Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Nov 28.
Published in final edited form as: Biochem Biophys Res Commun. 2014 Nov 4;454(4):604–608. doi: 10.1016/j.bbrc.2014.10.145

Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay

Kanchi Ravi Rupesh 1, Aaron Smith 1, Paul E Boehmer 1,*
PMCID: PMC4254511  NIHMSID: NIHMS642084  PMID: 25449284

Abstract

We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1 °C for (dT)5 to a maximum of 9 °C with oligomers ≥10 nucleotides, with an apparent Kd of <1 µM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9 °C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner.

Keywords: SYPRO Orange, thermal shift assay, single-strand DNA binding protein, Herpes simplex virus-1, ICP8

Introduction

SYPRO Orange was developed as a sensitive protein stain, allowing the detection of as little as 1 ng of protein following SDS PAGE as well as in native and two-dimensional gels [1,2]. It is a fluorescent stain with excitation maxima of 280 and 470 nm, and an emission maximum of 569 nm, exhibiting a ~500-fold increase in fluorescence intensity upon protein binding [1]. More recently, SYPRO Orange has found an intriguing application in measuring thermal denaturation of proteins [3]. Essentially, thermal unfolding of proteins exposes hydrophobic regions that are bound by SYPRO Orange with a concomitant increase in fluorescence emission. This permits the determination of the melting transition point or melting temperature1 (Tm) of a given protein as a measure of its thermal stability. One significant application of the assay has been in comparing the thermal stability of mutant proteins to gain insight into the impact on protein folding [4–7], and to evaluate the quality of proteins by distinguishing between folded and unfolded preparations [8]. Importantly, this method may also be used to investigate how ligands affect protein stability by shifting the Tm [3,9]. Indeed, the thermal shift assay has found application as a screen to identify protein ligands, with the potential to facilitate hit identification in drug discovery, and to aid in protein structure determination [10–13]. For instance, the thermal shift assay has been used to demonstrate that divalent cations can stabilize the gp2 nuclease subunit of the bacteriophage SPP1 terminase, with Mn2+ increasing the Tm by ~8 °C [14]. In another study with aspartyl-tRNA synthetase, of the various ligands, only the sulfamoyl-adenylated-asp analogue was shown to significantly increase the thermal stability of the enzyme, while neither tRNA, adenosine triphosphate or aspartic acid had a significant effect on Tm [15]. Regarding macromolecular ligands, in a study of the regulatory DNA binding protein ExsD from P. aeruginosa, it was demonstrated that DNA binding reduced the Tm by 12 °C, consistent with a reduction in protein stability as a result of the dissociation of the ExsD trimer [16]. In fact, to our knowledge, this is the only prior study using the thermal shift assay to have examined the effect of DNA ligands on protein stability. Here we have adapted the assay to investigate how single-stranded (ss) DNA ligands affect the stability of a ssDNA binding protein (SSB), specifically that of herpes simplex virus-1 (HSV-1) Infected Cell Polypeptide 8 (ICP8).

ICP8 is a 1196 amino acid, 128,342 Da polypeptide and one of seven essential viral DNA replication proteins [17]. Biochemically it functions as a SSB, binding to ssDNA with moderate cooperativity (ω = 15), an association constant K = 0.55 × 10−6 M−1, a site size of 10 +/−1 nucleotides, and stretching the DNA by 150% [18]. ICP8 also binds to RNA albeit with reduced affinity compared to its ssDNA binding activity [19]. Functionally, ICP8 performs a critical role at the viral DNA replication fork by maintaining ssDNA regions and by interacting with various other replisome components via specific protein-protein interactions [reviewed in 20–24]. In addition, ICP8 has been demonstrated to function as a recombinase, capable of promoting strand annealing and strand invasion as well as mediating strand exchange reactions in conjunction with the HSV-1 helicase-primase or UL12 nuclease [25–28].

Here we have used the thermal shift assay to measure the ssDNA binding parameters of ICP8. To our knowledge, this is the only report that demonstrates the application of the thermal shift assay to study ssDNA-SSB interactions. We believe that the thermal shift assay may be used to easily gain insight into the ssDNA binding properties of other SSB. Importantly, since SSBs perform critical and invariably essential functions, they represent excellent antibacterial and antiviral drug targets. Therefore, the thermal shift assay may be used as a rapid screen to identify compounds that inhibit the ssDNA binding activity of SSB. Indeed, using ICP8, we provide proof of concept that the thermal shift assay may be used to identify compounds that disrupt ssDNA-SSB interactions and have application as antiviral or antibacterial agents.

