN to the same cells in the absence of pro-inflammatory cytokines induces them to differentiate into T_reg. From this we conclude that similar to TGFβ, the effect of Sup ODN on CD4 T cell generation is context-dependent.

Previous work established that Sup ODN were useful in the treatment of various autoimmune diseases [4–7]. To date, efforts to determine whether that effect was mediated by Sup ODN increasing the frequency of T_reg have been unrevealing. As previously shown, successful treatment of murine autoimmunity requires that Sup ODN be administered repeatedly over many weeks. This prolonged intervention has many effects on the immune milieu, preventing us from establishing a cause-effect relationship with T_reg generation. To circumvent this problem, we used a well established model of in vivo tolerance that allowed precise analysis of the effect of a single treatment with Sup ODN on T_reg generation (Fig 4).

Sup ODN are fabricated from nuclease-resistant phosphorothioate nucleotides to improve their in vivo half life and activity. Bouladoux et al reported that Sup ODN could prevent CpG ODN from inhibiting T_reg generation but did not examine whether Sup ODN directly promoted T_reg generation [37]. Kim et al reported that phosophorthioate ODN could stablilize the expression of FoxP3 in a sequence non-specific manner but did not examine whether Sup ODN promoted the generation of T_reg from CD4⁺ precursors [38]. While phosphorothioate ODN can exert sequence non-specific immune effects at the high concentrations used by Kim et al [38;39], the control ODN used in our studies and by other groups uniformly failed to increase T_reg development and/or function [37;40–42]. Similarly, studies performed by multiple groups show that suppressive but not control ODN down regulate inflammatory and autoimmune responses in vivo [5;6;31–33].

Current findings are consistent with recent reports that T_reg generation is inhibited by STAT1 phosphorylation and that the deletion of STAT1 promotes T_reg differentiation [21–23,28]. The precise mechanism by which a decrease in STAT1 activation promotes the generation of T_regs is unclear. STAT1 may interfere with STAT5 driven T_reg production or it may trigger pathways that inhibit T_reg development. Specifically, we find that i) CD4⁺ T cells from STAT1-deficient mice generate significantly more iT_reg than those from WT donors, ii) Sup ODN block STAT1 phosphorylation and simultaneously enhance iT_reg generation and iii) Sup ODN do not enhance the generation of iT_reg from mice deficient in STAT1 (Fig 5). These findings suggest that the mechanism by which Sup ODN promote the generation of iT_reg is by inhibiting STAT1 phosphorylation. Consistent with that conclusion, we previously demonstrated that Sup ODN inhibited the differentiation of naive CD4 T cells into Th1 effectors by reducing STAT1 phosphorylation [8]. Other members of the STAT family also play a role in T_reg generation. FoxP3 expression and T_reg differentiation are enhanced by STAT5 phosphorylation [20;21] but inhibited by activation of the STAT4 and STAT6 signaling pathways [22]. We find that Sup ODN inhibit the phosphorylation of STAT1 but have no effect on STATS 3, 4 or 5 under culture conditions conducive to the generation of iT_reg (Fig 5 and data not shown).

The therapeutic benefit of increasing T_reg frequencies in patients with autoimmune and inflammatory disorders is being examined clinically [43]. Such therapy currently requires the adoptive transfer of T_reg, a strategy that is difficult, time consuming, and expensive [44]. The same outcome might be achieved by administering Sup ODN. Our studies of CD4⁺CD25⁻ T cells from normal human donors shows that Sup ODN induces them to differentiate into iT_reg. To study the effect of Sup ODN in vivo, the well defined DO11.10 Tg / Rag2 KO mouse model was employed [18]. This model has been used to identify other agents capable of eliciting Ag-specific T_reg responses [19;45]. Our results establish that Sup ODN significantly increase the number of CD4⁺CD25⁻ T cells that differentiate into T_reg in vivo (Fig 4). Other agents designed to increase T_reg production caused moderate-severe adverse events in clinical trials [43;46;47]. By comparison, pre-clinical studies found that Sup ODN are safe even when administered repeatedly and at high doses [48]. Taken together, these findings suggest that Sup ODN may be a promising tool to augment the generation of iT_reg in humans.

Highlights.

1. Supressive oligonucleotides (Sup ODN) enhance the generation of functionally active iT_reg in vitro

2. Sup ODN promote the generation of iT_regs in response to peptide challenge in vivo 3) The inhibition of STAT1 activation by Sup ODN increases the generation of iT_reg

Abbreviations

ODN

phosphorothiate oligodeoxynucleotide

Sup

suppressive