Abstract
Salt stress is one of the major environmental stresses in agriculture worldwide and affects crop productivity and quality. The development of crops with elevated levels of salt tolerance is therefore highly desirable. In the present study, a novel maspardin gene, named IbMas, was isolated from salt-tolerant sweetpotato (Ipomoea batatas (L.) Lam.) line ND98. IbMas contains maspardin domain and belongs to α/β-hydrolase superfamily. Expression of IbMas was up-regulated in sweetpotato under salt stress and ABA treatment. The IbMas-overexpressing sweetpotato (cv. Shangshu 19) plants exhibited significantly higher salt tolerance compared with the wild-type. Proline content was significantly increased, whereas malonaldehyde content was significantly decreased in the transgenic plants. The activities of superoxide dismutase (SOD) and photosynthesis were significantly enhanced in the transgenic plants. H2O2 was also found to be significantly less accumulated in the transgenic plants than in the wild-type. Overexpression of IbMas up-regulated the salt stress responsive genes, including pyrroline-5-carboxylate synthase, pyrroline-5-carboxylate reductase, SOD, psbA and phosphoribulokinase genes, under salt stress. These findings suggest that overexpression of IbMas enhances salt tolerance of the transgenic sweetpotato plants by regulating osmotic balance, protecting membrane integrity and photosynthesis and increasing reactive oxygen species scavenging capacity.
Introduction
Soil salinization is becoming a serious threat to world agriculture to support a rapidly growing population [1], [2]. Approximately 20% of the irrigated soils in the world are under salt stress, and soil salinization has become a major constraint limiting crop production [3], [4]. The development of crops with elevated levels of salt tolerance is therefore highly desirable.
The superfamily of α/β-hydrolase fold enzymes is one of the largest known protein families, including hydrolases (acetylcholinesterase, carboxylesterase, dienelactone hydrolase, lipase, cutinase, thioesterase, serine carboxypeptidase, proline iminopeptidase, proline oligopeptidase, epoxide hydrolase) along with enzymes that require activation of HCN, H2O2 or O2 instead of H2O for the reaction mechanism (haloalkane dehalogenase, haloperoxidase, hydroxynitrile lyase) [5]–[8]. The ESTHER database, which is freely available via a web server (http://bioweb.ensam.inra.fr/esther) and is widely used, is dedicated to proteins with the α/β-hydrolase fold, and it currently contains>30 000 manually curated proteins [9]. The biological functions of α/β-hydrolase fold enzymes in various organisms are widely ranging and include biosynthesis, metabolism, signal transduction and gene regulation [8]. To date, a few of α/β-hydrolase fold enzymes such as esterase, phospholipase D and OsPOP5 have been shown to be involved in plant salt tolerance [10]–[13].
The maspardin (Mast syndrome, spastic paraplegia, autosomal recessive with dementia) protein is a member of the α/β-hydrolase superfamily. Maspardin was first identified as an intracellular binding protein for the cell surface glycoprotein CD4 and proposed to modulate CD4 stimulatory activity in humans [14], [15]. Simpson et al. [16] reported that the maspardin gene could cause the complicated form of hereditary spastic paraplegia known as Mast syndrome. However, the maspardin gene has not been characterized at the functional level in plants. In our previous study, an EST library was constructed by using salt-tolerant sweetpotato line ND98 and the suppression subtractive hybridization (SSH) technique, and it was found that expression of the maspardin gene, named IbMas, was significantly up-regulated in ND98 under salt stress (unpublished).
Sweetpotato, Ipomoea batatas (L.) Lam., is an important food and industrial material crop. It is also an alternative source of bio-energy as a raw material for fuel production [17]. The increased production of sweetpotato is desired, but this goal is often limited by salt stress [18]. Especially, sweetpotato as source of bio-energy will mainly be planted on marginal land. Salt stress is a critical delimiter for the cultivation expansion of sweetpotato. Therefore, the primary challenge facing scientists is enhancing sweetpotato's tolerance to salt stress to maintain productivity on marginal land. The improvement of this crop by conventional hybridization is limited because of its high male sterility, incompatibility and hexaploid nature [19]. Genetic engineering offers great potential to improve salt tolerance in this crop.
A number of genes have been isolated from sweetpotato based on the information gathered from related publications [18], [20]–[23]. However, very a little work has been done on the cloning of salt tolerance-associated genes in sweetpotato. Chen et al. [22] isolated SPCP2 gene from sweetpotato and the SPCP2-overexpressing Arabidopsis plants exhibited higher salt and drought tolerance. Wang et al. [23] cloned IbNFU1 gene from sweetpotato and the IbNFU1-overexpressing sweetpotato plants exhibited higher salt tolerance [24]. Liu et al. [18] cloned IbP5CR gene from sweetpotato and the IbP5CR-overexpressing sweetpotato plants exhibited higher salt tolerance. In this study, a novel maspardin gene, named IbMas, has been isolated from a salt-tolerant sweetpotato line ND98 and it is found that overexpression of IbMas gene can significantly enhance salt tolerance of the transgenic sweetpotato plants.
Materials and Methods
Plant materials
Salt-tolerant sweetpotato line ND98 was employed for gene cloning in this study. One expressed sequence tag (EST) clone was selected from the EST library of ND98 constructed at our laboratory, with 66.67% homology to a predicted maspardin-like gene (XP_004245715) from Solanum lycopersicum for cloning the gene. Sweetpotato cv. Shangshu 19, a commercial cultivar widely planted in China, was used for characterizing the function of the cloned gene in responses of the transgenic plants to salt stress.
Cloning of IbMas gene
Total RNA was extracted from 0.5 g of fresh leaves of 4-week-old in vitro-grown plants of ND98 with the RNAprep Pure Plant Kit (Tiangen Biotech, Beijing, China). RNA samples were reverse-transcribed according to the instructions of Quantscript Reverse Transcriptase Kit (Tiangen Biotech, Beijing, China). A rapid amplification of cDNA ends (RACE) procedure was employed to amplify the 5′ and 3′ ends of the coding region using GeneRacer™ Kit (Invitrogen, Carlsbad, CA, USA). Based on the sequence of EST, primers were designed using the Primer 3 program (http://frodo.wi.mit.edu/primer3/) and listed in Table 1.
Table 1. Primers used in this study.
Primer name | Primer sequence (5′-3′) |
Primers for 5′/3′ RACE | |
IbMas 3′ RACE primer 1 | TCTTGAAGACGGGAGGTGAT |
IbMas 3′ RACE primer 2 | GTTGAGGCACGGCCAGACTT |
IbMas 5′ RACE primer 1 | AAAATCACCTCCCGTCTTCA |
IbMas 5′ RACE primer 2 | TCCCGTCTTCAAGATTGCTT |
Primers for constructing expression vector | |
IbMas-oe-F | AGATCTATGAAAGGCGTCTTC |
IbMas-oe-R | CACGTGCTATACTAAGTTTCTAAAT |
Primers for identifying transformants | |
35S-F | GAACTCGCCGTAAAGACTGG |
IbMas-R | CCACTTTAGGGCCAAAATCA |
Primers for real-time quantitative PCR | |
Actin-F | AGCAGCATGAAGATTAAGGTTGTAGCAC |
Actin-R | TGGAAAATTAGAAGCACTTCCTGTGAAC |
IbMas-F | TGATTTTGGCCCTAAAGTGG |
IbMas-R | AATCCACCGAGTGCTGTACC |
P5CR-F | ATAGAGGCATTGGCTGATGG |
P5CR-R | GGTAGTCCCACCTGGTGATG |
P5CS-F | GCCTGATGCACTTGTTCAGA |
P5CS-R | TTGAGCAATTCAGGGACCTC |
PRK-F | GCTCTCAACATAGATCAGCT |
PRK-R | TGAAGGCTCTACTATCTCAT |
psbA-F | CATCCGTTGATGAATGGTTA |
psbA-R | GCAACAGGAGCTGAGTATGC |
SOD-F | TCCTGGACCTCATGGATTTC |
SOD-R | GCCACTATGTTTCCCAGGTC |
PCR amplifications were performed with an initial denaturation at 94°C for 3 min, followed by 35 cycles at 94°C for 30 s, 55°C for 30 s, 72°C for 1 min and final extension at 72°C for 10 min. PCR products were separated on a 1.0% (w/v) agarose gel. Target DNA bands were recovered by gel extraction, then cloned into PMD19-T (TaKaRa, Beijing, China), and finally transformed into competent cells of Escherichia coli strain DH5α. White colonies were checked by PCR and the positive colonies were sequenced (Invitrogen, Beijing, China).
Sequence analysis of IbMas gene
The full-length cDNA of IbMas gene was analyzed by an online BLAST at the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/). For the multiple sequence alignment analysis, the amino acid sequences of IbMas and other homologs from different plant species retrieved from NCBI were aligned using the DNAMAN software (Lynnon Biosoft, Quebec, Canada). The phylogenetic analysis was conducted with the Clustalx program. Theoretical molecular weight and isoelectric point (pI) were calculated using ProtParam tool (http://www.expasy.ch/tools/protparam.html). The conserved domain of IbMas protein was scanned by InterProScan program (http://www.ebi.ac.uk/interpro/).
Expression analysis of IbMas gene
The expression of IbMas gene in ND98 was analyzed by real-time quantitative PCR (qRT-PCR) according to the method of Liu et al. [18]. The 4-week-old in vitro-grown plants of ND98 were submerged in 1/2 MS medium containing 200 mM NaCl and 100 µM abscisic acid (ABA), respectively, and sampled at 0, 3, 6, 12, 24 and 48 h after treatment to analyze the expression of IbMas gene. Specific primers of the IbMas gene were listed in Table 1. A 169 bp fragment of sweetpotato β-actin gene (Genbank AY905538), used as an internal control, was amplified by the specific primers (Table 1). Quantification of the gene expression was done with comparative C T method [25].
Transformation of sweetpotato with the IbMas gene
The coding region of IbMas gene was amplified from ND98 using a pair of specific primers with terminal BglII and PmlI restriction sites (Table 1) and then inserted into the same restriction sites in vector pCAMBIA3301 to create expression vector pCAMBIA3301-IbMas under the control of CaMV 35S promoter and NOS terminator of the expression box. This vector also contained bar gene driven by a CaMV 35S promoter. The recombinant vector was transformed into the Agrobacterium tumefaciens strain EHA 105 for sweetpotato transformation.
Embryogenic suspension cultures of sweetpotato cv. Shangshu 19 were prepared as described by Liu et al. [26]. Sixteen weeks after initiation, cell aggregates 0.7–1.3 mm in size from embryogenic suspension cultures of 3 days after subculture were employed for the transformation. The IbMas-overexpressing sweetpotato plants were produced according to the method of Liu et al. [18], but selection culture was conducted using 0.8 mg L−1 phosphinothricin (PPT).
PCR analysis of the IbMas-overexpressing sweetpotato plants
PCR analysis of the putatively transgenic plants and wild-type plants was performed as described by Liu et al. [18]. Equal amounts of 200 ng of total DNA were amplified in 50 µL reactions using 35S forward and IbMas-specific reverse primers (Table 1). These primers were expected to give products of 640 bp. PCR amplifications were performed with an initial denaturation at 94°C for 3 min, followed by 35 cycles at 94°C for 30 s, 55°C for 30 s, 72°C for 1 min and final extension at 72°C for 10 min. PCR products were separated by electrophoresis on a 1.0% (w/v) agarose gel.
In vitro assay for salt tolerance
Based on the method of He et al. [1], the transgenic plants and wild-type plants were cultured on Murashige and Skoog (MS) medium with 86 mM NaCl in order to evaluate their in vitro salt tolerance at 27±1°C under 13 h of cool-white fluorescent light at 54 µM m−2 s−1. Three plants were treated for each line. The growth and rooting ability were continuously observed for 4 weeks.
Analyses of proline and MDA content, SOD activity and fresh weight
The transgenic plants and wild-type plants cultured on MS medium with 86 mM NaCl for 4 weeks were used to analyze their proline and malonaldehyde (MDA) content, superoxide dismutase (SOD) activity and fresh weight. Proline content and SOD activity were analyzed as described by He et al. [1]. MDA content was measured according to the method of Gao et al. [2]. The plant fresh weight was measured immediately.
Expression analysis of IbMas gene in the transgenic plants
The expression of the IbMas gene in the transgenic plants and wild-type plants was analyzed by qRT-PCR. The transgenic and wild-type in vitro-grown plants were submerged for 12 h in 1/2 MS medium with 200 mM NaCl. qRT-PCR analysis was performed as described above.
In vivo assay for salt tolerance
The transgenic plants and wild-type plants were transferred to soil in a greenhouse for further evaluation of salt tolerance. The cuttings about 25 cm in length were cultured in the Hoagland solution [27] with 0 and 86 mM NaCl, respectively. Three cuttings were treated for each line. The growth and rooting ability were continuously observed for 4 weeks.
The 25-cm-long cuttings of the salt-tolerant transgenic plants evaluated with water culture assay and wild-type plants were grown in 19-cm diameter pots containing a mixture of soil, vermiculite and humus (1∶1∶1, v/v/v) in a greenhouse, with one cutting per pot, for further assay for salt tolerance according to the method of Liu et al. [18].
Measurement of photosynthesis
Photosynthetic rate, stomatal conductance and transpiration rate in the leaves of the salt-tolerant transgenic plants and wild-type plants grown in pots for 2 weeks under 200 mM NaCl stress were measured according to the methods of Liu et al. [18]. Relative chlorophyll content (SPAD value in fresh leaves) was measured as described by Fernández-Falcón et al. [28] with Chlorophyll Meter SPAD-502 (Minolta, Japan). The experiments were conducted at 9-11 a.m. of sunny days.