Materials and methods

Oligonucleotides, proteins and reagents

Oligothymidylate of various sizes (Operon Biotechnologies) were as follows: (dT)5, (dT)7, (dT)9, (dT)10, (dT)11, (dT)13, (dT)15, (dT)17, (dT)20, (dT)40, and (dT)60. Oligonucleotides PBAZ48 (24-mer, 5’ CGAGGCTGGATGGCCTTCCCCATT) and PBAZ49 (20-mer, 5’ TGGCCTTTGGCCTTTGGCCT) were synthesized by Operon Biotechnologies. Oligomers were purified by the manufacturer, either by QuickLC™ for those between 10 and 40 nucleotides or from polyacrylamide gels for (dT)60, PBAZ48 and PBAZ49. Oligonucleotide concentrations are expressed in moles of molecules. Where indicated, oligonucleotides were 5′-32P-labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP (Perkin Elmer, 3,000 Ci/mmol) followed by removal of unincorporated nucleotides using Microspin G-25 columns (GE Healthcare). ICP8 was purified as previously described [29]. Its concentration, expressed in moles of monomeric protein, was determined using an extinction coefficient of 82,720 M−1 cm−1 at 280 nm. SYPRO Orange and ciprofloxacin were purchased from Invitrogen and Sigma, respectively.

Thermal shift assay

The thermal shift assay was performed using an Applied Biosystems ABI Fast 7500 system. Unless otherwise stated, reactions (25 µl) in fast optical 96-well reaction plates (Applied Biosystems) contained 20 mM HEPES-NaOH pH 7.5, 150 mM NaCl, l µM ICP8, SYPRO Orange (500-fold dilution of the commercial stock), and oligonucleotide, as indicated. The plates were covered with optical foil during the reaction in the thermal cycler. The instrument was programmed in the Melt Curve mode with SYBR Green Reagent detection and the Standard speed run. The reporter was selected as FAM and None for the quencher. Each melt curve was programmed as follows: 25 °C for 5 min, followed by a 1 °C increase per min from 25 °C to 95 °C, and finally 25 °C for 5 min. The raw data was extracted in MS-Excel format. Arbitrary fluorescence was plotted as a function of temperature. In our studies, Tm is defined as the temperature with the highest SYPRO Orange fluorescence, coinciding with the maximum number of SYPRO Orange binding sites exposed by thermal denaturation. No significant background fluorescence was observed in the absence of protein. Upon reaching the Tm, the fluorescence slowly decreased due to aggregation of the protein at higher temperatures [10]. It should also be noted that while this method reproducibly reveals the temperature at which the maximum fluorescence occurs, the magnitude of the signal exhibits a certain degree of variance. Given that the temperature increment for each melt curve was 1 °C, the resolution of the Tm reported herein is 1 °C. The data for each experiment is based on a number of replicates as indicated in the relevant figure legends. In all cases the deviation from the average was less than 1 °C.

Electrophoretic mobility shift assay

ICP8 was incubated with 5’-32P-labeled oligothymidylate as indicated in 10 µl containing 20 mM HEPES-NaOH, pH 7.5 and 150 mM NaCl for 10 min on ice. The reactions were supplemented with 3 µl loading buffer (final concentration: 40 mM Tris-acetate pH 7.6, 1 mM EDTA, 10% glycerol, 0.1% bromophenol blue and 0.1% xylene cyanol) and immediately subjected to electrophoresis through 4% polyacrylamide (bis:acrylamide ratio 29:1)-TBE gels at 100 V for two hours at room temperature. Following electrophoresis, the gels were dried onto DE81 chromatography paper (Whatman), analyzed and quantitated by storage phosphor analysis with a Molecular Dynamics Storm 820. DNA binding was calculated as a percentage of the bound probe over total radioactivity.

Results

ssDNA ligand increases the thermal stability of ICP8

In this study we adapted the thermal shift assay as described under Materials and Methods, to determine the Tm of ICP8 and to evaluate how its thermal stability is impacted by ssDNA ligand. Analysis of the melting curves shows an initial increase in SYPRO Orange fluorescence starting at 36 °C that gradually increases with temperature (see Fig. 4 for representative curves). In our studies, Tm is defined as the temperature with the highest fluorescence, coinciding with the maximum number of SYPRO Orange binding sites exposed by thermal denaturation. Under our experimental conditions, ICP8 exhibits a Tm of 45 °C.

