Abstract
• Premise of the study: Chloroplast microsatellite markers were developed for Festuca rubra to examine its population genetic characteristics, taxonomy, and coevolution with its endophyte Epichloë festucae.
• Methods and Results: Thirteen polymorphic markers were identified from the chloroplast genome of a F. ovina accession and intergenic chloroplast sequences of F. rubra accessions. They amplified a total of 65 alleles in a sample of 93 individuals of F. rubra originating from six different populations located in the Faroe Islands, Finland, Greenland, Norway, and Spain.
• Conclusions: The developed microsatellite primer pairs can be used by researchers in population genetic and taxonomic studies, and by plant breeders in breeding programs on grasses.
Keywords: agriculture, breeding, Epichloë festucae, Festuca rubra, pasture grass, Poaceae, population genetics, taxonomy
Festuca rubra L. (red fescue) belongs to fine-leaved Festuca sect. Aulaxyper s.l. clade (F. rubra group, family Poaceae). Festuca rubra is perennial, rhizomatous, and highly interfertile with multiple ploidy levels (Dirihan et al., 2013). It is one of the agriculturally most important turfgrasses, widely cultivated in temperate regions (Gould and Shaw, 1983), with a number of commercial cultivars. The genus Festuca L. contains by recent estimates from 450 to more than 500 species with nearly global distribution (Lu et al., 2006; Darbyshire and Pavlick, 2007). The taxonomy of the genus Festuca is problematic and contentious (Darbyshire and Pavlick, 2007). The International Plant Names Index (IPNI) catalogues worldwide 37 subspecies, 36 varieties, and 19 forms of F. rubra. It has encountered a wide and rapid inter- and postglacial expansion around the world, and occupies a diverse range of ecological conditions (Inda et al., 2008). Consequently, F. rubra is morphologically highly variable, and plants falling into morphologically distinguishable categories are often inconsistently classified as both species and subspecies. The success of F. rubra is often linked with the systemic and vertically transmitted endophyte, Epichloë festucae Leuchtm., Schardl & Siegel, because the endophyte infection has been demonstrated to provide a selective advantage or disadvantage to the host plant depending on prevailing selection pressures (Wäli et al., 2009; Saikkonen et al., 2010).
Chloroplast microsatellites or simple sequence repeats (cpSSR) are used as effective tools in evolutionary, population genetic, and phylogeographic studies (Provan et al., 2001; Ebert and Peakall, 2009). In grasses, chloroplast microsatellite markers have been previously developed for Lolium perenne L. and tested also in fine-leaved F. rubra, resulting in five amplifiable polymorphic markers in F. rubra with low levels of intraspecific variation (McGrath et al., 2006). In fine-leaved fescues, cross-amplification problems of the chloroplast markers designed for other grass taxa can be caused by the smaller plastid genome size of fine-leaved Festuca due to a larger number of deletions within the intergenic regions compared to other grasses (Hand et al., 2013). However, no species-specific cpSSR markers have been developed for fine-leaved Festuca so far. In our study, we needed a greater number of polymorphic chloroplast markers to address our study aims, such as population genetic characteristics and the coevolution patterns of F. rubra with its endophyte E. festucae.
METHODS AND RESULTS
Chloroplast DNA is conserved, nonrecombinant, uniparentally inherited, and effectively haploid, and it generally lacks heteroplasmy, thus being ideal for marker development, as the flanking regions are typically conserved (Provan et al., 2001; Hand et al., 2013). In our study, the starting point of the cpSSR marker development for F. rubra was the plastome sequence of taxonomically closely related F. ovina L. (Inda et al., 2008), which is the only available complete fine-leaved Festuca plastome sequence (Hand et al., 2013). The chloroplast genome sequence of F. ovina (GenBank accession no. JX871940, length 133,165 bp) was downloaded from GenBank and searched for ≥7 mononucleotide repeats and ≥3 di-, tri-, and tetranucleotide repeats using MSATFINDER version 2.0.9 (Thurston and Field, 2005). A total of 569 repeat motifs were identified in the chloroplast genome, among which the most frequent types were mononucleotide (44%) and dinucleotide (46%) repeats, while tri- (8%) and tetranucleotide (1%) repeats were rare. In addition, the GenBank accessions of F. rubra intergenic chloroplast sequences were downloaded and similarly searched for mono-, di-, and trinucleotide repeats. The sequences containing repetitive motifs were aligned among accessions to reveal variation among individuals. The selection of the regions with repetitive motifs for primer design was based on the repeat length being as long as possible, the region located within an intergenic region and being a known mutational hot spot region (Hand et al., 2013), the alignment of sequences showing variation among individuals within the repeat motif, and the flanking sequences allowing primer design. The criteria for the primer design were as follows: primer length of 18–27 bp, GC content 40–60%, annealing temperature 55–58°C, and the expected amplicon size of 100–300 bp. Primer pairs homologous to the flanking regions were designed for 16 cpSSR loci using Primer3 software (Rozen and Skaletsky, 2000). The primers were obtained from Oligomer Oy (Helsinki, Finland). The forward primers were labeled with fluorescent dyes for automated electrophoresis.
Genomic DNA of F. rubra was extracted from fresh leaves using the E.Z.N.A. Plant DNA Kit (Omega Bio-Tek, Norcross, Georgia, USA). The yield and purity of DNA were measured using a NanoDrop Lite spectrophotometer (Thermo Fisher Scientific, Wilmington, Delaware, USA). PCR amplifications were performed in a final volume of 10 μL, containing 5–10 ng genomic DNA, 1× GoTaq Flexi Buffer, 1.0 mM MgCl2 solution, 0.2 mM of each dNTP, 0.2 μM of each primer, and 1.25 units GoTaq G2 HotStart Polymerase (Promega Corporation, Madison, Wisconsin, USA). The PCR reactions were performed as follows: an initial denaturation at 95°C for 2 min; followed by 30 cycles of 30 s at 95°C, 30 s at 56°C, and 30 s at 73°C; and a final extension for 5 min at 73°C, using a C1000 Thermal Cycler (Bio-Rad, Applied Biosystems, Foster City, California, USA). Each microsatellite marker was amplified singly. A set of PCR products, 4 μL per PCR reaction, were checked for amplification success using 1.5% agarose gels (SeaKem LE Agarose; Lonza, Rockland, Maine, USA). The PCR products were run on an ABI 3130xl DNA Sequencer using the GeneScan 500 ROX Size Standard (Applied Biosystems) at the Institute of Biotechnology, University of Helsinki, Finland, and the amplified fragment lengths were assigned to allelic sizes with Peak Scanner version 1 software (Applied Biosystems).
Characteristics of the 16 markers were initially tested by multiplexing markers with different fluorescent labels and expected fragment sizes, and including four samples originating from different geographic regions (Appendix 1). All primer pairs produced bands that matched the expected sizes. The 16 markers were arranged in multiplex sets for genotyping. Markers were screened for polymorphism using 93 samples originating from six different populations located in a wide geographic region, including Finland, Greenland, the Faroe Islands, Norway, and two locations in Spain (Appendix 1). The resulting genotyping data were analyzed using GenAlEx version 6.5 (Peakall and Smouse, 2006, 2012) to estimate the number of alleles per locus and unbiased haploid diversity.
Thirteen out of 16 markers were polymorphic, one marker was monomorphic, and two markers amplified unreliably (Table 1). Thirteen polymorphic markers amplified a total of 65 alleles in a sample of 93 individuals of F. rubra originating from the six different populations. The number of alleles per polymorphic locus varied from two to eight at the species level and from one to six at the population level, and the unbiased haploid diversity per locus varied from 0.104 to 0.795 at the species level and from 0.000 to 0.824 at the population level (Table 2). The southern populations from Spain possessed a greater number of alleles and higher haploid diversity compared to the northern populations.
Table 1.