Analysis of H2O2 accumulation
H2O2 accumulation in the leaves of the salt-tolerant transgenic plants and wild-type plants grown in pots for 2 weeks under 200 mM NaCl stress was analyzed by using 3, 3'-diaminobenzidine (DAB) staining as described by Liu et al. [18].
Expression analyses of salt stress responsive genes
The expression of salt stress responsive genes in the salt-tolerant transgenic plants and wild-type plants was analyzed by qRT-PCR. The transgenic and wild-type in vitro-grown plants were submerged for 12 h in 1/2 MS medium containing 0 and 200 mM NaCl, respectively. The qRT-PCR analysis was performed as described by Liu et al. [18]. Specific primers designed from conserved regions of genes were listed in Table 1. Sweetpotato β-actin gene was used as an internal control (Table 1). Quantification of the gene expression was done with comparative C T method [25].
Statistical analysis
The experiments were repeated three times and the data presented as the mean ± SE were analyzed by Student's t-test in a two-tailed analysis to compare the parameters obtained under normal or salt stress conditions. A P value of <0.05 or <0.01 was considered to be statistically significant.
Results
Cloning and sequence analysis of IbMas gene
The IbMas gene was cloned from salt-tolerant sweetpotato line ND98 by RACE and submitted to GenBank (accession no. KM095957). The cDNA sequence of 1564 bp contained an 1233 bp open reading frame (ORF) encoding a 410 amino acids polypeptide with a molecular weight of 45.4 kDa and an isoelectric point (pI) of 6.27. Sequence analysis via InterPro program (http://www.ebi.ac.uk/interpro/) showed that IbMas protein contained typical maspardin domain and belonged to α/β-hydrolase superfamily (Fig. 1). A BLASTX search indicated that no homolog of known function was similar to IbMas in plants, while the amino acid sequence of IbMas showed 66.99% to 71.53% amino acid identity with predicted protein products of XP_002509605 from Ricinus communis, KDP25601 from Jatropha curcas, XP_006368699 from Populus trichocarpa, EXC17874 from Morus notabilis, XP_004245715 from Solanum lycopersicum, XP_002267811 from Vitis vinifera, XP_007039974 from Theobroma cacao and XP_006363736 from Solanum tuberosum. Phylogenetic analysis revealed that IbMas had a close relationship with predicted protein products of XP_006363736 from Solanum tuberosum and XP_004245715 from Solanum lycopersicum (Fig. 2).
Figure 1. Sequence alignment of IbMas protein with its homologous proteins from various plant species.
The proteins are as follows: XP_006363736 from Solanum tuberosum, XP_007039974 from Theobroma cacao, XP_002267811 from Vitis vinifera, XP_004245715 from Solanum lycopersicum, EXC17874 from Morus notabilis, XP_006368699 from Populus trichocarpa, KDP25601 from Jatropha curcas and XP_002509605 from Ricinus communis. The maspardin domain is marked by asterisk line.
Figure 2. Phylogenetic tree of IbMas protein with its homologous proteins.
The branch lengths are proportional to distance.
Expression analysis of IbMas gene in ND98
The expression of IbMas gene in response to salt stress and ABA treatment was examined by qRT-PCR (Fig. 3). An increase in the IbMas transcript was observed after 3 h of exposure to 200 mM NaCl, peaked at 12 h with the 3.5-fold higher expression level than that of untreated control, and thereafter declined (Fig. 3A). For 100 µM ABA treatment, the expression of IbMas was induced rapidly to the highest level (12.2-fold) at 3 h, followed by a decrease (Fig. 3B).
Figure 3. Expression analysis of the IbMas gene in sweetpotato line ND98 by real-time quantitative PCR.
(A) and (B) Relative expression level of IbMas in ND98 after different times (h) of 200 mM NaCl and 100 µM ABA treatment, respectively. The 4-week-old in vitro-grown plants of ND98 were submerged in 1/2 MS medium containing 200 mM NaCl and 100 µM ABA, respectively, and sampled at 0, 3, 6, 12, 24 and 48 h after treatment to analyze the expression of IbMas. The sweetpotato β-actin gene was used as an internal control. Data are presented as means ± SE (n = 3).
Production of the IbMas-overexpressing sweetpotato plants
A total of 1000 cell aggregates of sweetpotato cv. Shangshu 19 (Fig. 4A) cocultivated with A. tumefaciens strain EHA 105 were cultured on the selective medium with 2.0 mg L−1 2,4-dichlorophenoxyacetic acid (2,4-D), 100 mg L−1 carbenicillin (Carb) and 0.8 mg L−1 PPT. Eight weeks after selection, 72 PPT-resistant embryogenic calluses were produced from them (Fig. 4B) and transferred to MS medium with 1.0 mg L−1 ABA, 100 mg L−1 Carb and 0.8 mg L−1 PPT. After 5 to 6 weeks, 61 of them formed somatic embryos which further germinated into plantlets on the same medium (Fig. 4C). These plantlets developed into whole plants on the basal medium. A total of 173 putatively transgenic plants, named L1, L2, …, L173, respectively, were obtained in the present study.
Figure 4. Production of transgenic sweetpotato plants overexpressing the IbMas gene.
(A) Embryogenic suspension cultures rapidly proliferating in MS medium containing 2.0 mg L−1 2,4-D. (B) PPT-resistant calluses formed on MS medium with 2.0 mg L−1 2,4-D, 100 mg L−1 Carb and 0.8 mg L−1 PPT after 8 weeks of selection. (C) Regeneration of plantlets from PPT-resistant calluses on MS medium with 1.0 mg L−1 ABA, 100 mg L−1 Carb and 0.8 mg L−1 PPT. (D) PCR analysis of transgenic plants. Lane M: DL2000 DNA marker; Lane W: water as negative control; Lane P: plasmid pCAMBIA3301-IbMas as positive control; Lane WT: wild-type as negative control; Lanes L39, L52, L55, L99, L101, L102 and L109: transgenic plants. (E) and (F) WT and transgenic plants grown in a greenhouse, respectively. (G) and (H) WT and transgenic plants grown in a field, respectively. (I) and (J) Storage roots of WT and transgenic plants, respectively.
The 173 putatively transgenic plants were analyzed by PCR amplification. The results showed that 119 of them had a specific 640 bp band of the IbMas gene, while no amplification occurred with the DNA from the remaining 54 putatively transgenic plants and wild-type plant and water (Fig. 4D), indicating that the 119 plants were transgenic.
Improved salt tolerance in the IbMas-overexpressing sweetpotato
Thirty-six transgenic plants were randomly sampled for evaluating their salt tolerance. The transgenic plants and wild-type plants showed the similar growth and rooting on MS medium without NaCl. After cultured for 4 weeks on MS medium with 86 mM NaCl, the transgenic plants exhibited vigorous growth and good rooting in contrast to the poor-growing wild-type plants (Fig. 5A). This observation indicated that the transgenic plants had higher salt tolerance than wild-type plants.
Figure 5. Responses of the IbMas-overexpressing sweetpotato plants under 86 mM NaCl stress.
(A) The growth and rooting of trangenic plants and wild-type plant (WT) cultured for 4 weeks on MS medium supplemented with 86 mM NaCl. (B) and (C) Phenotypes of salt-tolerant transgenic plants (L52, L99, L102 and L101) and WT incubated for 4 weeks in Hoagland solution with 86 mM NaCl; all of the cuttings of L52, L99, L102 and L101 formed obvious new leaves and roots and those of WT died.
Proline and MDA content, SOD activity and fresh weight of the 36 transgenic plants were shown in Table 2. Proline content, SOD activity and fresh weight were significantly higher in the 11 transgenic plants than in wild-type plants, while MDA content was significantly lower in these 11 transgenic plants than in wild-type plants. These results suggest that the high salt tolerance observed is due, at least in part, to the modulation of existing salt tolerance pathways.
Table 2. Comparison of salt tolerance between the IbMas-overexpressing plants and wild-type plants.
Plant lines | Proline content (µg g−1 FW) | SOD activity (U g−1 FW) | MDA content (nM g−1 FW) | Fresh weight (g−1 plant) |
L52 | 53.76±1.25**a | 564.88±6.77** | 19.46±0.40** | 1.16±0.03** |
L99 | 52.58±2.21** | 553.84±10.89** | 19.17±0.54** | 1.07±0.09** |
L101 | 51.78±0.92** | 533.59±12.33** | 20.52±0.56** | 0.98±0.03** |
L102 | 49.47±1.22** | 539.67±7.89** | 20.77±1.35** | 0.93±0.08** |
L51 | 48.44±0.60** | 532.13±6.68** | 21.78±0.54** | 0.82±0.04** |
L39 | 48.01±1.30** | 537.77±14.27** | 21.70±0.98** | 0.85±0.07** |
L55 | 47.98±1.06** | 501.66±6.78** | 23.20±0.32** | 0.69±0.06** |
L28 | 47.64±0.93** | 472.39±7.52* | 29.92±0.55 | 0.56±0.05* |
L37 | 46.06±0.58** | 513.29±4.88** | 22.62±0.69** | 0.76±0.05** |
L53 | 45.38±1.83** | 503.51±3.98** | 22.40±0.51** | 0.71±0.05** |
L59 | 45.00±1.71** | 502.44±14.36* | 26.05±1.35* | 0.78±0.06** |
L109 | 44.34±2.41* | 496.79±8.04** | 26.28±1.74* | 0.60±0.04** |
L3 | 43.38±2.75* | 450.54±15.05 | 30.37±0.53 | 0.61±0.06** |
L75 | 41.23±2.77* | 478.03±3.75** | 29.23±0.51 | 0.53±0.03** |
L79 | 40.88±1.25** | 489.78±10.54* | 29.52±1.25 | 0.55±0.03** |
L43 | 40.77±0.59** | 453.31±7.05 | 30.40±0.58 | 0.51±0.04* |
L17 | 38.02±2.32 | 440.66±11.44 | 30.41±0.63 | 0.47±0.04 |
L61 | 37.08±2.61 | 471.61±5.59* | 26.98±0.38** | 0.50±0.04* |
L96 | 36.12±2.09 | 455.28±5.93 | 25.35±0.91** | 0.47±0.02* |
L11 | 35.97±2.98 | 493.68±3.51** | 28.32±0.52* | 0.49±0.02** |
L23 | 35.08±1.84 | 463.01±7.82 | 25.78±1.11* | 0.46±0.03* |
L113 | 34.93±2.84 | 448.83±9.98 | 31.01±1.39 | 0.42±0.03 |
L88 | 33.81±1.28 | 432.31±14.33 | 31.46±0.79 | 0.44±0.03* |
L72 | 33.60±1.74 | 454.37±3.02 | 30.92±1.52 | 0.45±0.05 |
L81 | 32.97±0.83 | 414.84±14.34 | 31.85±0.74 | 0.45±0.02* |
L47 | 32.75±2.54 | 446.26±8.43 | 32.15±1.88 | 0.39±0.04 |
L9 | 32.51±1.28 | 467.60±12.04 | 30.90±0.64 | 0.41±0.04 |
WT | 31.94±1.27 | 436.33±6.48 | 31.75±0.79 | 0.32±0.03 |
L69 | 31.62±0.98 | 428.81±5.21 | 31.68±1.71 | 0.40±0.04 |
L18 | 31.05±0.66 | 410.09±10.21 | 33.97±1.95 | 0.41±0.03 |
L92 | 30.68±1.05 | 418.41±5.68 | 32.30±1.48 | 0.38±0.03 |
L1 | 30.56±0.60 | 386.15±2.68 | 34.75±1.16 | 0.35±0.02 |
L60 | 30.26±1.33 | 424.87±8.12 | 33.94±0.59 | 0.34±0.03 |
L70 | 29.93±2.05 | 408.56±6.32 | 32.78±0.32 | 0.36±0.04 |
L83 | 29.86±0.85 | 396.41±2.51 | 35.35±1.19 | 0.32±0.03 |
L67 | 28.42±1.76 | 380.32±9.51 | 35.43±1.59 | 0.31±0.01 |
L10 | 27.96±1.86 | 395.35±4.04 | 35.08±0.87 | 0.31±0.02 |
Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of the wild-type (WT) at P<0.05 and <0.01, respectively, by Student's t-test.
qRT-PCR analysis indicated that there was positive correlationship between expression level of IbMas gene and salt tolerance of transgenic plants (Fig. 6). Especially, the 4 transgenic plants, L52, L99, L101 and L102, showed significantly higher level of IbMas gene expression than that of the other 32 transgenic plants and wild-type (Fig. 6).
Figure 6. Expression analysis of IbMas gene in the transgenic sweetpotato plants by real-time quantitative PCR.
The 36 transgenic and wild-type (WT) in vitro-grown plants were submerged in 1/2 MS medium with 200 mM NaCl for 12 h to analyze the expression of IbMas. The sweetpotato β-actin gene was used as an internal control. The results are expressed as relative values based on WT as reference sample set to 1.0. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P<0.05 and <0.01, respectively, by Student's t-test.
The 11 transgenic plants and wild-type plants were transferred to the soil in a greenhouse and a field, and showed 100% survival (Fig. 4E-J). No morphological variations were observed (Fig. 4E-J). For further evaluation of salt tolerance, the cuttings of these 11 transgenic plants and wild-type plants were cultured for 4 weeks in the Hoagland solution containing 0 and 86 mM NaCl, respectively. The growth and rooting of all cuttings were normal without NaCl. And at 86 mM NaCl, the 4 transgenic plants (L52, L99, L101 and L102) formed obvious new leaves and roots, the number and length of which were significantly higher compared to wild-type plants; the 5 transgenic plants survived, but failed to form new leaves; the 2 transgenic plants and wild-type plants gradually turned brown to death (Fig. 5B, C; Table 3). These results demonstrated that L52, L99, L101 and L102 had significantly higher salt tolerance than the other transgenic plants and wild-type plants.