Fig. 4.

Fig. 4

Open in a new tab

Effect of ciprofloxacin on ligand induced stabilization of the Tm of ICP8. Reactions were performed as described in Materials and Methods with 10 µM DNA20 (PBAZ49) (A) and DNA24 (PBAZ48) (B), in the absence or presence of 200 µM ciprofloxacin (Cipro) as indicated. (C) Dose-dependent reduction of ligand stabilization by ciprofloxacin. Reactions were performed as described in Materials and Methods with 10 µM PBAZ48 (24-mer) and the indicated concentrations of ciprofloxacin. ΔTm = change in Tm relative to that in the absence of ligand (45 °C). The data are the average of 2 separate acquisitions.

We wanted to examine whether ssDNA ligands can affect the thermal stability of ICP8. Given that ICP8 forms nucleoprotein filaments on ssDNA, we predicted that ssDNA oligomers capable of interacting with ICP8 would stabilize it and raise the Tm. Fig. 1 shows the effect on Tm of (dT) oligomers ranging from 5 to 60 nucleotides at 10 µM. Under the specified experimental conditions, the first detectable shift in Tm was with (dT)10 which raised the Tm by 1° to 46 °C. One interpretation of this finding is that a 10-mer oligomer represents the minimal length to which ICP8 can bind. This would be consistent with previous determinations of the binding site size of ICP8 [18,20,30]. The most quantitative of these studies using fluorescence anisotropy found that ICP8 has a binding site size of 10+/−1 nucleotides [18]. Interestingly, oligomers between 11 and 20 nucleotides elicited progressive increases in the Tm, with a maximum shift of 9 °C to 54 °C. Oligomers of 40 and 60 nucleotides had no further effect on the thermal stability of ICP8. Overall, these results show that ssDNA ligands can significantly change the thermal stability of ICP8 in a length-dependent manner, increasing its Tm by a maximum of 9 °C.

Fig. 1.

Fig. 1

Open in a new tab

Oligonucleotide length-dependent stabilization of the Tm of ICP8. Reactions were performed as described in Materials and Methods with 10 µM of the (dT) oligomers as indicated. ΔTm = change in Tm relative to that in the absence of ligand (45 °C). The data are the average of 9 separate acquisitions.

Characterization of the ssDNA binding properties of ICP8 using the thermal shift assay

In order to determine the dependence of the increase in Tm on the concentration of ssDNA ligand we performed titrations with the various (dT) oligomers ranging from (dT)5 to (dT)20. As shown in Fig. 2, each of the oligomers tested increased the Tm of ICP8 in a concentration-dependent manner, with oligomers ≥10 increasing Tm by 9 °C. Using these data, we estimate an apparent Kd for (dT)20 of <1 µM. Notably, using this approach we were able to demonstrate an interaction between ICP8 and oligomers less than 10 nucleotides. Thus, (dT)7 and (dT)9 were able to increase the Tm of ICP8 by 2 and 3 °C, respectively. In fact, even (dT)5 was capable of increasing the Tm of ICP8 by 1 °C, albeit at high concentrations (>50 µM). Consequently, these data indicate that ICP8 can indeed interact with ssDNA as short as 5 nucleotides in length, albeit with lower apparent affinity. To confirm this observation, the interaction of ICP8 with short oligomers was also examined using electrophoretic mobility shift assays (EMSA). Fig. 3A shows that in addition to the complexes formed with (dT)≥10, ICP8 was capable of forming weak complexes with both (dT)5 and (dT)7 and more so with (dT)9. Moreover, to validate the interaction with (dT)5, Fig.3B and 3C show that it was capable of challenging complexes of ICP8 formed with (dT)20 when present at a 1000-fold excess, albeit significantly more weakly than the competition achieved with (dT)10 and (dT)20, indicating that the affinity for (dT)5 must be several orders of magnitude less.

Fig. 2.

Fig. 2

Open in a new tab

Oligonucleotide concentration-dependent stabilization of the Tm of ICP8. Reactions were performed as described in Materials and Methods with the indicated concentrations of the various (dT) oligomers. ΔTm = change in Tm relative to that in the absence of ligand (45 °C). The data are the average of 2 separate acquisitions.

Fig. 3.

Fig. 3

Open in a new tab

Interaction of ICP8 with (dT) oligomers by gel mobility shift. (A) EMSA was performed as described in Materials and Methods with 1 nM of the various (dT) oligomers and 500 nM ICP8 as indicated. The positions of free (dT)n and of the ICP8-(dT)n complexes are as indicated. (B) ICP8-(dT)20 complexes formed with 1 µM ICP8 and 500 nM 5’-32P-labeled (dT)20 were competed with unlabeled (dT)5 (100, 250, 500, 1000, 2000, 4000 and 5000 nM), (dT)10 (25, 50, 100, 250, 500, 1000 and 2000 nM) and (dT)20 (25, 50, 100, 250, 500, 1000 and 2000 nM), as indicated and analyzed by EMSA as described in Materials and Methods. The positions of free (dT)20 and of the ICP8-(dT)20 complexes are as indicated. (C) Quantitation of the data in (B).

Application of the thermal shift assay to identify compounds that inhibit ssDNA binding

We wanted to investigate the utility and provide proof of principle that the thermal shift assay could be used as a screening tool to identify inhibitors of the ssDNA binding activity of ICP8. In this assay such compounds would prevent ligand induced thermal stabilization. In lieu of an inhibitor of the ssDNA binding activity of ICP8, which has thus far not been developed and in fact remains a long term goal that may be realized using this assay, we used ciprofloxacin as a compound that is known to specifically bind to ssDNA [31]. Hence, ciprofloxacin should prevent the interaction between ssDNA and ICP8. Therefore, two synthetic oligonucleotides (PBAZ48, 24-mer and PBAZ49, 20-mer) that contain a preferred ciprofloxacin binding site (5’ TGGCCT) [31], were used as ligands to evaluate their effect on the Tm of ICP8 in the absence and presence of ciprofloxacin. The data show that the concentration of ciprofloxacin used in this experiment (200 µM) had no effect on the Tm of ICP8 (Figs. 4A and 4B). Consistent with the (dT) oligomers used in the earlier experiments, both ciprofloxacin-target containing oligonucleotides increased the Tm by the maximum amount of 9° C (Figs. 4A and 4B). Significantly, in the presence of 200 µM ciprofloxacin, both oligonucleotide ligands were only able to increase the Tm by 2 °C, indicating that the drug prevented ligand induced stabilization of ICP8. Further analysis using the 24-mer PBAZ48 revealed a dose-dependent reduction in ligand stabilization with increasing ciprofloxacin concentration, stabilizing Tm by only 1 °C at 500 µM, with an apparent IC50 of ~80 µM (Fig. 4C). These findings support our notion that the thermal shift assay may be developed into a screen to identify compounds that prevent the ssDNA binding activity of ICP8 and likely other SSB.

Discussion

In this study we explored the utilization of the thermal shift assay as a platform to investigate the interaction of SSB with ssDNA, with a view of applying the assay to readily define the basic ssDNA binding properties of this class of protein, and notably as a high-throughput screen to identify ssDNA binding inhibitors with therapeutic potential. Our study focused on the SSB from HSV-1, the essential DNA replication protein ICP8. Thus, we developed the assay in multi-well microtiter plates using a fluorescence enabled thermal cycler to permit the rapid and quantitative evaluation of ssDNA ligands on the Tm of ICP8 by measuring SYPRO Orange fluorescence.