Characteristics of 14 intergenic chloroplast microsatellite markers developed for the grass Festuca rubra.a
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp)b | Position | GenBank accession no. |
| FR15cpSSR | F: CCATCTCTCCCCGTTCCAAA | (T)11C(T)3,(T)6 | 203–212 | trnS-GCU/psbD | JX871940 |
| R: TTGTCTCTCGGCCAATATTGA | |||||
| FR16cpSSR | F: AGCGCACTATTGTAAATCGAAGT | (TAT)T(TAT)4,(T)8 | 229–234 | trnS-GCU/psbD | JX871940 |
| R: AGTTTGCCAGGGGTACAACT | |||||
| FR17cpSSR | F: GCCGCATCAATCGAGGATAC | (A)8C(A)13 | 217–222 | ycf3/trnS-GGA | JX871940 |
| R: TCCGACAACCTCAGGAGAAA | |||||
| FR19cpSSR | F: TAAGCAAGCGGTGTCTCTCA | (A)12 | 174–180 | trnT-UGU/trnL-UAA | JX871940 |
| R: ACAATCAAGTCCGTAGCGTC | |||||
| FR20cpSSR | F: TCCTCGTGTCACCAGTTCAA | (A)7(TA)3,(A)7 | 245–257 | trnF-GAA/ndhJ | JX871940 |
| R: AGCCTAATCTCACCTCCTTCTG | |||||
| FR21cpSSR | F: AGGACTAATCTCTGCAGTATAATGAGA | (A)9G(A)9,(GA)4,(T)7 | 246–260 | ndhC/trnV-UAC | JX871940 |
| R: TCCATCTTGCGAATTACTACCTTG | |||||
| FR23cpSSR | F: TCCACTTTCTTTTACGCTTCTGT | (A)13,(T)7 | 182 | psbE/petL | JX871940 |
| R: AGCAGCCAGTAGAAAACCGA | |||||
| FR24cpSSR | F: CCGTCTTATATAGGGGATAGGCT | (AT)5,(AT)6,(AT)3,(AT)3,(AT)3,(A)7 | 292–301 | ndhF/rpl32 | JX871940 |
| R: TGCCGCAAATAAATCCTTCTTTC | |||||
| FR26cpSSR | F: AGTCCCCTTAGTGGTCCCTA | (T)12,(T)6 | 186–190 | atp1/atpH | JX871940 |
| R: TCCGTAACCGTGCATGAATT | |||||
| FR27cpSSR | F: GGAGGAATTGCGGGTTTTCT | (T)7C(T)6,(TTC)4 | 198–201 | petA/psbJ | JX871940 |
| R: TACCTCGCCTGAACCTAAGC | |||||
| FR28cpSSR | F: AGGAGAACACAGAGTCATAGCA | (A)11 | 122–124 | trnT/trnL | EF585096 |
| R: CTCTCCCCGCCCTACTTTAT | |||||
| FR29cpSSR | F: TCAATTTGATATGGCTCAGAGGA | (AT)A(AT)5 | 191–200 | trnT/trnL | DQ336857.1 |
| R: TGCTATGACTCTGTGTTCTCCT | |||||
| FR30cpSSR | F: CAGCAATAGTGTCCTTGCCC | (T)4C(T)9CA(T)4 | 226–231 | rps8/rpl14 | HM173006 |
| R: GATTGCCGAGGAATTGAGAGA | |||||
| FR31cpSSR | F: TGACAAAGGAGTGCGAAGAG | (C)9 | 250–254 | trnL/trnF | EF593001 |
| R: CTTGTGCATCATCCTAGTAGAGT |
Annealing temperature = 56°C.
Size ranges are based on 93 samples representing European populations located in Finland, the Faroe Islands, Greenland, Norway, and Spain (n = 12–18 for each population); see Appendix 1 for population information.
Table 2.
Characteristics of 13 polymorphic chloroplast microsatellite loci in six populations of Festuca rubra within a wide geographic region.a
| BERG (n = 15) | FAS2 (n = 15) | GL1 (n = 12) | HA1 (n = 15) | SPGD (n = 18) | SPPOR (n = 18) | All (n = 93) | ||||||||
| Locus | A | h | A | h | A | h | A | h | A | h | A | h | A | h |
| FR15cpSSR | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.343 | 1 | 0.000 | 3 | 0.216 | 4 | 0.104 |
| FR16cpSSR | 2 | 0.514 | 2 | 0.248 | 1 | 0.000 | 2 | 0.133 | 4 | 0.471 | 4 | 0.542 | 4 | 0.370 |
| FR17cpSSR | 2 | 0.514 | 2 | 0.514 | 2 | 0.167 | 2 | 0.133 | 3 | 0.582 | 3 | 0.386 | 5 | 0.609 |
| FR19cpSSR | 3 | 0.590 | 2 | 0.133 | 2 | 0.167 | 1 | 0.000 | 2 | 0.294 | 2 | 0.425 | 4 | 0.471 |
| FR20cpSSR | 3 | 0.676 | 3 | 0.590 | 2 | 0.167 | 5 | 0.733 | 5 | 0.824 | 4 | 0.778 | 8 | 0.795 |
| FR21cpSSR | 2 | 0.533 | 3 | 0.257 | 1 | 0.000 | 3 | 0.257 | 5 | 0.693 | 6 | 0.784 | 7 | 0.596 |
| FR24cpSSR | 3 | 0.600 | 3 | 0.590 | 1 | 0.000 | 2 | 0.533 | 6 | 0.797 | 6 | 0.824 | 7 | 0.722 |
| FR26cpSSR | 2 | 0.514 | 2 | 0.514 | 2 | 0.167 | 2 | 0.133 | 4 | 0.732 | 4 | 0.725 | 5 | 0.601 |
| FR27cpSSR | 2 | 0.514 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 2 | 0.294 | 1 | 0.000 | 2 | 0.177 |
| FR28cpSSR | 2 | 0.248 | 3 | 0.705 | 2 | 0.167 | 1 | 0.000 | 3 | 0.582 | 3 | 0.582 | 3 | 0.571 |
| FR29cpSSR | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 1 | 0.000 | 3 | 0.601 | 4 | 0.608 | 4 | 0.300 |
| FR30cpSSR | 1 | 0.000 | 1 | 0.000 | 2 | 0.167 | 2 | 0.133 | 3 | 0.529 | 3 | 0.660 | 4 | 0.320 |
| FR31cpSSR | 1 | 0.000 | 3 | 0.648 | 1 | 0.000 | 2 | 0.133 | 4 | 0.686 | 3 | 0.582 | 5 | 0.455 |
| Mean | 1.9 | 0.362 | 2.1 | 0.323 | 1.5 | 0.077 | 2.0 | 0.195 | 3.5 | 0.545 | 3.5 | 0.547 | 4.8 | 0.469 |
Note: A = number of alleles per locus; h = unbiased haploid diversity; n = sample size.
Population information is provided in Appendix 1.
CONCLUSIONS
Thirteen novel polymorphic chloroplast microsatellite markers designed for fine-leaved fescues showed a considerable amount of genetic variation within F. rubra populations. This set of novel polymorphic cpSSR markers provides a valuable tool for grass breeders, taxonomists, and population geneticists investigating fine-leaved Festuca taxa, which presumably cross-amplify, especially within the F. ovina and F. rubra groups (Inda et al., 2008).
Appendix 1.
