Skip to main content
Biomedical Reports logoLink to Biomedical Reports
. 2014 Nov 7;3(1):33–37. doi: 10.3892/br.2014.378

Absence of DICER1, CTCF, RPL22, DNMT3A, TRRAP, IDH1 and IDH2 hotspot mutations in patients with various subtypes of ovarian carcinomas

YANG ZOU 1,2,*, MEI-ZHEN HUANG 1,2,3,*, FA-YING LIU 1,2, BI-CHENG YANG 1, LI-QUN WANG 1, FENG WANG 1,2, XIAO-HONG YU 4, LEI WAN 1, XI-DI WAN 1, XIAO-YUN XU 1,2,3, WEI LI 1,2,3, OU-PING HUANG 1,2,✉, MING HE 5,✉
PMCID: PMC4251111  PMID: 25469243

Abstract

Cancer is caused by multiple genetic alterations within cells. Recently, large-scale sequencing has identified frequent ribonuclease type III (DICER1), CCCTC-binding factor (CTCF), ribosomal protein L22 (RPL22), DNA (cytosine-5-)-methyltransferase 3α (DNMT3A), transformation/transcription domain-associated protein (TRRAP), isocitrate dehydrogenase (IDH)1 and IDH2 hotspot mutations in diverse types of cancer. However, it remains largely unknown whether these mutations also exist in ovarian carcinomas. In the present study, a collection of 251 patients with distinct subtypes of ovarian carcinomas were recruited and sequenced for the presence of these hotspot mutations. However, no mutations in the seven genes were detected in the samples. These negative results, together with certain recent reports, indicate that the hotspot mutations in the CTCF, RPL22, DNMT3A, TRRAP, IDH1 and IDH2 genes may not be actively involved in the carcinogenesis of ovarian carcinoma. Of note, the DICER1 mutation frequency in Sertoli-Leydig cell tumor in the present study was significantly lower compared to prior observation, and therefore, it is speculated that this discrepancy may be mainly due to the small sample size analyzed in the study. In addition, among these samples, frequent polymerase (DNA directed) ε, catalytic subunit (POLE1) and ring finger protein 43 (RNF43) mutations were identified in endometrioid and mucinous ovarian carcinomas, respectively; thus DICER1, CTCF, RPL22, DNMT3A, TRRAP, IDH1 and IDH2 hotspot mutations may not play synergistic roles with POLE1 or RNF43 mutations in the carcinogenesis of endometrioid or mucinous ovarian carcinomas.

Keywords: hotspot mutations, absence, ovarian carcinoma

Introduction

The current understanding of human malignancy is that it mainly arises due to the accumulation of multiple genetic alterations, transforming normal cells into malignant cells (1,2). Of these genetic alterations, a myriad of genomic mutation data derived from a high-throughput DNA sequencing technique provided a unique opportunity to profile the mutation spectra underlying human cancers and a large number of significant functional mutations in multiple genes were identified in diverse types of cancer (1,3,4). These genes can be defined as oncogenes or tumor suppressor genes and are being used as molecular markers for diagnosis, staging and prognosis of human cancers (5,6).

Ovarian carcinoma constitutes a heterogeneous group of malignancies with significantly different clinical expression, pathological characteristics and genetic etiology (7,8). However, the majority of ovarian carcinomas shared certain common genetic alterations, such as frequent tumor protein p53 (TP53) and PIK3CA, catalytic subunit α mutations (9,10), and patients also exhibited subtype-specific mutations (11–13), which are possibly essential for the differential clinical expression and molecular-targeted therapy in ovarian carcinomas (14,15). These observations emphasized the requirement to identify novel subtype-specific molecular genetic aberrations in ovarian carcinomas.

Recently, large-scale sequencing has identified frequent mutations of the ribonuclease type III (DICER1) gene in Sertoli-Leydig cell tumors of the ovary (3), CCCTC-binding factor (CTCF) gene in transient abnormal myelopoiesis (16) and endometrial cancer (17), ribosomal protein L22 (RPL22) gene in endometrial cancer (18), DNA (cytosine-5-)-methyltransferase 3α (DNMT3A) gene in hematological malignancies (4), the transformation/transcription domain-associated protein (TRRAP) gene in melanoma (19) and isocitrate dehydrogenase 1 and 2 (IDH1 and IDH2) genes in gliomas (1,20) and acute myeloid leukemia (AML) (21), respectively. Some of these mutations were closely associated with cancer progression (22) and prognosis (23,24).

Thus far, the mutation statuses of DICER1, CTCF, RPL22, DNMT3A, TRRAP, IDH1 and IDH2 mutational hotspots in ovarian carcinomas remain largely unknown. One critical concern in cancer genetics is whether those cancer-associated mutations identified in one type of cancer are also common in other types of cancer. Therefore, a cohort of 251 Chinese patients with distinct subtypes of ovarian carcinomas was recruited in the present study to examine whether the hotspot mutations in these genes also existed in these samples.

Materials and methods

Sample collection

The study included 251 archival formalin-fixed, paraffin-embedded (FFPE) tissues with various subtypes of ovarian carcinoma recruited from the Jiangxi Provincial Maternal and Child Health Hospital (Nanchang, Jiangxi, China). Only those patients with >70% of neoplastic cells were recruited in the study. The sample cohort contained 76 ovarian serous carcinoma, 43 ovarian clear cell carcinoma, 37 ovarian endometrioid carcinoma, 33 ovarian germ cell tumor, 15 mucinous ovarian carcinoma, 18 ovarian sex cord-stromal tumor, 12 other rare subtypes and 17 Krukenberg tumor, and the available clinical data was as described previously (25,26) and in Table I. Informed consent conforming to the tenets of the Declaration of Helsinki was obtained from each patient prior to the study. The Institutional Review Boards of the Jiangxi Provincial Maternal and Child Health Hospital approved the study.

Table I.

Mutation frequencies of ribonuclease type III (DICER1), CCCTC-binding factor (CTCF), ribosomal protein L22 (RPL22), DNA (cytosine-5-)-methyltransferase 3α (DNMT3A), transformation/transcription domain-associated protein (TRRAP), isocitrate dehydrogenase (IDH)1 and IDH2 hotspot mutations in 251 Chinese patients with ovarian carcinomas.

Subtype/gene No. DICER1 p.E1705-D1709 DICER1 p.D1810-E1813 CTCF p.T204fs* RPL22 c.43delA DNMT3A p.R882 TRRAP p.S722 IDH1 p.R132 IDH2 p.R140 IDH2 p.R172 RNF43 p.I48V and p.R40fs*11a POLE1 p.S297Fb
Epithelial
 Serous 76 0/76 0/76 0/72 0/75 0/74 0/75 0/73 0/74 0/74 0/74 0/74
 Clear cell 43 0/43 0/43 0/42 0/43 0/43 0/43 0/42 0/41 0/41 0/41 0/41
 Endometrioid 37 0/37 0/37 0/35 0/35 0/36 0/37 0/35 0/37 0/37 0/37 3/37
 Mucinous 15 0/15 0/15 0/14 0/15 0/15 0/15 0/14 0/15 0/15 2/15 0/15
 Undifferentiated 3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3
 Unclassified 4 0/4 0/4 0/3 0/4 0/4 0/4 0/4 0/4 0/4 0/4 0/4
 Transitional cell 3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3 0/3
 Mixed 2 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/2
Non-epithelial
 Germ cell tumor
  Yolk sac 11 0/11 0/11 0/10 0/11 0/11 0/10 0/11 0/11 0/11 0/11 0/11
  Dysgerminoma 7 0/7 0/7 0/7 0/7 0/7 0/7 0/6 0/6 0/6 0/6 0/6
  Teratoma 9 0/9 0/9 0/8 0/9 0/9 0/9 0/8 0/9 0/9 0/9 0/9
  Mixed 6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6
Sex cord-stromal tumor
  Granulosa cell 16 0/16 0/16 0/14 0/16 0/16 0/16 0/15 0/16 0/16 0/16 0/16
  Sertoli-Leydig 2 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/2
Krukenberg tumors 17 0/17 0/17 0/16 0/16 0/17 0/17 0/15 0/17 0/17 0/17 0/17
a,b

As per references (25,26); POLE1, polymerase (DNA directed) ε, catalytic subunit; RNF43, ring finger protein 43.

Mutation analysis of the DICER1, CTCF, RPL22, DNMT3A, TRRAP, IDH1 and IDH2 genes

The Omega FFPE DNA kit (Omega Bio-tek Inc., Doraville, GA, USA) was used to isolate the DNA from the FFPE tissues. The polymerase chain reaction (PCR) primers were as summarized previously (25,27) and are shown in Table II. PCR reactions were performed in a total volume of 25 µl, containing 50 ng genomic DNA, 2 units of LA Taq DNA Polymerase (Takara Biotechnology Dalian Co. Ltd., Liaoning, China), 300 µM of each dNTP and 0.2 µM of each primer. The amplification reaction was performed in a Thermal Cycler 2720 (Applied Biosystems, Foster City, CA, USA) and employed one denaturation cycle of 94°C for 3 min, 35 amplification cycles of 94°C for 30 sec, 50–60°C (Table II) (25,27) for 20 sec and 72°C for 30 sec, with one final extension cycle of 72°C for 10 min. The PCR products were purified and sequenced with an ABI 3730 DNA sequencer (Applied Biosystems). DNA sequence analyses were performed with the DNASTAR package software (DNASTAR Inc., Madison, WI, USA).

Table II.

Primers for the mutational analysis of the ribonuclease type III (DICER1), CCCTC-binding factor (CTCF), ribosomal protein L22 (RPL22), DNA (cytosine-5-)-methyltransferase 3α (DNMT3A), transformation/transcription domain-associated protein (TRRAP), isocitrate dehydrogenase (IDH)1 and IDH2 genes.

Gene Target regions Amplicon, bp Sample detected Annealing, ˚C Forward primer (5′-3′) Reverse primer (5′-3′)
DICER1 p.E1705.D1709 159 251/251 55 CGGATCCCCTCAGATTGTTA CGATGCAAAGATGGTGTTGT
DICER1 p.D1810.E1813 171 251/251 55 TGGCCTTTTTGCTTACAAGTC TGCCAGACTGTCTCCAGTGA
CTCF p.T204fs* 212 237/251 56 GTTAAAGTGGGGGCCAATG AGCAGACCCTCCTGCTGTT
RPL22 c.43delA 190 247/251 60 TCTTGTTTTTCCGACTGACTGA CCGAGTGGCAATAAGGATGT
DNMT3A p.R882 177 248/251 52 TGCCCTCTCTGCCTTTTCT CCATGTCCCTTACACACACG
TRRAP p.S722 183 249/251 52 TCTGCTCTGTTTGCTACGAT GCACTACTTAGATTAAATGGAC
IDH1 p.R132 269 239/251 50 TGCTGCAGAAGCTATAAAGAAG GCAAAATCACATTATTGCCAAC
IDH2 p.R140 and p.R172 209 246/251 50 GCTGCAGTGGGACCACTATT ACCCTGGCCTACCTGGTC

bp, base pair.

Results and Discussion

The available clinical data of these patients are as described previously (25,26). In the present study, a total of 251 Chinese samples with distinct subtypes of ovarian carcinoma were screened for the presence of potential hotspot mutations in the DICER1, CTCF, RPL22, DNMT3A, TRRAP, IDH1 and IDH2 genes. However, no mutations in these genes were detected in the 251 samples (Table I and Fig. 1).

Figure 1.

Figure 1

Representative sequencing electropherograms of the ribonuclease type III (DICER1), CCCTC-binding factor (CTCF), ribosomal protein L22 (RPL22), DNA (cytosine-5-)-methyltransferase 3α (DNMT3A), transformation/transcription domain-associated protein (TRRAP), isocitrate dehydrogenase (IDH)1 and IDH2 genes in Chinese patients with ovarian carcinomas.

Previous studies have found frequent DICER1 p.E1705-D1709 and p.D1810-E1813 mutations in Sertoli-Leydig cell tumors (3,28). However, no DICER1 mutations were detected in the two patients with Sertoli-Leydig cell tumors. Therefore, it can be speculated that this discrepancy may be caused mainly by the small sample size of the Sertoli-Leydig cell tumors analyzed in the present study. In addition, DICER1 mutations were not identified in other subtypes of ovarian carcinomas in the samples, which is consistent with previous large-scale sequencing results in which the DICER1 hotspot mutations were absent in 12 mucinous (29) or 316 serous ovarian carcinomas (9). Collectively, these results indicated that the DICER1 hotspot mutations may not be actively involved in the pathogenesis of ovarian carcinoma, except for Sertoli-Leydig cell tumors.

CTCF p.T204fs* and RPL22 c.43delA mutations have been observed frequently in endometrial carcinoma in previously studies (17,18). Considering the fact that ovarian carcinoma have certain overlapped genetic aberrations with endometrial cancer, such as frequent TP53 (9,30) and polymerase (DNA directed) ε, catalytic subunit (POLE1) mutations (26,30), we hypothesized that ovarian carcinomas may also harbor these mutations. However, neither CTCF p.T204fs* nor RPL22 c.43delA mutations were identified in the samples in the present study. The absence of the CTCF and RPL22 mutations in ovarian cancer in a previous study (29) and the present study suggested that the CTCF and RPL22 hotspot mutations may play an extremely limited role in the pathogenesis of ovarian cancer.

Prevalent TRRAP p.S722 mutation was initially identified in melanomas in a whole-exome sequencing study (19). Subsequent extended studies failed to identify these mutations in thyroid cancer (31) or splenic marginal zone lymphoma (32). In the present study, no TRRAP p.S722 mutations were detected in our ovarian cancer patients with distinct subtypes. Also, TRRAP p.S722 mutations were not found in 12 mucinous (29) or 316 serous ovarian carcinomas (9). These negative results led us to speculate that TRRAP p.S722 mutations may not play a crucial role in the malignant transformation of ovarian carcinoma.

DNMT3A p.R882 mutations were identified almost exclusively in hematological malignancies, including AML (33), acute lymphoblastic leukemia (34) and myelodysplastic syndromes (35), and are generally infrequent or absent in some solid tumors (9,29,36). DNMT3A p.R882 mutations were not detected in the 251 samples with distinct subtypes of ovarian carcinoma. Similarly, whole-exome sequencing studies suggested that DNMT3A p.R882 mutations were absent in 12 mucinous (29) or 316 serous ovarian carcinomas (9). Taken together, the absence of DNMT3A p.R882 mutations in ovarian carcinoma analyzed in the present study and in previous studies (9,29) indicated that DNMT3A p.R882 mutations may be infrequent in ovarian carcinoma.

Frequent IDH1 p.R132, and IDH2 p.R140 and p.R172 mutations were identified in the central nervous system tumors and AML (1,20,27). However, no IDH1 or IDH2 mutations were detected in the present samples. Similar results were observed in previous studies in which IDH1 p.R132 mutations were not detected in 168 ovarian carcinomas or 8 ovarian cancer cell lines (20,37–39). In addition, IDH1 and IDH2 hotspot mutations were also not identified in 12 mucinous (29) or 316 serous ovarian carcinomas (9). These combined results suggested that IDH1 and IDH2 potential hotspot mutations may not be common in patients with ovarian carcinoma.

Among these patients, the POLE1 mutation has been previously found to be frequent in 37 ovarian endometrioid carcinomas (26), whereas ring finger protein 43 (RNF43) mutations were recurrent in 15 mucinous ovarian carcinomas (25) (Table I). In the present study, neither endometrioid nor mucinous ovarian carcinomas were detected to harbor DICER1, CTCF, RPL22, DNMT3A, TRRAP, IDH1 and IDH2 hotspot mutations. These results suggested that these potential hotspot mutations observed in other (sub)types of cancer may not play synergistic roles with POLE1 or RNF43 mutations in the carcinogenesis of endometrioid or mucinous ovarian carcinomas, respectively.

The main limitation of the present study was that only short DNA fragments spanning the potential hotspot mutations were screened in the seven genes, and therefore, there is a possibility that mutations in other residues of these genes may exist in these samples. However, due to the shortage of DNA amounts, this hypothesis was not tested.

In conclusion, DICER1, CTCF, RPL22, DNMT3A, TRRAP, IDH1 and IDH2 hotspot mutations were not identified in 251 Chinese patients with diverse subtypes of ovarian carcinoma. These results were generally consistent with previous studies and these combined results indicated that the hotspot mutations in these genes may not be actively involved in the carcinogenesis of Chinese patients with ovarian carcinoma, except for DICER1 mutations in Sertoli-Leydig cell tumors.

Acknowledgements

The present study was supported by grants from the National Natural Science Foundation of China (nos. 81260384 and 81260097) and the Natural Science Foundation of Jiangxi Province (no. 20114BAB215033).

References

  • 1.Parsons DW, Jones S, Zhang X, et al. An integrated genomic analysis of human glioblastoma multiforme. Science. 2008;321:1807–1812. doi: 10.1126/science.1164382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wu J, Jiao Y, Dal Molin M, et al. Whole-exome sequencing of neoplastic cysts of the pancreas reveals recurrent mutations in components of ubiquitin-dependent pathways. Proc Natl Acad Sci USA. 2011;108:21188–21193. doi: 10.1073/pnas.1118046108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Heravi-Moussavi A, Anglesio MS, Cheng SW, et al. Recurrent somatic DICER1 mutations in nonepithelial ovarian cancers. N Engl J Med. 2012;366:234–242. doi: 10.1056/NEJMoa1102903. [DOI] [PubMed] [Google Scholar]
  • 4.Ley TJ, Ding L, Walter MJ, et al. DNMT3A mutations in acute myeloid leukemia. N Engl J Med. 2010;363:2424–2433. doi: 10.1056/NEJMoa1005143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tefferi A, Lasho TL, Abdel-Wahab O, et al. IDH1 and IDH2 mutation studies in 1473 patients with chronic-, fibrotic- or blast-phase essential thrombocythemia, polycythemia vera or myelofibrosis. Leukemia. 2010;24:1302–1309. doi: 10.1038/leu.2010.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ogino S, Liao X, Imamura Y, et al. Predictive and prognostic analysis of PIK3CA mutation in stage III colon cancer intergroup trial. J Natl Cancer Inst. 2013;105:1789–1798. doi: 10.1093/jnci/djt298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bast RC, Jr, Hennessy B, Mills GB. The biology of ovarian cancer: new opportunities for translation. Nat Rev Cancer. 2009;9:415–428. doi: 10.1038/nrc2644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cho KR, Shih IeM. Ovarian cancer. Annu Rev Pathol. 2009;4:287–313. doi: 10.1146/annurev.pathol.4.110807.092246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cancer Genome Atlas Research Network, corp-author. Integrated genomic analyses of ovarian carcinoma. Nature. 2011;474:609–615. doi: 10.1038/nature10166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wiegand KC, Shah SP, Al-Agha OM, et al. ARID1A mutations in endometriosis-associated ovarian carcinomas. N Engl J Med. 2010;363:1532–1543. doi: 10.1056/NEJMoa1008433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rafnar T, Gudbjartsson DF, Sulem P, et al. Mutations in BRIP1 confer high risk of ovarian cancer. Nat Genet. 2011;43:1104–1107. doi: 10.1038/ng.955. [DOI] [PubMed] [Google Scholar]
  • 12.Loveday C, Turnbull C, Ramsay E, et al. Germline mutations in RAD51D confer susceptibility to ovarian cancer. Nat Genet. 2011;43:879–882. doi: 10.1038/ng.893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jones S, Wang TL, Shih IeM, et al. Frequent mutations of chromatin remodeling gene ARID1A in ovarian clear cell carcinoma. Science. 2010;330:228–231. doi: 10.1126/science.1196333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Romero I, Sun CC, Wong KK, Bast RC, Jr, Gershenson DM. Low-grade serous carcinoma: new concepts and emerging therapies. Gynecol Oncol. 2013;130:660–666. doi: 10.1016/j.ygyno.2013.05.021. [DOI] [PubMed] [Google Scholar]
  • 15.Martini M, Vecchione L, Siena S, Tejpar S, Bardelli A. Targeted therapies: how personal should we go? Nat Rev Clin Oncol. 2011;9:87–97. doi: 10.1038/nrclinonc.2011.164. [DOI] [PubMed] [Google Scholar]
  • 16.Yoshida K, Toki T, Okuno Y, et al. The landscape of somatic mutations in Down syndrome-related myeloid disorders. Nat Genet. 2013;45:1293–1299. doi: 10.1038/ng.2759. [DOI] [PubMed] [Google Scholar]
  • 17.Zighelboim I, Mutch DG, Knapp A, et al. High frequency strand slippage mutations in CTCF in MSI-positive endometrial cancers. Hum Mutat. 2014;35:63–65. doi: 10.1002/humu.22463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Novetsky AP, Zighelboim I, Thompson DM, Jr, Powell MA, Mutch DG, Goodfellow PJ. Frequent mutations in the RPL22 gene and its clinical and functional implications. Gynecol Oncol. 2013;128:470–474. doi: 10.1016/j.ygyno.2012.10.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wei X, Walia V, Lin JC, et al. Exome sequencing identifies GRIN2A as frequently mutated in melanoma. Nat Genet. 2011;43:442–446. doi: 10.1038/ng.810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Yan H, Parsons DW, Jin G, et al. IDH1 and IDH2 mutations in gliomas. N Engl J Med. 2009;360:765–773. doi: 10.1056/NEJMoa0808710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Abbas S, Lugthart S, Kavelaars FG, et al. Acquired mutations in the genes encoding IDH1 and IDH2 both are recurrent aberrations in acute myeloid leukemia: prevalence and prognostic value. Blood. 2010;116:2122–2126. doi: 10.1182/blood-2009-11-250878. [DOI] [PubMed] [Google Scholar]
  • 22.Watanabe T, Nobusawa S, Kleihues P, Ohgaki H. IDH1 mutations are early events in the development of astrocytomas and oligodendrogliomas. Am J Pathol. 2009;174:1149–1153. doi: 10.2353/ajpath.2009.080958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Im AP, Sehgal AR, Carroll MP, et al. DNMT3A and IDH mutations in acute myeloid leukemia and other myeloid malignancies: associations with prognosis and potential treatment strategies. Leukemia. 2014;28:1774–1783. doi: 10.1038/leu.2014.124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kihara R, Nagata Y, Kiyoi H, et al. Comprehensive analysis of genetic alterations and their prognostic impacts in adult acute myeloid leukemia patients. Leukemia. 2014;28:1586–1595. doi: 10.1038/leu.2014.55. [DOI] [PubMed] [Google Scholar]
  • 25.Zou Y, Wang F, Liu FY, et al. RNF43 mutations are recurrent in Chinese patients with mucinous ovarian carcinoma but absent in other subtypes of ovarian cancer. Gene. 2013;531:112–116. doi: 10.1016/j.gene.2013.08.054. [DOI] [PubMed] [Google Scholar]
  • 26.Zou Y, Liu FY, Liu H, et al. Frequent POLE1 p.S297F mutation in Chinese patients with ovarian endometrioid carcinoma. Mutat Res Fundam Mol Mech Mutagen. 2014;761:49–52. doi: 10.1016/j.mrfmmm.2014.01.003. [DOI] [PubMed] [Google Scholar]
  • 27.Zou Y, Zeng Y, Zhang DF, Zou SH, Cheng YF, Yao YG. IDH1 and IDH2 mutations are frequent in Chinese patients with acute myeloid leukemia but rare in other types of hematological disorders. Biochem Biophys Res Commun. 2010;402:378–383. doi: 10.1016/j.bbrc.2010.10.038. [DOI] [PubMed] [Google Scholar]
  • 28.Witkowski L, Mattina J, Schonberger S, et al. DICER1 hotspot mutations in non-epithelial gonadal tumours. Br J Cancer. 2013;109:2744–2750. doi: 10.1038/bjc.2013.637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ryland GL, Hunter SM, Doyle MA, et al. RNF43 is a tumour suppressor gene mutated in mucinous tumours of the ovary. J Pathol. 2013;229:469–476. doi: 10.1002/path.4134. [DOI] [PubMed] [Google Scholar]
  • 30.Cancer Genome Atlas Research Network, corp-author. Kandoth C, Schultz N, Cherniack AD, et al. Integrated genomic characterization of endometrial carcinoma. Nature. 2013;497:67–73. doi: 10.1038/nature12113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Murugan AK, Yang C, Xing M. Mutational analysis of the GNA11, MMP27, FGD1, TRRAP and GRM3 genes in thyroid cancer. Oncol Lett. 2013;6:437–441. doi: 10.3892/ol.2013.1391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Parry M, Rose-Zerilli MJ, Gibson J, et al. Whole exome sequencing identifies novel recurrently mutated genes in patients with splenic marginal zone lymphoma. PLoS One. 2013;8:e83244. doi: 10.1371/journal.pone.0083244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yan XJ, Xu J, Gu ZH, et al. Exome sequencing identifies somatic mutations of DNA methyltransferase gene DNMT3A in acute monocytic leukemia. Nat Genet. 2011;43:309–315. doi: 10.1038/ng.788. [DOI] [PubMed] [Google Scholar]
  • 34.Neumann M, Heesch S, Schlee C, et al. Whole-exome sequencing in adult ETP-ALL reveals a high rate of DNMT3A mutations. Blood. 2013;121:4749–4752. doi: 10.1182/blood-2012-11-465138. [DOI] [PubMed] [Google Scholar]
  • 35.Walter MJ, Ding L, Shen D, et al. Recurrent DNMT3A mutations in patients with myelodysplastic syndromes. Leukemia. 2011;25:1153–1158. doi: 10.1038/leu.2011.44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kim MS, Kim YR, Yoo NJ, Lee SH. Mutational analysis of DNMT3A gene in acute leukemias and common solid cancers. APMIS. 2013;121:85–94. doi: 10.1111/j.1600-0463.2012.02940.x. [DOI] [PubMed] [Google Scholar]
  • 37.Bleeker FE, Lamba S, Leenstra S, et al. IDH1 mutations at residue p.R132 (IDH1(R132)) occur frequently in high-grade gliomas but not in other solid tumors. Hum Mutat. 2009;30:7–11. doi: 10.1002/humu.20937. [DOI] [PubMed] [Google Scholar]
  • 38.Kang MR, Kim MS, Oh JE, et al. Mutational analysis of IDH1 codon 132 in glioblastomas and other common cancers. Int J Cancer. 2009;125:353–355. doi: 10.1002/ijc.24379. [DOI] [PubMed] [Google Scholar]
  • 39.Mauzo SH, Lee M, Petros J, et al. Immunohistochemical demonstration of isocitrate dehydrogenase 1 (IDH1) mutation in a small subset of prostatic carcinomas. Appl Immunohistochem Mol Morphol. 2014;22:284–287. doi: 10.1097/PAI.0b013e3182649d1c. [DOI] [PubMed] [Google Scholar]

Articles from Biomedical Reports are provided here courtesy of Spandidos Publications

RESOURCES