The thermal shift assay allowed us to determine several basic parameters that define the interaction of ICP8 with ssDNA. In summary, we found that ICP8 exhibits a Tm of 45 °C. Importantly, oligonucleotide ligands stabilized its Tm by a maximum of 9 °C in a length- and concentration-dependent manner. This increase in Tm indicates that ligand binding significantly stabilizes the structure of ICP8. Our data show that (dT)10 was the shortest oligonucleotide that provided the maximum increase in Tm. This observation indicates that 10 nucleotides represents the minimum length of ssDNA on which an ICP8 protomer can effectively assemble and is consistent with prior analysis that defined the site size of ICP8 as 10 nucleotides [18]. Interestingly, oligomers that contained multiple site size equivalents (20- and 60-mers) and therefore represent a platform on which ICP8 can form a nucleoprotein filament, did not increase the Tm beyond 9 °C. This suggests that the thermal shift assay may not be suitable for detecting stabilization induced as a consequence of cooperative protein-protein interactions as would occur in the context of the ICP8 nucleoprotein filament. Alternatively, the assay may be limited by the overall thermal stability of ICP8 such that it is functionally denatured at temperatures >54 °C. Notably, we observed increases in Tm in the presence of oligomers shorter than 10 nucleotides, with (dT)9, (dT)7 and (dT)5 increasing Tm by 3, 2 and 1 °C, respectively. This finding was confirmed by direct protein-DNA interaction measurements using EMSA, thereby demonstrating that ICP8 can in fact interact with ssDNA shorter than 10 nucleotides albeit with reduced apparent affinity. To our knowledge this is the first demonstration that ICP8 can bind oligonucleotides as short as 5 nucleotides. The thermal shift assay can also be used to extract information pertaining to the binding equilibrium. Hence, the apparent Kd of <1 µM for (dT)20 determined herein is comparable to the association constant determined by fluorescence anisotropy measurements (K = 0.55 × 106 M−1) [18]. Overall, the results obtained in this study using the thermal shift assay compare well to previously determined parameters using other biochemical and biophysical techniques. Consequently, this validates the application of the thermal shift assay as a technique to easily determine the basic ssDNA binding parameters of SSB including their site size and binding affinity with the advantage of being a rapid and potentially high-throughput method, utilizing SYPRO Orange as an environmentally sensitive dye.

A further objective of this study was to validate the use of the thermal shift assay as a screening tool to identify compounds that disrupt the ssDNA-SSB interaction. Particularly in the case of microbial SSB, such compounds could potentially be developed into novel antibacterial and antiviral agents. In our case using ICP8, the magnitude of ligand induced stabilization (9 °C increase in Tm) creates an excellent starting point to identify compounds that reduce or eliminate a ligand-dependent shift in Tm. Indeed, in lieu of a compound that blocks the ssDNA binding activity of ICP8, we took advantage of the sequence-dependent ssDNA binding activity of ciprofloxacin to prevent ICP8 from interacting with its ligand [31]. Our finding of a dose-dependent reduction in Tm stabilization by ciprofloxacin provides proof of concept that the thermal shift assay may be used as a screen to identify compounds that disrupt ssDNA-SSB interactions with potential therapeutic effect.

In closing, our findings using ICP8 support the proposed applications of the thermal shift assay, successfully meeting the objectives of this study. To our knowledge this is the first study to utilize the thermal shift assay to measure ligand induced changes in the Tm of a SSB.

Highlights.

  • Thermal shift assay to study ligand induced stabilization of SSB: HSV-1 ICP8

  • ICP8 exhibits a melting temperature (Tm) of 45 °C

  • Single-strand DNA ligands stabilize ICP8 by increasing its Tm by up to 9 °C

  • ICP8 is capable of interacting with ssDNA oligomers as short as 5 nucleotides

  • Drug induced reduction in Tm stabilization to screen for inhibitors of SSB

Acknowledgements

This work was supported by grant GM62643 from the National Institutes of Health.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1

Abbreviations used: EMSA, electrophoretic mobility shift assay; HSV, herpes simplex virus; ICP8, Infected Cell Polypeptide 8; SSB, single-strand DNA binding protein; ss, single-stranded; Tm, melting temperature

References

  • 1.Steinberg TH, Jones LJ, Haugland RP, Singer VL. SYPRO Orange and SYPRO Red Protein Gel Stains: One-Step Fluorescent Staining of Denaturing Gels for Detection of Nanogram Levels of Protein. Anal. Biochem. 1996;239:223–237. doi: 10.1006/abio.1996.0319. [DOI] [PubMed] [Google Scholar]
  • 2.Steinberg TH, Haugland, Singer VL. Applications of SYPRO Orange and SYPRO Red Protein Gel Stains. Anal. Biochem. 1996;239:238–245. doi: 10.1006/abio.1996.0320. [DOI] [PubMed] [Google Scholar]
  • 3.Lo MC, Aulabaugh A, Jin G, Cowling R, Bard J, Malamas M, Ellestad G. Evaluation of fluorescence-based thermal shift assays for hit identification in drug discovery. Anal. Biochem. 2004;332:153–159. doi: 10.1016/j.ab.2004.04.031. [DOI] [PubMed] [Google Scholar]
  • 4.Malawski GA, Hillig RC, Monteclaro F, Eberspaecher U, Schmitz AAP, Crusius K, Huber M, Egner U, Donner P, Muller-Tiemann B. Identifying protein construct variants with increased crystallization propensity––A case study. Protein Science. 2006;15:2718–2728. doi: 10.1110/ps.062491906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Layton CJ, Hellinga HW. Quantitation of protein–protein interactions by thermal stability shift analysis. Protein Science. 2011;20:1439–1450. doi: 10.1002/pro.674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Campagne S, Muller I, Milon A, Gervais V. Towards the classification of DYT6 dystonia mutants in the DNA-binding domain of THAP1. Nucleic Acids Res. 2012;40:9927–9940. doi: 10.1093/nar/gks703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Carette X, Blondiaux N, Willery E, Hoos S, Lecat-Guillet N, Lens Z, Wohlkonig A, Wintjens R, Soror SH, Frenois F, Dirie B, Villeret V, England P, Lippens G, Deprez B, Locht C, Willand N, Baulard AR. Structural activation of the transcriptional repressor EthR from Mycobacterium tuberculosis by single amino acid change mimicking natural and synthetic ligands. Nucleic Acids Res. 2012;40:3018–3030. doi: 10.1093/nar/gkr1113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Crowther GJ, He P, Rodenbough PP, Thomas AP, Kovzun KV, Leibly DJ, Bhandari J, Castaneda LJ, Hol WGJ, Gelb MH, Napuli AJ, Van Voorhis WC. Use of thermal melt curves to assess the quality of enzyme preparations. Anal. Biochem. 2010;399:268–275. doi: 10.1016/j.ab.2009.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pantoliano MW, Petrella EC, Kwasnoski JD, Lobanov VS, Myslik J, Graf E, Carver T, Asel E, Springer BA, Lane P, Salemme FR. High-density miniaturized thermal shift assays as a general strategy for drug discovery. J. Biomol. Screen. 2001;6:429–440. doi: 10.1177/108705710100600609. [DOI] [PubMed] [Google Scholar]
  • 10.Vedadi M, Niesen FH, Allali-Hassani A, Fedorov OY, Finerty PJ, Jr, Wasney GA, Yeung R, Arrowsmith C, Ball LJ, Berglund H, Hui R, Marsden BD, Nordlund P, Sundstrom M, Weigelt J, Edwards AM. Chemical screening methods to identify ligands that promote protein stability, protein crystallization, and structure determination. Proc. Natl. Acad. Sci. USA. 2006;103:15835–15840. doi: 10.1073/pnas.0605224103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ericsson UB, Hallberg BM, Detitta GT, Dekker N, Nordlund P. Thermofluor-based high-throughput stability optimization of proteins for structural studies. Anal. Biochem. 2006;357:289–298. doi: 10.1016/j.ab.2006.07.027. [DOI] [PubMed] [Google Scholar]
  • 12.Senisterra GA, Hong BS, Park H-W, Vedadi M. Application of High-Throughput Isothermal Denaturation to Assess Protein Stability and Screen for Ligands. J. Biomol. Screen. 2008;13:337–342. doi: 10.1177/1087057108317825. [DOI] [PubMed] [Google Scholar]
  • 13.Layton CJ, Hellinga HW. Thermodynamic Analysis of Ligand-Induced Changes in Protein Thermal Unfolding Applied to High-Throughput Determination of Ligand Affinities with Extrinsic Fluorescent Dyes. Biochemistry. 2010;49:10831–10841. doi: 10.1021/bi101414z. [DOI] [PubMed] [Google Scholar]
  • 14.Cornilleau C, Atmane N, Jacquet E, Smits C, Alonso JC, Tavares P, Oliveira L. The nuclease domain of the SPP1 packaging motor coordinates DNA cleavage and encapsidation. Nucleic Acids Res. 2013;41:340–354. doi: 10.1093/nar/gks974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Neuenfeldt A, Lorber B, Ennifar E, Gaudry A, Sauter C, Sissler M, Florentz C. Thermodynamic properties distinguish human mitochondrial aspartyl-tRNA synthetase from bacterial homolog with same 3D architecture. Nucleic Acids Res. 2013;41:2698–2708. doi: 10.1093/nar/gks1322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bernhards RC, Jing X, Vogelaar NJ, Robinson H, Schubot FD. Structural evidence suggests that antiactivator ExsD from Pseudomonas aeruginosa is a DNA binding protein. Protein Science. 2009;18:503–513. doi: 10.1002/pro.48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Quinn JP, McGeoch DJ. DNA sequence of the region in the genome of herpes simplex virus type 1 containing the genes for DNA polymerase and the major DNA binding protein. Nucleic Acids Res. 1985;13:8143–8163. doi: 10.1093/nar/13.22.8143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gourves AS, Tanguy Le Gac N, Villani G, Boehmer PE, Johnson NP. Equilibrium binding of single-stranded DNA with herpes simplex virus type I-coded single-stranded DNA-binding protein, ICP8. J. Biol. Chem. 2000;275:10864–10869. doi: 10.1074/jbc.275.15.10864. [DOI] [PubMed] [Google Scholar]
  • 19.Boehmer PE. RNA binding and R-loop formation by the herpes simplex virus type-1 single-stranded DNA-binding protein (ICP8) Nucleic Acids Res. 2004;32:4576–4584. doi: 10.1093/nar/gkh797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Boehmer PE, Lehman IR. Herpes simplex virus DNA replication. Annu. Rev. Biochem. 1997;66:347–384. doi: 10.1146/annurev.biochem.66.1.347. [DOI] [PubMed] [Google Scholar]
  • 21.Boehmer PE, Lehman IR. Replication of herpes simplex virus DNA. J. Biol. Chem. 1999;274:28059–28062. doi: 10.1074/jbc.274.40.28059. [DOI] [PubMed] [Google Scholar]
  • 22.Boehmer PE, Villani G. Herpes simplex virus type-1: a model for genome transactions. Prog. Nucleic Acid Res. Mol. Biol. 2003;75:139–171. doi: 10.1016/s0079-6603(03)75005-3. [DOI] [PubMed] [Google Scholar]
  • 23.Muylaert I, Tang K-W, Elias P. Replication and recombination of herpes simplex virus DNA. J. Biol. Chem. 2011;286:15619–15624. doi: 10.1074/jbc.R111.233981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Weller SK, Coen DM. Herpes simplex viruses: mechanisms of DNA replication. Cold Spring Harb. Perspect. Biol. 2012;4:a013011. doi: 10.1101/cshperspect.a013011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bortner C, Hernandez TR, Lehman IR, Griffith J. Herpes simplex virus 1 single-strand DNA-binding protein (ICP8) will promote homologous pairing and strand transfer. J. Mol. Biol. 1993;231:241–250. doi: 10.1006/jmbi.1993.1279. [DOI] [PubMed] [Google Scholar]
  • 26.Nimonkar AV, Boehmer PE. In vitro strand exchange promoted by the herpes simplex virus type-1 single strand DNA-binding protein (ICP8) and DNA helicase-primase. J. Biol. Chem. 2002;277:15182–15189. doi: 10.1074/jbc.M109988200. [DOI] [PubMed] [Google Scholar]
  • 27.Reuven NB, Staire AE, Myers RS, Weller SK. The herpes simplex virus type 1 alkaline nuclease and single-stranded DNA binding protein mediate strand exchange in vitro. J. Virol. 2003;77:7425–7433. doi: 10.1128/JVI.77.13.7425-7433.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nimonkar AV, Boehmer PE. The Herpes Simplex Virus Type-1 Single-strand DNA-binding Protein (ICP8) Promotes Strand Invasion. J. Biol. Chem. 2003;278:9678–9682. doi: 10.1074/jbc.m212555200. [DOI] [PubMed] [Google Scholar]
  • 29.Boehmer PE, Lehman IR. Physical interaction between the herpes simplex virus 1 origin-binding protein and single-stranded DNA-binding protein ICP8. Proc. Natl. Acad. Sci. USA. 1993;90:8444–8448. doi: 10.1073/pnas.90.18.8444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mapelli M, Panjikar S, Tucker PA. The crystal structure of the herpes simplex virus 1 ssDNA-binding protein suggests the structural basis for flexible, cooperative single-stranded DNA binding. J. Biol. Chem. 2005;280:2990–2997. doi: 10.1074/jbc.M406780200. [DOI] [PubMed] [Google Scholar]
  • 31.Noble CG, Barnard FM, Maxwell A. Quinolone-DNA interaction: sequence-dependent binding to single-stranded DNA reflects the interaction within the gyrase-DNA complex. Antimicrob. Agents Chemother. 2003;47:854–862. doi: 10.1128/AAC.47.3.854-862.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES