Abstract
MUS81-EME1 is a conserved structure-selective endonuclease with a preference for branched DNA substrates in vitro that correspond to intermediates of DNA repair. Cells lacking MUS81 or EME1 show defects in the repair of DNA interstrand crosslinks (ICL) resulting in hypersensitivity to agents such as mitomycin C. In metazoans, a proportion of cellular MUS81-EME1 binds the SLX4 scaffold protein, which is itself instrumental for ICL repair. It was previously reported that mutations in SLX4 that abolished interaction with MUS81 affected ICL repair in human cells but not in murine cells. In this study we looked the other way around by pinpointing amino acid residues in MUS81 that when mutated abolish the interaction with SLX4. These mutations fully rescued the mitomycin C hypersensitivity of MUS81 knockout murine cells, but they were unable to rescue the sensitivity of two different human cell lines defective in MUS81. These data support an SLX4-dependent role for MUS81 in the repair, but not the induction of ICL-induced double-strand breaks. This study sheds light on the extent to which MUS81 function in ICL repair requires interaction with SLX4.
Keywords: SLX4, MUS81, Nuclease, Scaffold, Inter-strand crosslink
1. Introduction
MUS81-EME1 is an evolutionarily conserved structure-selective endonuclease with a preference in vitro for branched DNA substrates such as 3′ flaps, replication forks and nicked Holliday junctions (HJs) that correspond to intermediates of DNA repair [1]. Cells lacking MUS81 or EME1 show defects in the repair of DNA interstrand crosslinks (ICL) resulting in hypersensitivity to agents such as mitomycin C and platinum compounds [2], [3], [4], [5]. In metazoans, a proportion of the total cellular pool of MUS81-EME1 binds the SLX4 scaffold protein [6]. This scaffold is the central coordinator of a DNA repair toolkit that includes two other endonucleases: XPF-ERCC1 and SLX1 [7], [8], [9], which are also required for ICL repair, together with SLX4 [7], [8], [9], [10], [11], [12].
Although both SLX4 and MUS81-EME1 are highly conserved, budding yeast Slx4 does not associate with Mus81-Mms4Eme1 [13]. So somewhere in evolution SLX4 and MUS81 developed an ability to interact with each other. Furthermore the interaction of SLX4 with MUS81-EME1 appears to be restricted to late S and G2 phases of the cell cycle [14]. Also, mutations in murine SLX4 that disrupt the interaction with MUS81 largely abolishes the resolution of Holliday junctions that escape dissolution but does not affect ICL repair [11], [12]. In this study, we mapped domains and residues in MUS81 required for binding to SLX4 and tested the consequences for ICL repair.
2. Results and discussion
2.1. Mapping the SLX4 interacting region in MUS81
It was previously established that it is the N-terminus (amino acids 1–86) of the MUS81 subunit of MUS81-EME1 that interacts with SLX4 [7]. To narrow down the domain in human MUS81 interacting with SLX4, a series of MUS81 fragments were cloned into a yeast two-hybrid (Y2H)-compatible vector (Fig. S1), fused to a GAL4-DNA binding domain (MUS81-BD): amino acids (1–250), (151–350) and (251–551), as well as full-length MUS81 (FL) (Fig. 1A). A Y2H screen for interaction with full-length SLX4 fused to a GAL4-activation domain (SLX4-AD) revealed that the MUS81 fragment (1–250) was capable of interaction with SLX4 (Fig. 1B). To further narrow down the SLX4-binding region of MUS81, we subdivided this region and found that a MUS81 fragment coding for amino acids 1–106 is sufficient for interaction with SLX4 (Fig. 1A and B).
2.2. Reverse yeast two-hybrid assay
Low fidelity mutagenic PCR was used to generate mutations in MUS81 (1–106) fragment, which was recombined into the Y2H-compatible vector as a fusion with a kanamycin resistance gene. Resulting MUS81 (1–106) mutants with stop codons or frameshift mutations in the MUS81 coding sequence were eliminated by selection at an optimized kanamycin concentration (Fig. S2). The reporter strain Mav203 has, in addition to HIS3 and lacZ, a URA3 reporter gene driven by GAL4 sites. URA3 encodes orotidine 5-phosphate decarboxylase (ODCase) that converts 5-fluoroorotic acid (5-FOA) to 5-fluorouracil causing cell death when plated on medium containing 5-FOA and thereby selecting for loss-of-interaction between bait/prey proteins. To this end, Mav203 yeast were co-transformed with the MUS81 (1–106)-BD allele library and SLX4-AD and plated on medium containing 5-FOA. Of the hundreds of colonies that grew on 5-FOA, around 30 were picked, re-streaked and taken forward for further analysis. A representative group of ten such clones is shown in Fig. S3A. Sequencing revealed two single point mutations at residue Leu25 (L25) and Leu47 (L47), which were chosen for further analysis based on a high frequency of occurrence. To confirm loss-of-interaction with SLX4, HEK293 cells were transiently transfected with full-length FLAG-MUS81 carrying mutations at residues Leu25 and Leu47 (L25P, L25K, L47P, L47K and L25A, L47A). Immunoprecipitation using FLAG-M2 agarose beads revealed loss-of-interaction with SLX4 compared with wild-type MUS81 (Fig. S3B).
2.3. Alanine scanning of conserved residues in MUS81 (1–106) fragment
As a complementary approach, we carried out alanine scanning across conserved residues in the N-terminal (1–106) HhH-bearing region conserved in a range of MUS81 orthologues [15], [16]. Pairs of conserved residues were mutated to alanine, one pair at a time (Fig. 1C) in full-length FLAG-tagged MUS81, and HEK293 cells were transiently transfected with these mutants or wild-type FLAG-MUS81. As shown in Fig. 1D, several MUS81 mutants were identified in this way that could not interact with endogenous SLX4. Two of the mutants identified i.e. W24A L25A and L66A Q67A, did not seem to be defective in EME1 interaction when levels of MUS81 were taken into account and were chosen for further analysis. Leu25 was also identified in the reverse yeast two-hybrid assay (see above).
2.4. Effect of loss-of-SLX4-interaction mutants on MUS81 nuclease activity
Most of the cellular complement of MUS81-EME1 does not interact with SLX4, and we thought it unlikely that preventing interaction with SLX4 would affect the nuclease activity of MUS81-EME1. To test this, HEK293 cells were co-transfected with FLAG-MUS81 wild-type (WT) or MUS81 mutants (W24A L25A and L66A Q67A) that could not interact with SLX4 - and FLAG-EME1. As control a nuclease dead mutant FLAG-MUS81 D307A (D307A) was used. Anti-FLAG immunoprecipitates from cells expressing wild-type MUS81 cleaved the 3′ flap substrate efficiently, but not from cells expressing the nuclease dead D307A mutant (Fig. S4). As shown in Fig. 1E, 3′ flap nuclease activity in FLAG immunoprecipitates in the context of the MUS81 mutants W24A L25A and L66A Q67A that did not interact with SLX4 was indistinguishable from wild-type MUS81.
2.5. Impact of loss-of-SLX4-interaction MUS81 mutants on ICL repair in mouse cells
We next checked the ability of MUS81 mutants to rescue MMC hypersensitivity of Mus81−/− MEFs. To this end Mus81−/− MEFs [5] were infected with retroviruses for stable expression of wild-type mouse MUS81 (wt-MUS81) or full-length mouse MUS81 carrying the mutations W24A L25A (MUS81 24/25AA) or L66A Q67A (MUS81 66/67AA). Wild-type and Mus81−/− MEFs were infected with empty viruses to serve as controls. MUS81 expression in the complemented Mus81−/− MEFs was assessed by immunoblotting of whole cell extracts (Fig. 2A, top panel). While wild-type MUS81 and EME1 were detected in SLX4 immunoprecipitates, the MUS81 loss-of-SLX4-interaction mutants i.e. MUS81 24/25AA and MUS81 66/67AA were not (Fig. 2A, middle panel). Similar results were obtained when endogenous EME1 was precipitated from cells complemented with the MUS81 mutants (Fig. 2A, bottom panel). SLX4 was detected in EME1 immunoprecipitates from cells expressing wild-type MUS81, but not MUS81 24/25AA and MUS81 66/67AA mutants. The complemented Mus81−/− MEFs were used in a clonogenic survival assay to test sensitivity to MMC. Mus81−/− MEFs are hypersensitive to MMC compared to wild-type MEFs. This sensitivity was rescued by ectopic expression of wild-type MUS81, and the MUS81 24/25AA and MUS81 66/67AA mutants were indistinguishable from wild-type (Fig. 2B). These data suggest that the role of MUS81 in ICL repair is independent of its interaction with SLX4 at least in murine cells.
2.6. MUS81 mutants that cannot interact with SLX4 show defective ICL repair in human HCT116 cells
We tested the ability of the MUS81 24/25AA and MUS81 66/67AA mutants to rescue the ICL hypersensitivity of human HCT116 colon cancer cells in which the MUS81 gene had been disrupted [4]. To this end wild-type MUS81 or MUS81 24/25AA and 66/67AA mutants were expressed in MUS81−/− HCT116 cells. Wild-type and MUS81−/− HCT116 cells transduced with empty vectors were used as controls. As in MEFs, the MUS81 loss-of-interaction mutants failed to interact with SLX4 in co-immunoprecipitation experiments (Fig. 2C). Surprisingly, the 24/25AA and 66/67AA mutants were incapable of rescuing MMC sensitivity in MUS81−/− HCT116 cells (Fig. 2D) in contrast to Mus81−/− MEFs where MUS81 interaction with SLX4 was dispensable for ICL repair.
2.7. MUS81 mutants that cannot interact with SLX4 show defective ICL repair in HEK293 cells
To exclude the possibility that the discrepancies observed were unique to a particular cell type, we wished to test at least one more human cell line. To this end, two separate MUS81 specific siRNAs (#9, #10) were used to deplete MUS81 from HEK293 cells and a scrambled siRNA (CON) was used as control. HEK293 cells were also transfected with plasmids that allowed stable expression of FLAG–MUS81 or FLAG–MUS81 24/25AA, under the control of a tetracycline–inducible promoter. These plasmids encoded MUS81 with conservative mutations that rendered it refractory to siRNAs #9 and #10. Endogenous MUS81 was knocked down using siRNA oligos and expression of FLAG-MUS81 (wild-type or mutant) was induced by tetracycline. HEK293 cells with a stable expression of a FLAG-empty tag, also under control of a tetracycline-inducible promoter, were used as a negative control. The knockdown of endogenous MUS81 and simultaneous expression of FLAG-tagged MUS81 (wild type or mutant) was confirmed using western blotting (Fig. 3A). These cells were then subjected to clonogenic survival assays. Depletion of MUS81 using either siRNA #9 or #10 caused HEK293 cells to be hypersensitive to MMC, which could be rescued by wild-type MUS81 in each case, but not by MUS81 24/25AA mutant (Figs. 3B and C).
2.8. SLX4 interaction with MUS81 is required for repair of DSBs induced by MMC in human cells
MUS81 has been implicated in generation of ICL-induced DSBs [17]. However, as shown in Fig. 3D, we found that MUS81 is not required for DSB induction in HCT116 cells, which is consistent with a previous study in Mus81−/− MEFs that showed that ICL-induced DSBs could occur even in the absence of MUS81 [3]. The same study also showed that γH2AX foci, a widely used marker for DSBs, persisted for longer in MEFs lacking MUS81 [3]. Thus, we next wanted to test if MUS81−/− HCT116 cells complemented with MUS81 loss-of-interaction mutants were similarly defective in repair of ICL-induced DSBs.
To this end, the disappearance of γH2AX foci following a pulse of MMC treatment was analyzed in wild-type HCT116, MUS81−/− HCT116 or MUS81−/− HCT116 cells complemented with MUS81 (wild-type or mutant). We observed an elevated number of MUS81−/− HCT116 cells that were positive for γH2AX foci prior to MMC treatment as compared to wild-type HCT116 cells, which was consistent with a previous study of Mus81−/− MEFs [3]. Following MMC treatment, the proportion of cells positive for γH2AX foci peaked at ∼80% at 24 h in all cell lines tested. Subsequently, the number of both wild-type HCT116 cells and MUS81−/− HCT116 cells + MUS81 declined to basal levels within 48 h of drug treatment. However, for MUS81−/− HCT116 cells and MUS81−/− HCT116 cells complemented with MUS81 mutants that could not interact with SLX4, the percentage of cells with γH2AX foci remained constant at ∼70% for the duration of the experiment. This observation suggests that in human cells, MUS81-EME1 is required for ICL-induced DSB repair and this role of MUS81-EME1 is dependent on its interaction with SLX4.
3. Discussion
At present the basis for the clear difference between human and murine cells is unclear, but this is not the first evidence of a disparity between MUS81 function in mice and humans. For example, studies in MUS81−/− HCT116 cells show that response to camptothecin (CPT) is dependent on MUS81 whereas, a separate study showed that Mus81−/− MEFs were resistant to CPT treatment [3], [18]. Further evidence in favor of a functional disparity in ICL repair comes from studies in mutant mice models for FANC genes. While, cells isolated from these mice are ICL-sensitive, most mice do not present developmental defects, anemia and cancer predisposition that are commonly described in FANC patients [19]. Hence, while mouse models are important tools to study the mechanistic background of FA, it is important to keep in mind that there are differences in DNA repair between mice and humans.
MUS81 has been implicated in ICL-induced DSB formation as well as during homologous recombination in the latter stages of crosslink repair [3], [17]. Here we found that DSBs induced by MMC treatment were not dependent on MUS81, an observation made previously for SLX4 [6], [8]. However, MUS81 mutations that do not interact with SLX4 cause delayed repair of the DSBs as judged by γH2AX foci. This is consistent with a role for SLX4-bound MUS81-EME1 in processing repair intermediates at late stages of ICL repair, perhaps during homologous recombination.
4. Experimental procedures
4.1. Nuclease assays
Oligonucletotides were purchased from VBC Biotech. The sequences of the oligonucleotides used to prepare the 3′ flap DNA substrate are given below:
Oligo 1: 5′-AGCTACCATGCCTGCACGAATTAAGCAATTCGTAATCATGGTCATAGCT
Oligo 4: 5′-AATTCGTGCAGGCATGGTAGCT
Oligo 6: 5′-AGCTATGACCATGATTACGAATTGCTTGGAATCCTGACGAACTGTAG
Oligo 1 was labeled with fluorescein isothiocyanate (FITC) at its 5′ end. The 3′ flap substrate was prepared as previously described in [20]. After immunoprecipitation, FLAG M2 beads were washed in cell lysis buffer followed by a final wash in nuclease buffer (20 mM Tris-HCl [pH 7.5], 50 mM NaCl, 10 mM MgCl2, 0.1 mg/ml BSA) and assay was performed as described in [8]. Reaction products were analyzed by native PAGE (10% polyacrylamide) in TAE buffer. Gels were exposed to FLA5000IR, 473 nm, 600 V and viewed using AIDA image software.
4.2. Clonogenic survival analysis
MEFs or HCT116 cells were seeded in triplicates in 10 cm dishes and were allowed to attach before treatment. MMC was added to cells for 24 h before medium was replaced with fresh growth medium. HEK293 cells were seeded in 10 cm dishes at 25% confluence and allowed to adhere overnight. Cells were transfected with the relevant siRNA for 48 h and cells were split and seeded in 10 cm dishes (3500 cells/dish). Cells were allowed to adhere for a minimum of 8 h before MMC treatment for 24 h. After 10 days cells were washed, fixed and stained with Giemsa. The number of colonies with >50 cells were counted. Results were normalized to plating efficiency.
Conflict of interest
The authors have no conflict of interest.
Acknowledgements
We would like to thank Dr. Razqallah Hakem for Mus81−/− MEFs and Prof. Kiyoshi Miyagawa for MUS81−/− HCT116 cells. We are grateful to James Hastie, Hilary MacLauchlan and the Antibody Production Team at Division of Signal Transduction Therapy, University of Dundee for help with antibody production, and to DNA Sequencing Service and Oligonucleotide Synthesis Service at CLS, University of Dundee. We thank Ivan Muñoz, Christophe Lachaud and Anne-Cécile Déclais for help with experiments. The authors acknowledge use of GRE microscopy facilities at the University of Dundee, funded by the Wellcome Trust (097945/B/11/Z). This study was supported by the Medical Research Council (MRC), the pharmaceutical companies supporting the Division of Signal Transduction Therapy Unit (AstraZeneca, Boehringer-Ingelheim, GlaxoSmithKline, Merck, Janssen and Pfizer) associated with the MRC PPU (NN, DC, TJM and JR).
Footnotes
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.dnarep.2014.08.004.
Appendix A. Supplementary data
The following are the supplementary data to this article:
References
- 1.Ciccia A., Constantinou A., West S.C. Identification and characterization of the human mus81-eme1 endonuclease. J. Biol. Chem. 2003;278(27):25172–25178. doi: 10.1074/jbc.M302882200. [DOI] [PubMed] [Google Scholar]
- 2.Abraham J. Eme1 is involved in DNA damage processing and maintenance of genomic stability in mammalian cells. EMBO J. 2003;22(22):6137–6147. doi: 10.1093/emboj/cdg580. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Dendouga N. Disruption of murine Mus81 increases genomic instability and DNA damage sensitivity but does not promote tumorigenesis. Mol. Cell. Biol. 2005;25(17):7569–7579. doi: 10.1128/MCB.25.17.7569-7579.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hiyama T. Haploinsufficiency of the Mus81-Eme1 endonuclease activates the intra-S-phase and G2/M checkpoints and promotes rereplication in human cells. Nucleic Acids Res. 2006;34(3):880–892. doi: 10.1093/nar/gkj495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.McPherson J.P. Involvement of mammalian Mus81 in genome integrity and tumor suppression. Science. 2004;304(5678):1822–1826. doi: 10.1126/science.1094557. [DOI] [PubMed] [Google Scholar]
- 6.Stoepker C. SLX4: a coordinator of structure-specific endonucleases, is mutated in a new Fanconi anemia subtype. Nat. Genet. 2011;43(2):138–141. doi: 10.1038/ng.751. [DOI] [PubMed] [Google Scholar]
- 7.Fekairi S. Human SLX4 is a Holliday junction resolvase subunit that binds multiple DNA repair/recombination endonucleases. Cell. 2009;138(1):78–89. doi: 10.1016/j.cell.2009.06.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Munoz I.M. Coordination of structure-specific nucleases by human SLX4/BTBD12 is required for DNA repair. Mol. Cell. 2009;35(1):116–127. doi: 10.1016/j.molcel.2009.06.020. [DOI] [PubMed] [Google Scholar]
- 9.Svendsen J.M. Mammalian BTBD12/SLX4 assembles a Holliday junction resolvase and is required for DNA repair. Cell. 2009;138(1):63–77. doi: 10.1016/j.cell.2009.06.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kim Y. Regulation of multiple DNA repair pathways by the Fanconi anemia protein SLX4. Blood. 2013;121(1):54–63. doi: 10.1182/blood-2012-07-441212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Crossan G.P. Disruption of mouse Slx4: a regulator of structure-specific nucleases, phenocopies Fanconi anemia. Nat. Genet. 2011;43(2):147–152. doi: 10.1038/ng.752. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Castor D. Cooperative control of Holliday junction resolution and DNA repair by the SLX1 and MUS81-EME1 nucleases. Mol. Cell. 2013;52(2):221–233. doi: 10.1016/j.molcel.2013.08.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Schwartz E.K. Mus81-Mms4 functions as a single heterodimer to cleave nicked intermediates in recombinational DNA repair. Mol. Cell. Biol. 2012;32(15):3065–3080. doi: 10.1128/MCB.00547-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wyatt H.D. Coordinated actions of SLX1–SLX4 and MUS81-EME1 for Holliday junction resolution in human cells. Mol. Cell. 2013;52(2):234–247. doi: 10.1016/j.molcel.2013.08.035. [DOI] [PubMed] [Google Scholar]
- 15.Chen X.B. Human Mus81-associated endonuclease cleaves Holliday junctions in vitro. Mol. Cell. 2001;8(5):1117–1127. doi: 10.1016/s1097-2765(01)00375-6. [DOI] [PubMed] [Google Scholar]
- 16.Ciccia A., McDonald N., West S.C. Structural and functional relationships of the XPF/MUS81 family of proteins. Annu. Rev. Biochem. 2008;77:259–287. doi: 10.1146/annurev.biochem.77.070306.102408. [DOI] [PubMed] [Google Scholar]
- 17.Hanada K. The structure-specific endonuclease Mus81-Eme1 promotes conversion of interstrand DNA crosslinks into double-strands breaks. EMBO J. 2006;25(20):4921–4932. doi: 10.1038/sj.emboj.7601344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Regairaz M. Mus81-mediated DNA cleavage resolves replication forks stalled by topoisomerase I-DNA complexes. J. Cell Biol. 2011;195(5):739–749. doi: 10.1083/jcb.201104003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Bakker S.T., de Winter J.P., te Riele H. Learning from a paradox: recent insights into Fanconi anaemia through studying mouse models. Dis. Models Mech. 2013;6(1):40–47. doi: 10.1242/dmm.009795. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Matulova P. Cooperativity of Mus81.Mms4 with Rad54 in the resolution of recombination and replication intermediates. J. Biol. Chem. 2009;284(12):7733–7745. doi: 10.1074/jbc.M806192200. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.