Voucher information for Festuca rubra specimens used in this study.
| Taxon | Population code | Locality | Geographic coordinates | Altitude (m) | Habitat | Voucher specimena |
| Festuca rubra s.l. | BERG | Kinsarvik, Norway | 60°22′43″N, 6°43′32″E | 0 | Seashore meadow | H1761060 |
| Festuca rubra subsp. rubra | FAS2 | Vidoy, Faroe Islands | 62°22′3.4″N, 6°32′31.8″W | 148 | Meadow | H1762440 |
| Festuca rubra subsp. arctica | GL1 | Disko, Greenland | 69°14′59″N, 53°31′15″W | 1 | Sandy seashore | H1757969 |
| Festuca rubra subsp. rubra | HA1 | Hanko, Finland | 59°50′27″N, 23°13′15″E | 1 | Seashore meadow | H1762441 |
| Festuca cf. rubra | SPGD | Cáceres, Spain | 40°12′1.12″N, 5°45′11.03″W | 768 | Xerophytic forest | H1762442 |
| Festuca rubra subsp. rothmalerib | SPPOR | Salamanca, Spain | 40°58′24.28″N, 5°57′33.69″W | 812 | Grassland “dehasa” | H1762443 |
Vouchers deposited at the Botanical Museum (H), University of Helsinki.
This taxon is also treated as the species Festuca rothmaleri.
LITERATURE CITED
- Darbyshire S. J., Pavlick L. E. 2007. Festuca L. In M. E. Barkworth, K. M. Capels, S. Long, L. K. Anderton, and M. B. Piep [eds.], Flora of North America, vol. 24. Magnoliophyta: Commelinidae (in part): Poaceae, part 1, 389–443. Oxford University Press, New York, New York, USA. [Google Scholar]
- Dirihan S., Terho P., Helander M., Saikkonen K. 2013. Efficient analysis of ploidy levels in plant evolutionary ecology. Caryologia: International Journal of Cytology, Cytosystematics and Cytogenetics 66: 251–256. [Google Scholar]
- Ebert D., Peakall R. 2009. Chloroplast simple sequence repeats (cpSSRs): Technical resources and recommendations for expanding cpSSR discovery and applications to a wide array of plant species. Molecular Ecology Resources 9: 673–690. [DOI] [PubMed] [Google Scholar]
- Gould F. W., Shaw R. B. 1983. Grass systematics, 2nd ed. Texas A&M University Press, College Station, Texas, USA. [Google Scholar]
- Hand M. L., Spangenberg G. C., Forster J. W., Cogan N. O. I. 2013. Plastome sequence determination and comparative analysis for members of the Lolium-Festuca grass species complex. G3: Genes|Genomes|Genetics 3: 607–616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Inda L. A., Segarra-Moragues J. G., Muller J., Peterson P. M., Catalan P. 2008. Dated historical biogeography of the temperate Loliinae (Poaceae, Pooideae) grasses in the northern and southern hemispheres. Molecular Phylogenetics and Evolution 46: 932–957. [DOI] [PubMed] [Google Scholar]
- Lu S.-L., Chen X., Aiken S. G. 2006. Festuca Linnaeus. In Z. Y. Wu, P. H. Raven, and D. Y. Hong [eds.], Flora of China, vol. 22, 225–242. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- McGrath S., Hodkinson T. R., Salamin N., Barth S. 2006. Development and testing of novel chloroplast microsatellite markers for Lolium perenne and other grasses (Poaceae) from de novo sequencing and in silico sequences. Molecular Ecology Notes 6: 449–454. [Google Scholar]
- Peakall R., Smouse P. E. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peakall R., Smouse P. E. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics (Oxford, England) 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Provan J., Powell W., Hollingsworth M. 2001. Chloroplast microsatellites: New tool for studies in plant ecology and evolution. Trends in Ecology & Evolution 16: 142–147. [DOI] [PubMed] [Google Scholar]
- Rozen S., Skaletsky H. J. 2000. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Saikkonen K., Wäli P. R., Helander M. 2010. Genetic compatibility determines endophyte-grass combinations. PLoS ONE 5: e11395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thurston M. I., Field D. 2005. MSATFINDER: Detection and characterisation of microsatellites. Website http://www.genomics.ceh.ac.uk/msatfinder/ [accessed 8 April 2013].
- Wäli P. R., Helander M., Saloniemi I., Ahlholm J., Saikkonen K. 2009. Variable effects of endophytic fungus on seedling establishment of fine fescues. Oecologia 159: 49–57. [DOI] [PubMed] [Google Scholar]