Table 3. Leaf and root formation of the IbMas-overexpressing sweetpotato plants after 4 weeks of water culture with 86 mM NaCl.
Plant lines | Leaf formation | No. of roots | Length of roots (cm) |
L52 | ++a | 29.33±3.84**b | 7.03±1.23** |
L99 | ++ | 25.00±5.13* | 7.07±1.19** |
L102 | ++ | 23.67±4.48* | 5.83±0.60** |
L101 | ++ | 19.33±2.33** | 6±1.65* |
L37 | + | 14.67±4.98 | 4.83±0.17** |
L39 | + | 14.33±2.96* | 4.97±2.01 |
L53 | + | 13.00±5.69 | 3.23±1.82 |
L51 | + | 10.00±3.79 | 4.53±1.54 |
L55 | + | 8.67±2.33 | 4.23±2.12 |
L109 | - | 4.33±0.67 | 3.50±1.44 |
L59 | - | 4.00±1.53 | 2.83±1.27 |
WT | - | 3.33±0.88 | 1.03±0.12 |
‘++’ indicates that cuttings formed obvious new leaves; ‘+’ indicates that cuttings survived, but failed to form new leaves; ‘-’ indicates that cuttings died.
Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of the wild-type (WT) at P<0.05 and <0.01, respectively, by Student's t-test.
The 4 salt-tolerant transgenic plants L52, L99, L101 and L102 and wild-type plants were grown in pots and irrigated a 200 mL of 0 and 200 mM NaCl solution, respectively, once every 2 days for 4 weeks. The growth and rooting of all cuttings were normal without NaCl (Fig. 7). And at 200 mM NaCl, the 4 salt-tolerant plants showed good growth and increased physical size, while wild-type plants died (Fig. 7). Fresh weight (FW) and dry weight (DW) of the 4 salt-tolerant plants were increased by 113–220% and 12–108%, respectively, compared to the wild-type (Fig. 8).
Figure 7. Phenotypes of the IbMas-overexpressing sweetpotato plants grown in pots under 200 mM NaCl stress.
The 25-cm-long cuttings of the salt-tolerant transgenic plants (L52, L99, L102 and L101) and wild-type plants (WT) were grown in 19-cm diameter pots containing a mixture of soil, vermiculite and humus (1∶1∶1, v/v/v) in a greenhouse, with one cutting per pot. All pots were irrigated sufficiently with half-Hoagland solution for 10 days until the cuttings formed new leaves, and then each pot was irrigated a 200 mL of 0 and 200 mM NaCl solution, respectively, once every 2 days for 4 weeks. All of L52, L99, L102 and L101 plants showed good growth and increased physical size and those of WT died under 200 mM NaCl stress.
Figure 8. Biomass of the IbMas-overexpressing sweetpotato plants grown in pots under 200 mM NaCl stress.
The 25-cm-long cuttings of the salt-tolerant transgenic plants (L52, L99, L102 and L101) and WT were grown in 19-cm diameter pots containing a mixture of soil, vermiculite and humus (1∶1∶1, v/v/v) in a greenhouse, with one cutting per pot, and treated as described in Fig. 6. After treatment, the plant fresh weight (FW) was measured immediately. The plants were then dried for 24 h in an oven at 80°C and weighed (DW). All treatments were performed in triplicate. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P<0.05 and <0.01, respectively, by Student's t-test.
Enhanced photosynthesis in the salt-tolerant transgenic plants
Photosynthesis in the leaves of the 4 salt-tolerant transgenic plants grown in pots for 2 weeks under 200 mM NaCl stress was measured. The salt-tolerant transgenic plants maintained significantly higher photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll relative content, which were increased by 8–25%, 7–22%, 15–41% and 13–24%, respectively, compared to the wild-type (Fig. 9).
Figure 9. Photosynthetic performance of the IbMas-overexpressing sweetpotato plants under salt stress.
(A), (B), (C) and (D) Photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll relative content, respectively, in the leaves of salt-tolerant transgenic plants (L52, L99, L102 and L101) and wild-type plant (WT). The 25-cm-long cuttings of the salt-tolerant transgenic plants evaluated with water culture assay and WT were grown in 19-cm diameter pots containing a mixture of soil, vermiculite and humus (1∶1∶1, v/v/v) in a greenhouse, with one cutting per pot. All pots were irrigated sufficiently with half-Hoagland solution for 10 days until the cuttings formed new leaves, and then each pot was irrigated with a 200 mL of 200 mM NaCl solution once every 2 days for 2 weeks. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P<0.05 and <0.01, respectively, by Student's t-test.
Reduced H2O2 accumulation in the salt-tolerant transgenic plants
Abiotic stress induces the accumulation of H2O2, which is the toxic molecule that causes oxidative damage in plants [29]. To explore the potential mechanism by which IbMas improved salt tolerance in sweetpotato, H2O2 accumulation was analyzed by using DAB staining of leaves from the 4 salt-tolerant transgenic plants and wild-type plants under 200 mM NaCl stress for 2 weeks. The leaves of the salt-tolerant transgenic plants displayed less brown spots and diffuse staining than those of wild-type plants, indicating less H2O2 accumulation in the salt-tolerant transgenic plants (Fig. 10A). The statistical analysis further confirmed that significantly less H2O2 was accumulated in the salt-tolerant transgenic plants compared to the wild-type under salt stress (Fig. 10B).
Figure 10. Effects of salt stress on H2O2 accumulation in the IbMas-overexpressing sweetpotato plants.
(A) Accumulation of H2O2 in the leaves of salt-tolerant transgenic plants (L52, L99, L102 and L101) and wild-type plant (WT). A plant grown in a 19-cm diameter pot was irrigated with a 200 mL of 200 mM NaCl solution once every 2 days for 2 weeks. (B) The average intensity of DAB staining leaves after converting to 256 grey scale images. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P<0.05 and <0.01, respectively, by Student's t-test.
Expression analyses of salt stress responsive genes
Expression of IbMas, proline biosynthesis, photosynthesis and SOD genes in the salt-tolerant transgenic plants was analyzed by qRT-PCR. The expression level of IbMas gene was significantly higher in the transgenic plants compared to wild-type plants (Fig. 11). To investigate the impact of IbMas overexpression on the transcription of salt stress response related genes, the expression of well-known salt stress responsive marker genes encoding pyrroline-5-carboxylate synthase (P5CS), pyrroline-5-carboxylate reductase (P5CR) and SOD was analyzed under salt stress (Fig. 11). P5CS, P5CR and SOD genes exhibited significantly increased expression level in the salt-tolerant transgenic plants compared to the wild-type under salt stress (Fig. 11). The expression level of psbA and PRK genes, which encode D1 protein and phosphoribulokinase (PRKase), respectively, was also higher in transgenic plants than in wild-type plants (Fig. 11).
Figure 11. Relative expression level of IbMas and salt stress responsive genes in the IbMas-overexpressing sweetpotato plants.
P5CS: pyrroline-5-carboxylate synthase; P5CR: pyrroline-5-carboxylate reductase; SOD: superoxide dismutase; psbA: encoding D1 protein; PRK: phosphoribulokinase (PRKase). The salt-tolerant transgenic plants (L52, L99, L102 and L101) and wild-type plant (WT) in vitro-grown plants were submerged for 12 h in 1/2 MS medium containing 0 and 200 mM NaCl, respectively. The sweetpotato β-actin gene was used as an internal control. The results are expressed as relative values based on WT grown under control condition as reference sample set to 1.0. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P<0.05 and <0.01, respectively, by Student's t-test.
Discussion
Soil salinity is one of the major factors that limit the productivity and quality of crops. Plant genetic engineering provides the potential for breeding salt-tolerant varieties. Overexpression of salt tolerance related genes is an important strategy for improving salt tolerance of crops.
The maspardin protein was first identified as an intracellular binding protein for the cell surface glycoprotein CD4 and proposed to modulate CD4 stimulatory activity [14]. Simpson et al. [16] reported that a nucleotide insertion (601insA) mutation in the maspardin gene resulted in the complicated form of hereditary spastic paraplegia known as Mast syndrome. However, the maspardin gene has not been characterized at the functional level in plants. In the present study, we isolated the maspardin gene from salt-tolerant sweetpotato line ND98. Sequence analysis showed that the protein contained typical maspardin domain and thus is named IbMas (Fig. 1). BLAST analysis indicated that IbMas protein exhibited 62.68% amino acid identity to an α/β-hydrolase superfamily protein in Arabidopsis thaliana (NP_192960). However, there was no report about Arabidopsis mutant for NP_192960. Furthermore, the present results demonstrated that no homolog of known function in other plants was similar to IbMas. Therefore, it is thought that IbMas is a novel gene.
The expression of IbMas gene was induced by salt stress and peaked at 12 h of salt stress (Fig. 3A), indicating that IbMas may play an important role in response of sweetpotato to salt stress. We found that overexpression of IbMas significantly enhanced the salt tolerance of sweetpotato (Figs. 5, 7). In addition, IbMas was also induced in the presence of ABA, and the transcript reached the highest level at 3 h under ABA treatment (Fig. 3B). It is well established that salt stress is able to induce ABA biosynthesis and trigger ABA-dependent signaling pathways [30], [31]. Thus, it is assumed that Ibmas gene may regulate sweetpotato salt stress response in an ABA-dependent manner similar to those of OsMYB2 in rice [32], AtLPK1 in Arabidopsis [33] and LcDREB2 in Leymus chinensis [34].
Osmotic stress often results in more accumulation of proline, and the level of proline accumulation is related to the extent of salt tolerance [18], [24], [35], [36]. In the present study, most of the IbMas-overexpressing sweetpotato plants had significantly higher proline content compared to wild-type plants under salt stress, indicating measurable improvement of salt tolerance (Table 2; Figs. 5, 7). Proline accumulation in the IbMas-overexpressing sweetpotato plants most likely maintains the osmotic balance between the intracellular and extracellular environment under salt stress, which results in the improved salt tolerance [37], [38]. Also, proline helps cells to maintain membrane integrity [39], [40] and has been proposed to function as molecular chaperone stabilizing the structure of proteins [41]. Therefore, it is assumed that proline accumulation in the IbMas-overexpressing sweetpotato plants might protect the cell membrane from salt-induced injuries. It was also found that the expression of P5CS and P5CR genes was up-regulated in the transgenic sweetpotato plants under salt stress (Fig. 11). Thus, the present results suggest that overexpression of IbMas in sweetpotato plants increases proline accumulation by up-regulating the expression of P5CS and P5CR genes.
MDA is often considered a reflection of cellular membrane degradation, and its accumulation increases with production of superoxide radicals and hydrogen peroxide [29]. Higher MDA content can induce cell membrane damage, which further reduces salt tolerance of plants [18], [24], [42], [43]. In the present study, most of the IbMas-overexpressing sweetpotato plants had significantly lower MDA content compared to wild-type plants, also indicating the marked improvement of their salt tolerance (Table 2).
Salinity perturbs plant water uptake in leaves, leading to quick response in stomatal conductance. It also disrupts the osmotic, ionic and nutrient balances in plants. This affects photosynthetic electron transport and the activities of enzymes for carbon fixation [44], [45]. Salinity induces ROS production in plant cells [29], [46], [47]. It is thought that an effect of ROS is the inhibition of the repair of photodamaged PSII by the suppression of de novo protein synthesis; the primary sites of photodamage are the oxygen-evolving complex and the D1 proteins [48]. The damaging effects of singlet oxygen and hydroxyl radicals on PSII can be reduced by proline in isolated thylakoid membranes [49]. Proline protects PSII photofunctions against photodamage which gets accelerated in plants under salt stress [49], [50], [51]. In our study, the IbMas-overexpressing sweetpotato plants exhibited higher photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll relative content compared to wild-type plants under salt stress (Fig. 9). Also, the expression of psbA and PRK genes was up-regulated in the transgenic plants (Fig. 11). The biomass difference between the IbMas-overexpressing plants and wild-type plants is thought to be due to the photosynthesis difference under salt stress (Fig. 8). The less affected photosynthesis of the IbMas-overexpressing sweetpotato plants could be explained by that the accumulated proline in the transgenic plants provides protection against photoinhibition under salt stress.
Salinity leads to the overproduction of reactive oxygen species (ROS) in plants which are highly reactive and toxic and cause damage to proteins, lipids, carbohydrates and DNA which ultimately results in oxidative stress. ROS scavenging systems of plants detoxify ROS to minimize and/or prevent oxidative damage in cells by increasing the activity of ROS scavenging enzymes [52]. As a key enzyme of ROS scavenging system, SOD is usually induced by salinity to enhance the timely dismutation of superoxide into oxygen and H2O2, which is subsequently removed through different pathways [53], [54]. Thus, SOD activity is often used to test the salt tolerance of plants [18], [24], [55], [56]. In the present study, the IbMas-overexpressing sweetpotato plants had significantly higher SOD activity and significantly less H2O2 accumulation compared to wild-type plants, which further showed the marked improvement of their salt tolerance (Table 2; Fig. 10). Consistent with this phenomenon, the increased SOD expression was also detected in the transgenic plants (Fig. 11). It is suggested that the improved salt tolerance of the transgenic sweetpotato plants is also due to the enhanced ROS scavenging capacity [18], [24], [54], [55], [56]. It has been reported that proline acted as a ROS scavenger under abiotic stress [57]. Proline is an effective scavenger of singlet oxygen and hydroxyl radicals [57], [58]. Thus, our results support that more proline accumulation in the IbMas-overexpressing sweetpotato plants increases the expression of SOD gene, which enhances ROS scavenging capacity.
In conclusion, a novel maspardin gene, IbMas, has been successfully isolated from salt-tolerant sweetpotato line ND98. The IbMas-overexpressing sweetpotato plants exhibited significantly higher salt tolerance compared with the wild-type. Our results suggest that overexpression of IbMas enhances salt tolerance of the transgenic sweetpotato plants by regulating osmotic balance, protecting membrane integrity and photosynthesis and increasing reactive oxygen species scavenging capacity.
Acknowledgments
We thank Dr. Michael Portereiko, Ceres, Inc. USA, and Dr. Daniel Q. Tong, University of Maryland, USA, for English improvement. We also thank Prof. Wang T, State Key Laboratory of Agrobiotechnology, Beijing, China, for providing Strain EHA 105.
Data Availability
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper.
Funding Statement
This work was supported by the National Natural Science Foundation of China (31371680, 31271777) and China Agriculture Research System (CARS-11, Sweetpotato). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. He SZ, Han YF, Wang YP, Zhai H, Liu QC (2009) In vitro selection and identification of sweetpotato (Ipomoea batatas (L.) Lam.) plants tolerant to NaCl. Plant Cell Tiss Organ Cult 96:69–74. [Google Scholar]
- 2. Gao S, Yuan L, Zhai H, Liu CL, He SZ, et al. (2011) Transgenic sweetpotato plants expressing an LOS5 gene are tolerant to salt stress. Plant Cell Tiss Organ Cult 107:205–213. [Google Scholar]
- 3. Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev Plant Biol 59:651–681. [DOI] [PubMed] [Google Scholar]
- 4. Zhao Q, Zhang H, Wang T, Chen SX, Dai SJ (2013) Proteomics-based investigation of salt-responsive mechanisms in plant roots. J Proteomics 82:230–253. [DOI] [PubMed] [Google Scholar]
- 5. Bugg TD (2004) Diverse catalytic activities in the α/β-hydrolase family of enzymes: activation of H2O, HCN, H2O2, and O2 . Bioorg Chem 32:367–375. [DOI] [PubMed] [Google Scholar]
- 6. Jochens H, Hesseler M, Stiba K, Padhi SK, Kazlauskas RJ, et al. (2011) Protein engineering of α/β-hydrolase fold enzymes. ChemBioChem 12:1508–1517. [DOI] [PubMed] [Google Scholar]
- 7. Lenfant N, Hotelier T, Bourne Y, Marchot P, Chatonnet A (2013) Proteins with an alpha/beta hydrolase fold: Relationships between subfamilies in an ever-growing superfamily. Chem-biol Interact 203:266–268. [DOI] [PubMed] [Google Scholar]
- 8. Lord CC, Thomas G, Brown JM (2013) Mammalian alpha beta hydrolase domain (ABHD) proteins: Lipid metabolizing enzymes at the interface of cell signaling and energy metabolism. Biochim Biophys Acta 1831:792–802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Lenfant N, Hotelier T, Velluet E, Bourne Y, Marchot P, et al. (2012) ESTHER, the database of the α/β-hydrolase fold superfamily of proteins: tools to explore diversity of functions. Nucleic Acids Res 41:423–429. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Swapna TS (2002) Esterase as molecular marker for salt tolerance in regenerated plants of rice, Oryza sativa L. Indian J Exp Biol 40:1056–1059. [PubMed] [Google Scholar]
- 11. Wang XM (2002) Phospholipase D in hormonal and stress signaling. Curr Opin Plant Biol 5:408–414. [DOI] [PubMed] [Google Scholar]
- 12. Hong YY, Zhang WH, Wang XM (2010) Phospholipase D and phosphatidic acid signalling in plant response to drought and salinity. Plant Cell Environ 33:627–635. [DOI] [PubMed] [Google Scholar]
- 13. Tan CM, Chen RJ, Zhang JH, Gao XL, Li LH, et al. (2013) OsPOP5, a prolyl oligopeptidase family gene from rice confers abiotic stress tolerance in Escherichia coli . Int J Mol Sci 14:20204–20219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Zeitlmann L, Sirim P, Kremmer E, Kolanus W (2001) Cloning of ACP33 as a novel intracellular ligand of CD4. J Biol Chem 276:9123–9132. [DOI] [PubMed] [Google Scholar]
- 15. Hanna M, Blackstone C (2009) Interaction of the SPG21 protein ACP33/maspardin with the aldehyde dehydrogenase ALDH16A1. Neurogenetics 10:217–228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Simpson MA, Cross H, Proukakis C, Pryde A, Hershberger R, et al. (2003) Maspardin is mutated in Mast syndrome, a complicated form of hereditary spastic paraplegia associated with dementia. Am J Hum Genet 73:1147–1156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Zang N, Zhai H, Gao S, Chen W, He SZ, et al. (2009) Efficient production of transgenic plants using the bar gene for herbicide resistance in sweetpotato. Sci Hortic 122:649–653. [Google Scholar]
- 18. Liu DG, He SZ, Zhai H, Wang LJ, Zhao Y, et al. (2014) Overexpression of IbP5CR enhances salt tolerance in transgenic sweetpotato. Plant Cell Tiss Organ Cult 117:1–16. [Google Scholar]
- 19. Dhir SK, Oglesby J, Bhagsari AS (1998) Plant regeneration via embryogenesis and transient gene expression in sweet potato protoplasts. Plant Cell Rep 17:665–669. [DOI] [PubMed] [Google Scholar]
- 20. Liu QC (2011) Sweetpotato omics and biotechnology in China. Plant Omics 4:295–301. [Google Scholar]
- 21. Jiang T, Zhai H, Wang FB, Yang NK, Wang B, et al. (2013) Cloning and characterization of a carbohydrate metabolism-associated gene IbSnRK1 from sweetpotato. Sci Hortic 158:22–32. [Google Scholar]
- 22. Chen HJ, Su CT, Lin CH, Huang GJ, Lin YH (2010) Expression of sweet potato cysteine protease SPCP2 altered developmental characteristics and stress responses in transgenic Arabidopsis plants. J Plant Physiol 167:838–847. [DOI] [PubMed] [Google Scholar]
- 23. Wang LJ, He SZ, Zhai H, Liu DG, Wang YN, et al. (2013) Molecular cloning and functional characterization of a salt tolerance-associated gene IbNFU1 from sweetpotato. J Integr Agr 12:27–35. [Google Scholar]
- 24. Liu DG, Wang LJ, Liu CL, Song XJ, He SZ, et al. (2014) An Ipomoea batatas iron-sulfur cluster scaffold protein gene, IbNFU1, is involved in salt tolerance. PLoS ONE 9(4):e93935. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nat Protocols 3:1101–1108. [DOI] [PubMed] [Google Scholar]
- 26. Liu QC, Zhai H, Wang Y, Zhang DP (2001) Efficient plant regeneration from embryogenic suspension cultures of sweetpotato. In Vitro Cell Dev Biol Plant 37:564–567. [Google Scholar]
- 27. Hoagland DR, Arnon DI (1950) The water-culture method for growing plants without soil. Calif Agric Exp Stn Circ 347:1–39. [Google Scholar]
- 28. Fernández-Falcón M, Hernández M, Alvarez CE, Borges AA (2006) Variation in nutrition along time and relative chlorophyll content of Leucospermum cordifolium cv. ‘High Gold’, and their relationship with chlorotic sypmptoms. Sci Hortic 107:373–379. [Google Scholar]
- 29. Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55:73–399. [DOI] [PubMed] [Google Scholar]
- 30. Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53:247–273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61:651–679. [DOI] [PubMed] [Google Scholar]
- 32. Yang A, Dai XY, Zhang WH (2012) A R2R3-type MYB gene, OsMYB2, is involved in salt, cold, and dehydration tolerance in rice. J Exp Bot 63:2541–2556. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Huang P, Ju HW, Min JH, Zhang X, Kim SH, et al. (2013) Overexpression of L-type lectin-like protein kinase 1 confers pathogen resistance and regulates salinity response in Arabidopsis thaliana . Plant Sci 203–204:98–106. [DOI] [PubMed] [Google Scholar]
- 34. Peng XJ, Zhang LX, Zhang LX, Liu ZJ, Cheng LQ, et al. (2013) The transcriptional factor LcDREB2 cooperates with LcSAMDC2 to contribute to salt tolerance in Leymus chinensis . Plant Cell Tiss Organ Cult 113:245–256. [Google Scholar]
- 35. Sun YG, Wang B, Jin SH, Qu XX, Li YJ, et al. (2013) Ectopic expression of Arabidopsis glycosyltransferase UGT85A5 enhances salt stress tolerance in tobacco. PLoS ONE 8:e59924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Xu JY, Xue CC, Xue D, Zhao JM, Gai JY, et al. (2013) Overexpression of GmHsp90s, a heat shock protein 90 (Hsp90) gene family cloning from soybean, decrease damage of abiotic stresses in Arabidopsis thaliana . PLoS ONE 8:e69810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Delauney AJ, Verma DPS (1993) Proline biosynthesis and osmoregulation in plants. Plant J 4:215–223. [Google Scholar]
- 38. Zhang H, Liu YX, Xu Y, Chapman S, Love AJ, et al. (2012) A newly isolated Na+/H+ antiporter gene, DmNHX1, confers salt tolerance when expressed transiently in Nicotiana benthamiana or stably in Arabidopsis thaliana . Plant Cell Tiss Organ Cult 110:189–200. [Google Scholar]
- 39. Hare PD, Cress WA (1997) Metabolic implications of stress-induced proline accumulation in plants. Plant Growth Regul 21:79–102. [Google Scholar]
- 40. De Ronde JA, Spreeth MH, Cress WA (2000) Effect of antisense L-Δ1-pyrroline-5-carboxylate reductase transgenic soybean plants subjected to osmotic and drought stress. Plant Growth Regul 32:13–26. [Google Scholar]
- 41. Verbruggen N, Hermans C (2008) Proline accumulation in plants: a review. Amino Acids 35:753–759. [DOI] [PubMed] [Google Scholar]
- 42. Deng XM, Hu W, Wei SY, Zhou SY, Zhang F, et al. (2013) TaCIPK29, a CBL-interacting protein kinase gene from wheat, confers salt stress tolerance in transgenic tobacco. PLoS ONE 8:e69881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Wang TZ, Zhang JL, Tian QY, Zhao MG, Zhang WH (2013) A Medicago truncatula EF-Hand family gene, MtCaMP1, is involved in drought and salt stress tolerance. PLoS ONE 8:e58952. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Parida AK, Das AB (2005) Salt tolerance and salinity effects on plants: a review. Ecotoxicol Environ Saf 60:324–349. [DOI] [PubMed] [Google Scholar]
- 45. Tuteja N (2007) Mechanisms of high salinity tolerance in plants. Methods Enzymol 428:419–438. [DOI] [PubMed] [Google Scholar]
- 46. Miller G, Shulaev V, Mittler R (2008) Reactive oxygen signaling and abiotic stress. Physiol Plantarum 133:481–489. [DOI] [PubMed] [Google Scholar]
- 47. Miller G, Suzuki N, Ciftci-Yilmaz S, Mittler R (2010) Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ 33:453–467. [DOI] [PubMed] [Google Scholar]
- 48. Takahashi S, Murata N (2008) How do environmental stresses accelerate photoinhibition? Trends in Plant Sci 13:178–182. [DOI] [PubMed] [Google Scholar]
- 49. Alia, Saradhi PP, Mohanty P (1997) Involvement of proline in protecting thylakoid membranes against free radical-induced photodamage. J Photochem Photobiol 38:253–257. [Google Scholar]
- 50. Alia, Saradhi PP, Mohanty P (1991) Proline enhances primary photochemical activities in isolated thylakoid membranes of Brassica juncea by arresting photoinhibitory damage. Biochem Biophs Res Commun 181:1238–1244. [DOI] [PubMed] [Google Scholar]
- 51. De Ronde JA, Cress WA, Krüger GHJ, Strasser RJ, Van Staden J (2004) Photosynthetic response of transgenic soybean plants, containing an Arabidopsis P5CR gene, during heat and drought stress. J Plant Physiol 161:1211–1224. [DOI] [PubMed] [Google Scholar]
- 52. Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol Biochem 48:909–930. [DOI] [PubMed] [Google Scholar]
- 53. Koca H, Ozdemir F, Turkan I (2006) Effect of salt stress on lipid peroxidation and superoxide dismutase and peroxidase activities of Lycopersicon esculentum and L. pennellii . Biol Plant 50:745–748. [Google Scholar]
- 54. Zhang H, Han B, Wang T, Chen S, Li H, et al. (2012) Mechanisms of plant salt response: insights from proteomics. J Proteome Res 11:49–67. [DOI] [PubMed] [Google Scholar]
- 55. Mishra MK, Chaturvedi PC, Singh R, Singh G, Sharma LK, et al. (2013) Overexpression of WsSGTL1 gene of Withania somnifera enhances salt tolerance, heat tolerance and cold acclimation ability in transgenic Arabidopsis plants. PLoS ONE 8:e63064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Yang L, Han HJ, Liu MM, Zuo ZJ, Zhou KQ, et al. (2013) Overexpression of the Arabidopsis photorespiratory pathway gene, serine: glyoxylate aminotransferase (AtAGT1), leads to salt stress tolerance in transgenic duckweed (Lemna minor). Plant Cell Tiss Organ Cult 113:407–416. [Google Scholar]
- 57. Smirnoff N, Cumbes QJ (1989) Hydroxyl radical scavenging activity of compatible solutes. Phytochemistry 28:1057–1060. [Google Scholar]
- 58. Alia, Mohanty P, Matysik J (2001) Effect of proline on the production of singlet oxygen. Amino Acids 21:195–200. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper.