Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Dec 1.
Published in final edited form as: Mol Cancer Ther. 2014 Oct 15;13(12):3163–3174. doi: 10.1158/1535-7163.MCT-14-0317

Involvement of microRNA-24 and DNA Methylation in Resistance of Nasopharyngeal Carcinoma to Ionizing Radiation

Sumei Wang 1,2, Rong Zhang 1,3, Francois X Claret 2,4,*, Huiling Yang 1,*
PMCID: PMC4258432  NIHMSID: NIHMS635301  PMID: 25319395

Abstract

Nasopharyngeal carcinoma (NPC) is a malignant tumor originating in the epithelium. Radiotherapy is the standard therapy, but tumor resistance to this treatment reduces the 5-year patient survival rate dramatically. Studies are urgently needed to elucidate the mechanism of NPC radioresistance. Epigenetics — particularly microRNAs (miRNAs) and DNA methylation — plays an important role in carcinogenesis and oncotherapy. We used qRT-PCR analysis and identified a miRNA signature from differentially expressed miRNAs. Our objectives were to identify the role of miR-24 in NPC tumorigenesis and radioresistance and to identify the mechanisms by which miR-24 is regulated. We found that miR-24 inhibited NPC cell growth, promoted cell apoptosis, and suppressed the growth of NPC xenografts. We showed that miR-24 was significantly downregulated in recurrent NPC tissues. When combined with irradiation, miR-24 acted as a radiosensitizer in NPC cells. One of the miR-24 precursors was embedded in a CpG island. Aberrant DNA methylation was involved in NPC response to radiotherapy, which linked inactivation of miR-24 through hypermethylation of its precursor promoter with NPC radioresistance. Treating NPC cells with the DNA-hypomethylating agent 5-aza-2′-deoxycytidine compensated for the reduced miR-24 expression. Together, our findings showed that miR-24 was negatively regulated by hypermethylation of its precursor promoter in NPC radioresistance. Our findings defined a central role for miR-24 as a tumor-suppressive miRNA in NPC and suggested its use in novel strategies for treatment of this cancer.

Keywords: nasopharyngeal carcinoma, methylation, microRNA, radioresistance

Introduction

Nasopharyngeal carcinoma (NPC) is a non-lymphomatous squamous cell carcinoma that occurs in the epithelial lining of the nasopharynx. This Epstein-Barr virus (EBV)-associated epithelial malignancy is prone to local invasion and early distant metastasis. NPC is prevalent in Southern China, especially in the Cantonese region around Guangzhou, where the incidence is approximately 30-80/100 000 persons per year (1-3). Studies have shown that a variety of genetic, ethnic, and environmental factors contribute to the development of NPC (1, 4-6). Radiotherapy is the standard treatment for NPC. However, the tumor often develops resistance to ionizing radiation (IR) and the relapse rate is as high as 82%, so radioresistance is a major cause of treatment failure (7, 8), leading to incomplete cure, recurrence, or metastasis. Once NPC reoccurs or metastasizes, patients have a very limited 5-year survival rate. Therefore, understanding the mechanism of NPC radioresistance is urgently needed to improve the effectiveness of NPC therapy and patient survival rates.

The role of epigenetic modification, especially the microRNAs (miRNAs or miRs) and DNA methylation, has been extensively explored in the pathogenesis of cancer (9-11). First discovered as a mechanism of gene regulation in Caenorhabditis elegans, miRNAs are a class of endogenous non-coding RNA molecules about 22 nucleotides in length (12, 13) and may regulate more than 60% of genes in multicellular eukaryotes (14, 15). MiRNAs control gene expression by binding to the 3′ untranslated region (UTR), 5′ UTR, or coding region of messenger RNAs (mRNAs), leading to mRNA degradation or translational repression (16). Many miRNAs exist in clusters, such as miR-23~27~24. Three fourths of the miRNA genes in the database miRBase R19 are assigned to miRNA families (17).

Of particular interest to us are the genomic loci miR-24-1 and miR-24-2, which encode the miR-24 precursor transcripts pre-miR-24-1 (MI0000080, from miRBase, located on chromosome 9q22.32) and pre-miR-24-2 (MI0000081, chromosome 19p13.13). Processing of the precursor transcripts by the enzyme Dicer generates three mature miRNAs: miR-24-3p (MIMAT0000080) from the 3′ ends of both precursors, and miR-24-1-5p (MIMAT0000079) and miR-24-2-5p (MIMAT0004497) from the 5′ ends of pre-miR-24-1 and pre-miR-24-2, respectively. Many studies have indicated a central regulatory role for miRNAs in the initiation and development of NPC. However, the role of miR-24 in NPC or therapy is still unknown.

DNA methylation plays a major role in the transcriptional silencing of certain genes but especially tumor-suppressive genes. Generally, the DNA methylation process is catalyzed by DNA methyltransferases (DNMTs), mainly DNMT1 (maintenance DNMT) and DNMT3A and DNMT3B (de novo DNMTs), which use S-adenosylmethionine as a methyl donor to specifically methylate the fifth carbon atom of the cytosine ring (18). Methylation-mediated silencing of tumor-suppressive genes, genome-wide DNA hypomethylation (which induces chromosomal instability), and spurious gene expression contribute to carcinogenesis (19, 20). MiRNAs harboring CpG islands can be directly targeted by DNA hypermethylation (21, 22). Kozake et al (23) reported that miR-199-5b was downregulated in medulloblastomas by methylation of a CpG island 3 kb upstream of the 5′ site of the miR-199b-5p promoter, and Lukas et al (24) demonstrated that epigenetic mechanisms are involved in the regulation of miR-200c/141 expression in both normal and cancer cells. The fact that the U.S. Food and Drug Administration has approved hypomethylating agents such as 5-aza-2′-deoxycytidine for use as anticancer agents indicates the potential for modification of DNA methylation in cancer treatment (25, 26). Although studies have demonstrated the crucial role of DNA methylation in NPC carcinogenesis, the mechanisms by which DNA methylation contributes to NPC radioresistance have yet to be elucidated.

We previously established a radioresistant NPC cell line, CNE-2R, from the parental CNE-2 cell line by high- and gradient-dose IR treatment. These two cell lines differed only in their sensitivity to irradiation but not other cytotoxic agents. We then used qRT-PCR analysis to search for miRNAs differentially expressed between CNE-2 and CNE-2R cells and identified a set of 8 miRNAs, including miR-24, that were significantly different (27). The objectives of our current study were to identify the role of miR-24 in NPC tumorigenesis and radioresistance and to identify the mechanisms by which miR-24 is regulated. Here, we used quantitative real-time polymerase chain reaction (qRT-PCR) to detect miRNA expression; cytosine-extension assay, methylation DNA immunoprecipitation sequencing (MeDIP-Seq), and methylation-specific PCR (MSP) to measure methylation status; and flow cytometry and western blotting to assess the cell cycle, apoptosis, and protein expression. Our results support the idea of novel biomarkers for NPC and will facilitate the development of improved therapeutic approaches for NPC patients.

Materials and Methods

Patient samples

NPC specimens were obtained from patients according to a study protocol approved by the institutional human tissue committee of the Cancer Center of Sun Yat-Sen University in 2011 and 2012. Full, informed consent was obtained from each patient before sample collection. Specimens were obtained by surgical resection and snap-frozen in liquid nitrogen. Primary NPC tumors from patients were diagnosed as NPC prior to any therapy, and recurrent NPC tumors were diagnosed as NPC reoccurring after radiotherapy. NPC primary and recurrent tissues were matched by sex and similar age. Information about these patients is provided in Supplementary Table 1.

Cell lines and cell culture

Human NPC cell lines: CNE-1 (well-differentiated) and CNE-2 (poorly differentiated) were purchased from the Cancer Center of Sun Yat-Sen University, China in 2006, and were not authenticated by us; CNE-2R cells (derived from the parental cell line CNE-2, radioresistant), were established by our group in 2009 (27); and HONE-1 cells (poorly differentiated) were a generous gift 2010 from Prof. Ronald Glaser (Ohio State University Medical Center, USA) and were not authenticated by us. All cells were maintained in RPMI 1640 medium (Mediatech, Inc.) containing 10% fetal bovine serum (Gibco) and 0.5% penicillin-streptomycin sulfate. Cells were stained with trypan blue and counted using the automated cell counter Countess (Invitrogen).

Quantitative real-time polymerase chain reaction (qRT-PCR)

qRT-PCR was used to detect miRNA and H2AX expression. Cells were washed twice in cold phosphate-buffered saline (ThermoScientific) before being harvested with trizol (Ambion). A NanoDrop Lite spectrophotometer (Thermo Scientific) was used to measure the total RNA concentration and purity. For detection of mature miRNA, reverse transcription was performed to convert RNAs to cDNAs using a Taqman miRNA reverse-transcription kit (Applied Biosystems) and miRNA-specific stem-loop reverse transcription primers by a thermal cycler (Bio-Rad) in one reaction. For H2AX detection, reverse transcription was performed using an ImProm-II transcription system kit (Promega). Finally, PCR reaction mixtures containing TaqMan universal master mix II or SYBR Green PCR master mix (for miRNA and H2AX, respectively) and TaqMan miRNA or gene expression assays (all from Applied Biosystems) were used according to the manufacturer's protocols (gradient S; Mastercycler, Eppendorf) with the software Realplex. Cycling variables were as follows: 50°C for 2 min and 95°C for 10 min followed by 40 cycles at 95°C (15 s) and annealing/extension at 60°C (1 min). All reactions were performed in triplicate. Data were analyzed with 2−ΔΔCt for relative change in gene expression. U6 snRNA served to normalize miRNA values. GAPDH served to normalize H2AX values.

Colony-formation assay

The colony-formation assay was employed to analyze cell growth after treatment with IR or miR-24 mimic. NPC cells were plated onto 6-well or 12-well plates after irradiation or miR-24 mimic transfection. The medium was changed after irradiation for 24 hours or 48 hours after transfection. After 10 days, cell colonies were fixed with methanol, stained with 0.1% crystal violet, and scored by counting the number of colonies with an inverted microscope, using the standard definition that a colony consists of 50 or more cells. The inhibition ratios of colony formation were calculated as the ratio of the indicated treatment group to the control group: 100% * Nt/Nc, where Nt is the colony number of the treatment group and Nc is the colony number of the control group.

MicroRNA (miRNA) transfection

MirVana miR-24 mimics or miRNA inhibitor (Ambion) was transfected into NPC cells to overexpress or inhibit mature miR-24-3p. Exponentially growing NPC cells were plated onto 6-well plates using medium without antibiotics 24 hours before transfection. miR-24 mimics, miRNA inhibitor, or scramble control (Ambion) was transfected using Lipofectamine 2000 (Invitrogen) as a carrier at a 1:1 ratio.

Flow cytometric analysis of cell cycle and apoptosis

Briefly, NPC cells were collected 48 hours after transfection with miR-24 mimic or scramble control. Cells were stained with an Annexin VFITC apoptosis detection kit I (BD Biosciences) and propidium iodide (PI; Sigma-Aldrich) according to the manufacturer's recommendations. For cell cycle detection, cells were collected and fixed overnight at −20°C. Samples were measured with a FACScan flow cytometer (Becton Dickinson), and results were analyzed using FlowJo software.

Mice model

Both flanks of 4- to 6-week-old male BALB/c athymic nu/nu mice were subcutaneously injected with 50 μl of 1.5×106 NPC CNE-2R cells and 50 μl of Matrigel (BD Biosciences). Forty-eight hours later, all mice were transfected with miR-scramble (injected into the left flank) or with miR-24 mimic (injected into the right flank) for 48 hours before injection. Tumors were measured on the fifth day after NPC cell injection, when tumors were palpable. Tumors were measured every other day with digital calipers, and tumor volume was calculated using the formula: mm3 = (L×W2)/2. Mice were sacrificed on the sixteenth day after injection, when the some of the tumors reached the size limit set by IACUC. Mice were killed by CO2 asphyxiation, and tumors were weighed after careful resection.

Irradiation

Radiation was performed using a Gammacell 1000 machine (Nordion), a 131I irradiator at The University of Texas MD Anderson Cancer Center. Cells were suspended in cell medium before irradiation. The irradiation rate was 283 rads/min.

Cell proliferation assay

The cell proliferation assay was used to evaluate cell viability with thiazolyl blue tetrazolium bromide (MTT; Sigma-Aldrich). Briefly, NPC cells were seeded into 96-well plates after irradiation in 200 μl of RPMI 1640. For 5-aza-2′-deoxycytidine treatment, cells were plated into 96-well plates 24 hours before 5-aza-2′-deoxycytidine was added. After the indicated incubation period, MTT (5 mg/ml) was added, the cells were incubated at 37°C for 24 hours, and 10 μl of the solubilization reagent 10% SDS was added to each well. Spectrophotometric absorbance of the samples was measured at 570 nm with a microplate reader (Molecular Devices) after an additional 4 hours of incubation. The inhibition ratios of cell survival were calculated as: 100% * Nt/Nc, where Nt is the optical density of the treatment group and Nc is the optical density of the control group.

Cytosine extension assay

Cytosine extension assay was performed to detect genome-wide methylation status as previously described by Pogribny (28). Briefly, genomic DNA was pretreated with HpaII (New England Biolabs) following the manufacturer's protocol. A second DNA aliquot incubated without restriction enzyme served as the background control. The single-nucleotide extension reaction was performed in a 25-μl reaction mixture containing 0.25 μg of DNA, 1× PCR buffer II, 1.0 mM MgCl2, 0.25 units of AmpliTaq DNA polymerase (Perkin Elmer), and 57.4 Ci/mmol [3H]dCTP (DuPont NEN) and incubated at 56°C for 1 hour. Results are displayed as percent change from control samples.

Methylated DNA immunoprecipitation sequencing (MeDIP-Seq)

MeDIP-Seq was performed to compare alterations in the DNA methylation patterns in the CNE-2 and CNE-2R cell lines. Jacinto et al (29) first reported this method for mapping methylation profiles to better understand the implications of methylation changes in the regulation of gene expression. Briefly, DNA was fragmented by ultrasonic waves, modified at the 3′ terminal end by adding adenine using an Illumina paired-end DNA sample prep kit, and then denatured. The 5-methylcytosine antibody was then added for immunoprecipitation using a Diagenode magnetic methylated DNA immunoprecipitation kit to enrich methylated DNA fragments, which was followed up with high-throughput sequencing. Data were ultimately analyzed using standard bioinformatic analysis, which was performed for comparison to the personalized analysis (30). In brief, sequencing data were filtered to get clean data, followed by a comparative analysis. The unique mapped reads (by an alignment analysis between MeDIP-seq data and the reference genome) were used to analyze the genome and the distribution of gene elements. A comparison analysis was performed for the peak coverage at different gene elements to identify the differentiated genes between two samples (p≤0.05), followed by the Go and Pathway analyses (31).

Methylation-specific polymerase chain reaction (MSP)

MSP was performed to analyze the methylation of the miR-24-1 promoter in NPC cells with or without irradiation. Briefly, DNA samples were extracted with a PureLink genomic DNA mini kit (Invitrogen), converted with an EpiTect bisulfite kit (Qiagen) following the manufacturer's protocol, and amplified by PCR using methylated and unmethylated specific primers for miR-24-1. By bisulfite conversion, non-methylated cytosines were transformed into uracils and methylated cytosines remained unconverted. PCR products were subsequently electrophoresed by 1.5% agarose gel stained with GelRed nucleic acid (Biotium) and finally exposed to ultraviolet radiation.

Two sets of miR-24-1 primers were designed with MethPrimer software (32): left methylated primer, ATTATGTGTTAGGAAAGGGAAAC; right methylated primer, CTATATACCGCCAACCCGTC; left unmethylated primer, ATTATGTGTTTAGGAAAGGGAAAT; and right unmethylated primer, ACAATCTATATACCACCAACCCATC.

Experiment with 5-aza-2′-deoxcycytidine

The DNA-hypomethylating drug 5-aza-2′-deoxycytidine (Sigma-Aldrich) was used to verify the DNA methylation regulation of NPC cells. Briefly, NPC cells were plated onto 60-mm dishes or 96-well plates 24 hours before treatment with 5-aza-2′-deoxcycytidine. Acetic acid (50%) was used to dissolve the 5-aza-2′-deoxcycytidine, and the control group was treated with the same amount of 50% acetic acid as the 10 μM 5-aza-2′-deoxcycytidine. RNA was isolated 96 hours after treatment with 5-aza-2′-deoxcycytidine to examine miR-24 and H2AX expression.

Statistical analysis

Statistical analysis was performed using SPSS statistical software (Chicago). Data are presented as the mean ± standard deviation. Statistical analyses were performed by one-way analysis of variance when there were more than two groups. The Student t test was used when there were only two groups. The statistical significance level was set as p=0.05 (two sided). Differences between groups were considered to be significant statistically when p≤0.05.

Results

MiR-24 is involved in NPC radioresistance

The radioresistant NPC cell line CNE-2R was established with an escalating dose of IR over 12 months from the parental cell line CNE-2 (Supplementary Fig. S1A) before the current study was initiated. We used microarray and qRT-PCR analysis to search for miRNAs differentially expressed in CNE-2 and CNE-2R cells (Supplementary Fig. S1B). We identified 14 miRNAs whose expression differed by a factor of 2 or more (p<0.01) between the two cell lines and designated the gene set as the radioresistant miRNA signature (Supplementary Table 2). qRT-PCR was performed to verify miRNA expression, and 8 of the 14 miRNAs were identified to be significantly altered, where 5 miRNAs were downregulated (miR-24, miR-18a, miR-19b, miR-93 and miR-103) and 3 miRNAs were upregulated (miR-205, miR-224 and let 7g) in CNE-2R cells (Supplementary Fig. S1C) (27).

We next measured the expression levels of these 8 miRNAs in 6 pairs of matched NPC patient samples. As shown in Fig. 1A (heat map) and 1B (bar graph), out of all 6 pairs, only mature miR-24 had consistently reduced expression (around 50%) in recurrent NPC tissues compared with primary NPC tissues. Therefore, we focused on investigating the potential role of miR-24 in regulating the sensitivity of NPC to IR.

Figure 1. MiR-24 expression is positively correlated with the sensitivity of NPC to IR.

Figure 1

Open in a new tab

A, MiRNA signature in NPC tissues. Heat map of 8 miRNAs expressed differentially in 6 pairs of matched NPC primary and recurrent tissues. Lowest expression is represented by green and highest expression by red. Data were normalized to the median value by log2 before mapping using software programs Cluster and TreeView. B, Bar graphs of miR-24 differential expression levels between the 6 pairs of matched NPC recurrent tissues compared to primary tissues, as determined by qRT-PCR. Raw data were analyzed with 2−ΔΔCt. U6 snRNA was used as an internal control. C, Characterization of NPC cell lines. CNE-2, CNE-2R, CNE-1 and HONE-1 cells were exposed to IR (0, 2, or 4 Gy) and colony-formation assay was measured at 24 hours. In a dose-dependent manner, CNE-2R cells were more resistant to radiation than CNE-2 cells (left panel) and HONE-1 cells were more resistant than CNE-1 cells (right panel). The colony ratio (%) is relative to 0 Gy. Data represent mean ± s.d. of 3 independent experiments. D, Relative miR-24 expression levels of NPC radioresistant cell lines (CNE-2R and HONE-1) compared with radiosensitive cell lines (CNE-2 and CNE-1) as determined by qRT-PCR. miR-24 expression levels in CNE-2R and HONE-1 cells were normalized to those of CNE-2 and CNE-1 cells, respectively. Data represent mean ± s.d. of 3 independent experiments. **, p<0.01; ***, p<0.001.

To investigate the involvement of miR-24 in NPC radioresistance, we first examined the radiosensitivity of the NPC cell lines. As expected, after 24 hours of exposure to 4 Gy, the CNE-2R cell line maintained relative radioresistance: it retained 27% of its colonies whereas the CNE-2 cell line had only 3% of its colonies (Fig. 1C). Interestingly, the HONE-1 cell line displayed a radioresistant phenotype compared with the CNE-1 cell line (Fig. 1C). qRT-PCR demonstrated that the miR-24 expression level was more than 50% lower in the NPC radioresistant CNE-2R and HONE-1 cells than in the CNE-2 and CNE-1 cells, respectively (Fig. 1D). Our findings showed that miR-24 was downregulated both in recurrent NPC tissue samples and in relatively radioresistant NPC cells, implicating miR-24 in NPC radioresistance.

MiR-24 suppresses cell growth in vitro and reduces tumor growth in mouse models

Because miR-24 expression correlated positively with NPC radiosensitivity, we next investigated the role of miR-24 in NPC by overexpressing miR-24 using miR-24 mimics (Fig. 2A). NPC cells transfected with miR-24 mimics exhibited significant cell growth inhibition. Cell survival was greatly inhibited in all four NPC cell lines (CNE-2, CNE-2R, CNE-1 and HONE-1) (Fig. 2B). The relatively radioresistant cell lines CNE-2R and HONE-1 were much more inhibited than the CNE-2 and CNE-1 cell lines, respectively. We used the clonogenic assay to evaluate the oncogenic potential of this miRNA. Colony-formation ability was significantly suppressed in NPC cells by overexpression of miR-24; CNE-2R cells in particular were completely suppressed with 30 nM miR-24 mimic (Fig. 2C). Interestingly, both cell survival and clonogenic assay results revealed that the CNE-2R cell line was the most sensitive to miR-24 overexpression.

Figure 2. MiR-24 functions as a growth inhibitory factor in NPC cells and xenografts.

Figure 2

Open in a new tab

A, Verification by qRT-PCR of miR-24 expression after transfection with miR-24 mimic (10, 30, or 60 nM) or control (scramble, Scr) for 48 hours. Data represent mean ± s.d. of 3 independent experiments. B, Cell numbers were determined with an automated cell counter 48 hours after transfection with miR-24 mimic (10, 30, or 60 nM). Data are normalized to Scr and represent mean ± s.d of 3 independent experiments. C, Effects of overexpression of miR-24 on the clonogenic ability of CNE-2, CNE-2R, CNE-1, and HONE-1 cells. Representative examples of colony-formation assays in CNE-1, HONE-1, CNE-2 and CNE-2R cells (top panel). Percentage of colonies treated with miR-24 mimic (10 or 30 nM) relative to colonies treated with scramble control (bottom panel). Data represent mean ± s.d of 3 independent experiments. D, Representative results of cell apoptosis assay by flow cytometry in NPC cells (left panel). Red numbers indicate percentages of apoptosis. Quantification of the percentage of apoptotic cells (right panel) was shown. Data represent mean ± s.d of 3 independent experiments. E, Representative results of flow cytometry with PI staining after transfection with 30 nM miR-24 mimic and scramble control (left panel). Sub-G1 cell percentages and G2-M/S ratios are shown in red. Bar charts show the percentage of sub-G1 cells (middle panel) and ratio of C2-M/S cells (right panel) in CNE-2R and HONE-1 cells. Data represent mean ± s.d of 3 independent experiments. ***, p<0.001 versus scramble. F, miR-24 suppresses tumor growth of NPC xenografts. In vivo experiment illustrating the injection of radioresistant NPC (CNE-2R) cells stably expressing miR-24 or miR-scramble into nude mice. Tumor size is reported as mean tumor volume ± s.d for each group of six mice (left panel). Mice with tumors and resected tumors are shown in middle panel. Red arrow: miR-24–overexpressing group injected in right flank. Blue arrow: miR-scramble group injected in left flank. Bar graph: tumor weight of the two treatment groups (right panel). NS, not significant; *, p<0.05; **, p<0.001, ***, p<0.0001.

Using flow cytometry, we next measured the rate of cell apoptosis in NPC cells overexpressing miR-24. A significant induction of apoptosis was observed in both the early and late stages in a dose-dependent manner in all NPC cells transfected with miR-24 mimics (Fig. 2D). Consistently, cell apoptosis was induced the most in CNE-2R cells, indicating the best response of CNE-2R to miR-24 overexpression. Cells were then stained with only PI for measuring the percentage of sub-G1 cells (Fig. 2E). A significant increase (p<0.0001) in sub-G1 cells was observed in all NPC cell lines (data not shown for CNE-2 and CNE-1 cells).

To confirm the role of miR-24 in suppressing cell growth in vivo, the miR-24 stably expressing NPC CNE-2R cells and the miR-scramble vector (control) were subcutaneously injected into the right and left flanks of mice, respectively. On days 12 and 16, the mean size of the tumors from mice injected with miR-24–expressing cells was significantly smaller (67% and 74%, respectively) than that of mice injected with miR-scramble (Fig. 2F). Taken together, the data suggested that miR-24 expression of NPC CNE-2R cells is associated with tumor reduction. We found that miR-24 inhibited the growth of NPC cancer cell xenografts. Taken together, these results indicate a potential tumor-suppressive role for miR-24 in NPC cells.

MiR-24 is a potential radiosensitizor in NPC cells

Considering the role of miR-24 in NPC cells and the involvement of miR-24 in NPC radioresistance, we hypothesized that miR-24 can alter cellular sensitivity to IR in NPC. The cell cycle is a critical process during radiotherapy. Cells in the G2/M phase tend to be the most sensitive to irradiation among all the cell-cycle phases, whereas cells in the S phase tend to resist irradiation the most. Fig. 2E showed a significant increase in the ratio of G2/M phase to S phase in HONE-1 and CNE-2R miR-24–treated cells than in cells treated with control scramble miR (ratios: 2.3 and 2.5 vs 1.7 and 1.8, respectively; p<0.001 for each cell line).

As was shown in Fig. 2C, CNE-2 and HONE-1 cells were less sensitive to miR-24 overexpression than were CNE-2R and CNE-1 cells, respectively. To determine the role of miR-24 under IR, we combined IR with miR-24 mimics to re-assess colony formation. Our results showed that colony formation dropped from 84% to 18% in CNE-2 cells and from 86% to 14% in HONE-1 cells when treated with 2 Gy IR compared to scramble groups (Fig. 3A).

Figure 3. MiR-24 increases radiosensitivity of NPC cells.

Figure 3

Open in a new tab

A, Representative colony-formation assay results following transfection with miR-24 mimics (10 nM) or scramble control and combined with 2-Gy irradiation treatments. Data represent mean ± s.d. of 3 experiments. B, Representative results of cell apoptosis assay by flow cytometry stained with PI and FITC Annexin V (left panel). Apoptosis percentages appear in red. Quantification of apoptotic cells shows the fold of miR-24 mimics (10 nM) to control group (right panel). Data represent mean ± s.d. of at least 3 independent experiments. NS, not significant; **, p<0.001, ***, p<0.0001.

Moreover, in miR-24–overexpressing cells, compared with no IR, 10-Gy IR increased the rate of cell apoptosis from 1.24-fold to 2.10-fold in CNE-2R cells, from 1.17-fold to 1.45-fold in HONE-1 cells, from 1.48-fold to 1.77-fold in CNE-2 cells, and from 1.60-fold to 1.64-fold in CNE-1 cells (Fig. 3B). These data indicate that, compared with the radiosensitive cell lines (CNE-2 and CNE-1), the radioresistant cell lines (CNE-2R and HONE-1) exhibit higher sensitivity under IR treatment when combined with miR-24 mimics. These data demonstrated that miR-24 could sensitize NPC cells to IR treatment.

Inhibition of miR-24 expression increases H2AX in NPC cells

To reveal how miR-24 functions in NPC, we inhibited its endogenous expression using a miR-24 inhibitor. QRT-PCR revealed that the miR-24 level was remarkably decreased in all four NPC cell lines, as we expected (Fig. 4A). The histone variant H2AX is a key DSB repair protein that has been proven to be a target of miR-24 in HepG2 cells (33). They demonstrated that miR-24 up-regulation reduces H2AX and thereby renders them vulnerable to DNA damage. Consistent with their results, in our NPC model, H2AX was upregulated in a dose-dependent manner upon miR-24 inhibition with increasing doses of miR-24 inhibitor in all four NPC cells (Fig. 4B). This finding indicate a possible mechanism by which miR-24 is involved in the response to radiotherapy of NPC cells, strongly supporting our hypothesis that miR-24 is crucial in NPC radioresistance.

Figure 4. Loss of miR-24 impairs cell apoptosis and promotes DNA damage repair.

Figure 4

Open in a new tab

A, miR-24 expression levels as determined by qRT-PCR following transfection with a miR-24 inhibitor (10, 30, or 60 nM) or scramble-miR (10 nM) as a control in NPC cells for 48 hours. Data represent mean ± s.d of 3 independent experiments. B, qRT-PCR results of H2AX expression at mRNA levels by transfecting with a miR-24 inhibitor (10, 30, or 60 nM) or scramble control (10 nM). GAPDH served as an internal control. Data represent mean ± s.d. of 3 independent experiments. *, p<0.05; **, p<0.001, ***, p<0.0001.

Hypermethylation of mir-24-1 contributes to NPC radioresistance

It is well documented that radiation can induce global genome DNA hypomethylation, leading to genome instability (34). However, the role of methylation in NPC radioresistance is still unknown. Thus, we evaluated whether differences in DNA methylation could be observed between CNE-2 and CNE-2R cells. The genome-wide methylation level was approximately 30% lower in CNE-2R cells than in CNE-2 cells (Supplementary Fig. S2), indicating that DNA methylation is indeed involved in NPC radioresistance.

To confirm the role of DNA methylation in NPC radioresistance, we next used MeDIP-Seq to analyze the methylation pattern of CNE-2 and CNE-2R cells. Our data showed that the methylation pattern of hundreds of genes had altered at the gene function elements, including the upstream 2K sequence, 5′ UTR, coding sequence, intron, 3′ UTR, and downstream 2K sequence (Supplementary Fig. S3A, Supplementary Table 3). We next analyzed the gene methylation patterns that differed between the two cell lines by Go and Pathway analysis. We found that these genes were involved in almost all biological functions, including biological processes, cellular components, and molecular functions (Supplementary Fig. S3B). To be more specific, genes involved mainly in biological regulation, cellular processes, metabolic processes, cell parts, and molecular binding were dysregulated in DNA methylation patterns. Clearly, altered DNA methylation is associated with NPC radioresistance.

Because both DNA methylation and miR-24 appear to be associated with NPC radioresistance, we hypothesized that loss of miR-24 in recurrent NPC is regulated by DNA methylation. Mature miR-24-3p is cleaved from its precursor mir-24-1 and mir-24-2, which are located at chromosomes 9q22.32 and 13.13, respectively; only mir-24-1 was embedded in a CpG island (Supplementary Fig. S4). We used MethPrimer software to analyze the CpG island area of the 2K upstream sequence of the mir-24-1 promoter. From this analysis, we designed the primers for methylation detection in the region of the mir-24-1 promoter by MSP.

Methylation status was measured in the two pairs of radioresistant and radiosensitive cell lines (CNE-2 and CNE-2R, and CNE-1 and HONE-1). Interestingly, the miR-24-1 promoter was hypermethylated in both radioresistant cell lines (CNE-2R and HONE-1) compared with the corresponding radiosensitive cell lines (CNE-2 and CNE-1, respectively) (Fig. 5A). Combined with our previous data shown in Fig. 1D, this finding revealed an inverse correlation between mir-24-1 promoter methylation status and mature miR-24 expression. We next measured the methylation status of the mir-24-1 promoter and found that it was hypermethylated after IR treatment in a dose-dependent manner in all four NPC cell lines (Fig. 5B). These findings suggested that hypermethylation of the mir-24-1 promoter is associated with the response of NPC cells to IR. In addition, a decrease level of miR-24 expression was measured under IR treatment in a dose-dependent manner (Fig. 5C), conforming the inverse correlation between mir-24-1 promoter methylation status and miR-24 expression under IR treatment.

Figure 5. Promoter of mir-24-1 is hypermethylated in NPC radioresistant cells.

Figure 5

Open in a new tab

A, Representative MSP results of methylation status of the mir-24-1 promoter in NPC cell lines. M: methylated primers; U: unmethylated primers. B, Representative MSP results of the mir-24-1 promoter methylation status after IR (0, 5, or 10 Gy) treatment in NPC cells were shown. Data were quantified by Image J software. C, QRT-PCR results of miR-24 expression after IR treatment (0, 5, or 10 Gy) for 24 hours were shown. Data represent mean ± s.d. of 3 independent experiments. *, p<0.05; **, p<0.001, ***, p<0.0001.

5-Aza-2'-deoxycytidine treatment can increase miR-24 expression in NPC cells

As we noted, mature miR-24 was inversely correlated with the methylation status of the mir-24-1 promoter, and this promoter was significantly hypermethylated after IR treatment. To better determine the regulation of miR-24 by DNA methylation, we used 5-aza-2′-deoxycytidine to analyze the effect of demethylation on miR-24. The reduced miR-24 expression was compensated for by hypomethylation in a dose-dependent manner, which provided solid evidence that miR-24 inhibition could be regulated by hypermethylation of its promoter (Fig. 6A). Furthermore, inhibition of H2AX expression and NPC cell growth was observed after 5-aza-2′-deoxycytidine treatment and miR-24 compensation, which was consistent with the role of DNA damage repair in miR-24–mediated function in NPC (Fig. 6B) and the role of miR-24 as a tumor-suppressive factor in NPC (Fig. 6C). These findings indicated the regulation of miR-24 by hypermethylation of mir-24-1 promoter in NPC.

Figure 6. Increased miR-24 expression and inhibition of H2AX levels following 5-aza-2′-deoxycytidine treatment (0, 10, or 20 μM) for 96 hours.

Figure 6

Open in a new tab

A, QRT-PCR results of miR-24 expression after 5-aza-2′deoxycytidine treatment were shown. Data represent mean ± s.d. of 3 independent experiments. B, QRT-PCR results of H2AX expression after 5-aza-2′deoxycytidine treatment were shown. Data represent mean ± s.d. of 3 independent experiments. GAPDH served as an internal control. C, MTT assay results of NPC cell viability after treatment. Cell viability percentages are normalized to 0 μM. Data represent mean ± s.d. of 3 independent experiments. NS, not significant; *, p<0.05; **, p<0.001, ***, p<0.0001.

Discussion

Recent demonstrations of differential expression of miRNAs in cancer and the function of some miRNAs as oncogenes (called “oncomiRs”) or tumor-suppressive genes (“tumor-suppressive miRNAs”) have spurred considerable interest in the elucidation of their roles in cancer. MiR-24, an abundant miRNA that is well conserved among species, has attracted much attention due to its important role in various biological and pathological processes, including cell proliferation, cell cycle, apoptosis, and differentiation. It is expressed in normal tissues such as adipose tissue, mammary gland, kidney, and differentiated skeletal muscles (35); however, it is dysregulated in cancer. Lin et al (36) reported that miR-24 was upregulated in oral squamous cell carcinoma tissues, plasma, and cell lines in comparison with their normal counterparts, whereas Wu et al (37) found that miR-24 was down-regulated in gastric cancer cells, indicating a dual role for miR-24 in cancers. Indeed, the same miRNA can have different functions in different cancers. For example, miR-24 promotes the proliferation of HuH7 hepatocellular carcinoma cells as well as A549 lung carcinoma cells but inhibits HeLa cell proliferation (38), perhaps because the targets of miR-24 differ by cancer type.

Our findings established, for the first time, that miR-24 functions as a tumor suppressor miRNA in NPC by inhibiting cell proliferation and promoting apoptosis, which is consistent with the studies of Lal et al (39) and Mishra et al (40). In addition, we discovered that miR-24 expression was decreased in both NPC radioresistant cells and recurrent NPC tissue samples, which suggested the involvement of miR-24 in NPC radioresistance. To identify the role of miR-24 in the effect of radiotherapy on NPC, we combined IR treatment with enhanced miR-24 expression and found that miR-24 radiosensitized NPC cells.

IR produces intermediate ions and free radicals that induce cell inactivation and cell death mainly through inflicting DNA DSBs. Nonhomologous end-joining (NHEJ) is the major DNA repair pathway involved in the repair of DSBs after IR (41). The histone variant H2AX is a critical molecule in the response to DSB and leads to DNA repair; H2AX is also a known target of miR-24 (33). Thus, overexpressing miR-24 is expected to increase cell sensitivity to IR, which is one probable way that miR-24 acts as a radiosensitizer in NPC. We assessed H2AX expression with miR-24 inhibitors in the four NPC cell lines and discovered, as expected, that H2AX increased markedly after miR-24 inhibition in all four NPC cell lines. All together, our data indicated that DNA damage repair, cell apoptosis, and cell cycle manipulation are all conceivable processes by which miR-24 modulates response to NPC radiotherapy.

Global hypomethylation and aberrant hypermethylation of gene promoter CpG islands results in tumor cell genomic instability and gene silencing (particularly of tumor-suppressive genes), respectively (42). During the last decade, the appearance of cancer-specific upstream region hypermethylation of miRNAs has been demonstrated to be an epigenetic mechanism for aberrant miRNA expression (15), (43). Numerous reports have documented the mutual regulation between ectopic miRNA expression and aberrant DNA methylation, which was first confirmed in cancer research.

MiRNA-encoding genes are both targets and regulators of methylation. On the one hand, ectopic miRNA expression could be regulated by DNA methylation primarily via hypermethylation of the promoter region of the miRNA gene (usually pointing to tumor-suppressive miRNAs). For instance, miR-342 inhibition in colorectal cancer could be mediated epigenetically by hypermethylation of its promoter (44). Another study reported that the DNA methylation inhibitor 5-aza-2′-deoxycytidine could induce miR-127 expression in cancer cells, confirming that miRNA can be targeted by DNA methylation (45). On the other hand, aberrant methylation could be manipulated by miRNA primarily through targeting DNA methyltransferases or DNA methylation-related proteins. MiR-29 (miR-29-a, -b, or -c; also called “epi-miRNAs”) can reverse aberrant methylation in lung cancer by targeting DNMT3A and 3B (18). Chen et al (46) reported that miR-373 could negatively regulate methyl-CpG-binding domain protein 2 (MBD2) directly in cholangiocarcinoma.

In our present study, we measured the genome-wide methylation level between CNE-2 and CNE-2R cells and showed that DNA methylation was approximately 30% lower in CNE-2R cells, indicating genomic instability after irradiation by DNA methylation alteration. We searched miR-24 genes and found that only mir-24-1 was embedded in CpG islands. MSP was subsequently performed to test the methylation level of the mirr-24-1 promoter, and the results revealed hypermethylation in both radioresistant NPC cells and NPC cells after IR treatment. In addition, miR-24 was downregulated after irradiation, which was adversely correlated with the methylation status of its promoter. Furthermore, 5-aza-2′-deoxycytidine reversed the hypermethylation pattern and compensated for the miR-24 inhibition. Taken together, our findings suggested that the mechanism by which miR-24 mediates NPC radioresistance is regulated epigenetically by mir-24-1 promoter hypermethylation.

Epigenetic modifications, particularly miRNAs and DNA methylation, have been gaining more and more attention due to their potential as therapeutic targets. First, miRNAs are very stable, even in body fluids such as plasma, serum, urine, and saliva (47). Second, miRNAs have multiple functions and are involved in almost every physiologic and pathologic process and thus clearly have crucial roles and potentially profound effects in cancer treatment. Third, cancer-specific miRNA signatures can be highly reproducible and independently predictive of clinical and biological features of tumors and thus very useful in improving treatment (48). Mu and colleagues (49) successfully inhibited the tumorigenicity of NPC cells in nude mice in vivo by using lenti-miR-26a as gene therapy. Moreover, the first miRNA-targeted drug, miravirsen, a locked nucleic acid-modified oligonucleotide, has gone through preclinical trials with primates (50). Miravirsen has also been determined to be safe and well tolerated and to result in a significant dose-dependent decrease in hepatitis-C RNA levels in patients (51). Additionally, some demethylating agents have been approved by the U.S. Food and Drug Administration as anti-cancer drugs. In conclusion, we have provided new insight into NPC treatment. Our findings defined a central role for miR-24 as a potential tumor suppressor miRNA in NPC and they suggested a use for miR-24 in novel therapeutic strategies to treat this cancer.

Supplementary Material

1

Acknowledgements

We thank Elizabeth L. Hess in the Department of Scientific Publications at MD Anderson for editing the manuscript.

Grant support: This work was supported by a fellowship from the China Scholarship Council (201206380043 to S Wang), the National Natural Science Foundation of China (81071837, 81372410, and 30670627 to H Yang), the Scientific and Technological Project of Guangdong, China (2008A030201009 and 2010B050700016 to H Yang), and grants from the National Cancer Institute (R01-CA90853 to FX Claret), the Sister Institution Network Fund (FX Claret), and The University of Texas MD Anderson Functional Proteomics Core Facility (NCI Cancer Center Support Grant CA16672).

Footnotes

Conflict of interest statement: The authors have no conflicts of interest to declare.

References

  • 1.Lo KW, Chung GT, To KF. Deciphering the molecular genetic basis of NPC through molecular, cytogenetic, and epigenetic approaches. Seminars in cancer biology. 2012;22:79–86. doi: 10.1016/j.semcancer.2011.12.011. [DOI] [PubMed] [Google Scholar]
  • 2.Wei WI, Sham JS. Nasopharyngeal carcinoma. Lancet. 2005;365:2041–54. doi: 10.1016/S0140-6736(05)66698-6. [DOI] [PubMed] [Google Scholar]
  • 3.Lee FK, Yeung DK, King AD, Leung SF, Ahuja A. Segmentation of nasopharyngeal carcinoma (NPC) lesions in MR images. International journal of radiation oncology, biology, physics. 2005;61:608–20. doi: 10.1016/j.ijrobp.2004.09.024. [DOI] [PubMed] [Google Scholar]
  • 4.Chan AT. Nasopharyngeal carcinoma. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2010;21(Suppl 7):vii308–12. doi: 10.1093/annonc/mdq277. [DOI] [PubMed] [Google Scholar]
  • 5.Chen HC, Chen GH, Chen YH, Liao WL, Liu CY, Chang KP, et al. MicroRNA deregulation and pathway alterations in nasopharyngeal carcinoma. British journal of cancer. 2009;100:1002–11. doi: 10.1038/sj.bjc.6604948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Liu S, Dontu G, Mantle ID, Patel S, Ahn NS, Jackson KW, et al. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and malignant human mammary stem cells. Cancer research. 2006;66:6063–71. doi: 10.1158/0008-5472.CAN-06-0054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chan MC, Hilyard AC, Wu C, Davis BN, Hill NS, Lal A, et al. Molecular basis for antagonism between PDGF and the TGFbeta family of signalling pathways by control of miR-24 expression. The EMBO journal. 2010;29:559–73. doi: 10.1038/emboj.2009.370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Claret FX, Hibi M, Dhut S, Toda T, Karin M. A new group of conserved coactivators that increase the specificity of AP-1 transcription factors. Nature. 1996;383:453–7. doi: 10.1038/383453a0. [DOI] [PubMed] [Google Scholar]
  • 9.Calin GA, Croce CM. MicroRNA signatures in human cancers. Nature reviews Cancer. 2006;6:857–66. doi: 10.1038/nrc1997. [DOI] [PubMed] [Google Scholar]
  • 10.Bounpheng MA, Melnikova IN, Dodds SG, Chen H, Copeland NG, Gilbert DJ, et al. Characterization of the mouse JAB1 cDNA and protein. Gene. 2000;242:41–50. doi: 10.1016/s0378-1119(99)00525-9. [DOI] [PubMed] [Google Scholar]
  • 11.Tian L, Peng G, Parant JM, Leventaki V, Drakos E, Zhang Q, et al. Essential roles of Jab1 in cell survival, spontaneous DNA damage and DNA repair. Oncogene. 2010;29:6125–37. doi: 10.1038/onc.2010.345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.He ML, Luo MX, Lin MC, Kung HF. MicroRNAs: potential diagnostic markers and therapeutic targets for EBV-associated nasopharyngeal carcinoma. Biochimica et biophysica acta. 2012;1825:1–10. doi: 10.1016/j.bbcan.2011.09.001. [DOI] [PubMed] [Google Scholar]
  • 13.Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993;75:843–54. doi: 10.1016/0092-8674(93)90529-y. [DOI] [PubMed] [Google Scholar]
  • 14.Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–97. doi: 10.1016/s0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
  • 15.Calin GA, Croce CM. MicroRNA-cancer connection: the beginning of a new tale. Cancer research. 2006;66:7390–4. doi: 10.1158/0008-5472.CAN-06-0800. [DOI] [PubMed] [Google Scholar]
  • 16.Almeida MI, Reis RM, Calin GA. Decoy activity through microRNAs: the therapeutic implications. Expert Opin Biol Th. 2012;12:1153–9. doi: 10.1517/14712598.2012.693470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kamanu TKK, Radovanovic A, Archer JAC, Bajic VB. Exploration of miRNA families for hypotheses generation. Sci Rep-Uk. 2013:3. doi: 10.1038/srep02940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fabbri M, Garzon R, Cimmino A, Liu Z, Zanesi N, Callegari E, et al. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proceedings of the National Academy of Sciences of the United States of America. 2007;104:15805–10. doi: 10.1073/pnas.0707628104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Datta J, Kutay H, Nasser MW, Nuovo GJ, Wang B, Majumder S, et al. Methylation mediated silencing of microRNA-1 gene and its role in hepatocellular carcinogenesis. Cancer research. 2008;68:5049–58. doi: 10.1158/0008-5472.CAN-07-6655. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 20.Pan Y, Claret FX. Targeting Jab1/CSN5 in nasopharyngeal carcinoma. Cancer letters. 2012;326:155–60. doi: 10.1016/j.canlet.2012.07.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lujambio A, Calin GA, Villanueva A, Ropero S, Sanchez-Cespedes M, Blanco D, et al. A microRNA DNA methylation signature for human cancer metastasis. Proceedings of the National Academy of Sciences of the United States of America. 2008;105:13556–61. doi: 10.1073/pnas.0803055105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang LQ, Liang R, Chim CS. Methylation of tumor suppressor microRNAs: lessons from lymphoid malignancies. Expert Rev Mol Diagn. 2012;12:755–65. doi: 10.1586/erm.12.64. [DOI] [PubMed] [Google Scholar]
  • 23.Kozaki K, Imoto I, Mogi S, Omura K, Inazawa J. Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer. Cancer research. 2008;68:2094–105. doi: 10.1158/0008-5472.CAN-07-5194. [DOI] [PubMed] [Google Scholar]
  • 24.Vrba L, Jensen TJ, Garbe JC, Heimark RL, Cress AE, Dickinson S, et al. Role for DNA Methylation in the Regulation of miR-200c and miR-141 Expression in Normal and Cancer Cells. PloS one. 2010:5. doi: 10.1371/journal.pone.0008697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chen H, Hutt-Fletcher L, Cao L, Hayward SD. A positive autoregulatory loop of LMP1 expression and STAT activation in epithelial cells latently infected with Epstein-Barr virus. Journal of virology. 2003;77:4139–48. doi: 10.1128/JVI.77.7.4139-4148.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hino R, Uozaki H, Murakami N, Ushiku T, Shinozaki A, Ishikawa S, et al. Activation of DNA methyltransferase 1 by EBV latent membrane protein 2A leads to promoter hypermethylation of PTEN gene in gastric carcinoma. Cancer research. 2009;69:2766–74. doi: 10.1158/0008-5472.CAN-08-3070. [DOI] [PubMed] [Google Scholar]
  • 27.Qu CJ, Liang ZH, Huang JL, Zhao RY, Su CH, Wang SM, et al. MiR-205 determines the radioresistance of human nasopharyngeal carcinoma by directly targeting PTEN. Cell cycle. 2012;11:785–96. doi: 10.4161/cc.11.4.19228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pogribny I, Yi P, James SJ. A sensitive new method for rapid detection of abnormal methylation patterns in global DNA and within CpG islands. Biochemical and biophysical research communications. 1999;262:624–8. doi: 10.1006/bbrc.1999.1187. [DOI] [PubMed] [Google Scholar]
  • 29.Jacinto FV, Ballestar E, Esteller M. Methyl-DNA immunoprecipitation (MeDIP): Hunting down the DNA methylome. Biotechniques. 2008;44:35. doi: 10.2144/000112708. [DOI] [PubMed] [Google Scholar]
  • 30.Gehring M, Bubb KL, Henikoff S. Extensive demethylation of repetitive elements during seed development underlies gene imprinting. Science. 2009;324:1447–51. doi: 10.1126/science.1171609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Huang J, Renault V, Sengenes J, Touleimat N, Michel S, Lathrop M, et al. MeQA: a pipeline for MeDIP-seq data quality assessment and analysis. Bioinformatics. 2012;28:587–8. doi: 10.1093/bioinformatics/btr699. [DOI] [PubMed] [Google Scholar]
  • 32.Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002;18:1427–31. doi: 10.1093/bioinformatics/18.11.1427. [DOI] [PubMed] [Google Scholar]
  • 33.Lal A, Pan Y, Navarro F, Dykxhoorn DM, Moreau L, Meire E, et al. miR-24-mediated downregulation of H2AX suppresses DNA repair in terminally differentiated blood cells. Nature structural & molecular biology. 2009;16:492–8. doi: 10.1038/nsmb.1589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kovalchuk O, Hendricks CA, Cassie S, Engelward AJ, Engelward BP. In vivo recombination after chronic damage exposure falls to below spontaneous levels in “recombomice”. Molecular cancer research : MCR. 2004;2:567–73. [PubMed] [Google Scholar]
  • 35.Gibcus JH, Tan LP, Harms G, Schakel RN, de Jong D, Blokzijl T, et al. Hodgkin lymphoma cell lines are characterized by a specific miRNA expression profile. Neoplasia. 2009;11:167–76. doi: 10.1593/neo.08980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lin SC, Liu CJ, Lin JA, Chiang WF, Hung PS, Chang KW. miR-24 up-regulation in oral carcinoma: positive association from clinical and in vitro analysis. Oral oncology. 2010;46:204–8. doi: 10.1016/j.oraloncology.2009.12.005. [DOI] [PubMed] [Google Scholar]
  • 37.Wu J, Zhang YC, Suo WH, Liu XB, Shen WW, Tian H, et al. Induction of anion exchanger-1 translation and its opposite roles in the carcinogenesis of gastric cancer cells and differentiation of K562 cells. Oncogene. 2010;29:1987–96. doi: 10.1038/onc.2009.481. [DOI] [PubMed] [Google Scholar]
  • 38.Cheng AM, Byrom MW, Shelton J, Ford LP. Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic acids research. 2005;33:1290–7. doi: 10.1093/nar/gki200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O'Day E, et al. miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to “seedless” 3′UTR microRNA recognition elements. Molecular cell. 2009;35:610–25. doi: 10.1016/j.molcel.2009.08.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mishra PJ, Song B, Mishra PJ, Wang Y, Humeniuk R, Banerjee D, et al. MiR-24 Tumor Suppressor Activity Is Regulated Independent of p53 and through a Target Site Polymorphism. PloS one. 2009:4. doi: 10.1371/journal.pone.0008445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Helleday T, Lo J, van Gent DC, Engelward BP. DNA double-strand break repair: from mechanistic understanding to cancer treatment. DNA repair. 2007;6:923–35. doi: 10.1016/j.dnarep.2007.02.006. [DOI] [PubMed] [Google Scholar]
  • 42.Meng F, Wehbe-Janek H, Henson R, Smith H, Patel T. Epigenetic regulation of microRNA-370 by interleukin-6 in malignant human cholangiocytes. Oncogene. 2008;27:378–86. doi: 10.1038/sj.onc.1210648. [DOI] [PubMed] [Google Scholar]
  • 43.Lujambio A, Esteller M. CpG island hypermethylation of tumor suppressor microRNAs in human cancer. Cell cycle. 2007;6:1455–9. [PubMed] [Google Scholar]
  • 44.Grady WM, Parkin RK, Mitchell PS, Lee JH, Kim YH, Tsuchiya KD, et al. Epigenetic silencing of the intronic microRNA hsa-miR-342 and its host gene EVL in colorectal cancer. Oncogene. 2008;27:3880–8. doi: 10.1038/onc.2008.10. [DOI] [PubMed] [Google Scholar]
  • 45.Pan C, Chen H, Wang L, Yang S, Fu H, Zheng Y, et al. Down-regulation of MiR-127 facilitates hepatocyte proliferation during rat liver regeneration. PloS one. 2012;7:e39151. doi: 10.1371/journal.pone.0039151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Chen Y, Luo J, Tian R, Sun H, Zou S. miR-373 negatively regulates methyl-CpG-binding domain protein 2 (MBD2) in hilar cholangiocarcinoma. Digestive diseases and sciences. 2011;56:1693–701. doi: 10.1007/s10620-010-1481-1. [DOI] [PubMed] [Google Scholar]
  • 47.Cortez MA, Bueso-Ramos C, Ferdin J, Lopez-Berestein G, Sood AK, Calin GA. MicroRNAs in body fluids-the mix of hormones and biomarkers. Nature Reviews Clinical Oncology. 2011;8:467–77. doi: 10.1038/nrclinonc.2011.76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Di Leva G, Croce CM. miRNA profiling of cancer. Current opinion in genetics & development. 2013;23:3–11. doi: 10.1016/j.gde.2013.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Lu J, He ML, Wang L, Chen Y, Liu X, Dong Q, et al. MiR-26a inhibits cell growth and tumorigenesis of nasopharyngeal carcinoma through repression of EZH2. Cancer research. 2011;71:225–33. doi: 10.1158/0008-5472.CAN-10-1850. [DOI] [PubMed] [Google Scholar]
  • 50.Lanford RE, Hildebrandt-Eriksen ES, Petri A, Persson R, Lindow M, Munk ME, et al. Therapeutic Silencing of MicroRNA-122 in Primates with Chronic Hepatitis C Virus Infection. Science. 2010;327:198–201. doi: 10.1126/science.1178178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Janssen HLA, Reesink HW, Lawitz EJ, Zeuzem S, Rodriguez-Torres M, Patel K, et al. Treatment of HCV Infection by Targeting MicroRNA. New Engl J Med. 2013;368:1685–94. doi: 10.1056/NEJMoa1209026. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS635301-supplement-1.pdf (5.3MB, pdf)

RESOURCES