Skip to main content
Veterinary Research Forum logoLink to Veterinary Research Forum
. 2013 Autumn;4(4):265–268.

No mutations of FecB and FecGH in Iranian Lory sheep

Zaynab Shafieiyan 1, Ghodratollah Mohammadi 1,*, Abbas Jolodarzadeh 1, Sara Amiri 1
PMCID: PMC4279613  PMID: 25568682

Abstract

The Booroola fecundity gene (FecB) and growth differentiation factor 9 (GDF9) gene belong to the transforming growth factor β (TGF-β) superfamily. The mutations of these genes have additive effects on the prolificacy in sheep. The aim of the present study was to determine the possible mutations of FecB and FecGH genes in Lory sheep breed of the Lorestan province, Iran. Sixty blood samples were collected and DNA was extracted from whole fresh blood. For detection of FecB and FecGH mutations, the PCR products were incubated with AvaII and DdeI restricted enzymes. Based on the results we did not find the FecB and FecGH mutations in this sheep breed population, so these mutations cannot the cause of the high prolificacy of Lory sheep breed and more study are needed to determine the genetic or environmental causes of high prolificacy of this sheep breed.

Key Words: FecB, FecGH, Lory sheep breed, PCR, RFLP

Introduction

Transforming growth factor β (TGF-β) superfamily is one of the widespread genes that have major effects on the reproduction.1 Booroola fecundity gene (FecB) and growth differentiation factor 9 (GDF9) belong to this superfamily.

The FecB locus is situated in the region of ovine chromosome 6 corresponding to the human chromosome 4q22-23,2 and contains the bone morphogenetic protein receptor 1B (BMPR1B) gene. The A to G transition at nucleotide position 746 of the cDNA sequence induces a no synonymous substitution of glutamine with an arginine corresponding to position 249 of the mature protein.3,4 Based on segregation of the ovulation rate in Merino and Romney flocks, the genotypes in the ewes have been classified as homozygous no carrier (FecB+/FecB+) with ovulation rate of 2 or less, heterozygous carriers (FecBB/FecB+) with ovulation rate of 3-4 and homozygous carriers (FecBB/FecBB) with more than 5 ovulations per estrous cycle. This increased ovulation rate of FecBB carriers is associated with a precocious maturation of a large number of antral follicles that ovulate at a smaller size than non-carrier follicles.5

The ovine GDF9 gene maps to chromosome 5 and contains 2 exons. Eight single nucleotide polymorphisms (SNPs) have been identified so far in sheep GDF9, labeled G1-G8. The G8 mutation, also indicated as FecGH (high fertility), causes increased ovulation rate in heterozygous ewes, while homozygous ewes are sterile.6,7

Carriers of FecB mutation are containing an AvaII restriction site (G/GACC) in the PCR products, whereas products from non-carriers lack this site. To detect the mutation, the 190 bp products were incubated with AvaII enzyme. Products containing the BMPRIB mutation were digested to yield a 160 bp fragment, whereas non-carriers products remained uncut at 190 bp.8

For detecting of the FecGH mutation based on the method described by Hanrahan et al., the 139 bp PCR products are incubated with DdeI enzyme. The wild type products could be cleaved by DdeI (C/TTAG) but the mutation type with GDF9 remained uncleaved.6

Lory sheep is one of the Iranian breeds in the Lorestan province in central of Iran. The population of this sheep in Lorestan province is more than 3 million sheep. Average live weight of the lamb is about 3.7 kg and the adult ranges between 55 to 60 kg with mean litter size of 1.4. However, this breed is the best known in the region for their meat and wool production.

The aim of the present study was to determine the mutations of FecB and FecGH genes in Lory sheep breeds of the Lorestan province.

Materials and Methods

Sixty blood samples were collected into a 5 mL EDTA contained vacuum tube and transferred to laboratory for DNA extraction within 2 hr. Total DNA extractions were made using modified salting out method from whole fresh blood. 9

The specific primers were purchased from TAG Copenhagen (Copenhagen, Denmark). The restriction endonucleases (RE) and other reagents were purchased from CinnaGen (Tehran, Iran). Based on previous studies, the specific primers were designed.6,10 The sequences of primers and RE are described in Table 1.

Table 1.

Primers and conditions used for PCR-RFLP

Gene Primer sequence (5́→3́) Annealing temperature ( ˚C) Restriction enzyme
FecB CCAGAGGACAATAGCAAAGCAAA
CAAGATGTTTTCATGCCTCATCAACAGGTC
60 AvaII
FecG H CTTTAGTCAGCTGAAGTGGGACAAC
ATGGATGATGTTCTGCACCATGGTGTGAACCTGA
62 DdeI

The amplification of the loci was carried out in a total volume of 25 μL reaction.11 The reaction contained the following constituents: 100 ng of DNA used as a template, 1X PCR Buffer, 0.2 mM of each dNTP, 0.5 μM of each primer, 1 IU Taq polymerase and 1.5 mM of MgCl2. PCR amplifications were performed in a thermal cycler (Bioer, Tokyo, Japan) by an initial denaturation of 5 min at 95 ˚C, followed by 35 cycles of 30 sec of denaturation at 94 ˚C, 30 sec of annealing based on table 1, 30 sec of extension at 72 ˚C and a final extension of 10 min at 72 ˚C. The amplified products were electrophoresed in 2% agarose gel and the DNA bands were visualized by ethidium bromide staining technique.

For detection of FecB and FecGH mutations, the PCR products were incubated with AvaII and DdeI overnight. For restriction fragment length polymorphism (RFLP) test; 10 µL of PCR product, 3µL 10X buffer, 1 IU RE and 15 µL double-distilled water mixed and incubated in water bath 37 ˚C overnight. After incubation, the digested products were analyzed by 3% agarose gel and ethidium bromide.

Results

Based on the results, the FecB and GDF9 genes were amplified in all samples. The electrophoresis of the PCR products showed the bands of 190 bp and 139 bp for FecB and GDF9 gene, respectively.

The electrophoresis of forced PCR-RFLP for detection of FecB and FecGH have been shown in Figures 1 and 2, respectively. All of the 50 individuals were wild homozygote for FecB and FecGH therefore none of the samples carried the mutation in FecB and FecGH genes.

Fig 1.

Fig 1

Agarose gel electrophoresis (2%) of allele specific BMPRIB PCR products digested by AvaII showing genotypes. Lane 1; 50 bp DNA marker, Lanes 2-9 represent different undigested products of samples from Lory sheep, lane 10 represents digested lambda DNA

Fig. 2.

Fig. 2

Agarose gel electrophoretogram for GDF9 mutation loci product digested by DdeI showing genotypes. Lane 1; 50 bp DNA marker. Lanes 2-10 represent different digested products of samples from Lory sheep

Discussion

The FecX, FecB and FecG genes have been found to be closely associated with prolificacy in sheep.1,12,13 It has been reported that the litter size and ovulation rate in sheep increase with number of mutations in FecB gene.1 Ewes inheriting one copy of the Booroola gene from either of parents produced about 1.5 extra eggs and gave birth to about 1.0 extra lamb per lambing. Homozygous carriers produced about 3.0 extra eggs resulting in about 1.5 extra lambs per lambing.1 This increase in ovulation rate of FecBB carriers is associated with a precocious maturation of a large number of antral follicles that ovulate at a smaller size than non-carrier follicles.5

The FecB mutations have been reported in some of the world's most prolific sheep breeds as Australian Booroola Merino,14 Indian Garole,10 Indonesian Javanese,10 Small-tailed Han and Hu sheep of China.15 The FecGH mutation was reported only in the Belclare and Cambridge sheep.6 In the present study, we utilized FecB and FecGH as candidates, but did not find these mutations in the Lory sheep breed.

The studies showed that maybe FecB and FecGH were not the only ones responsible for the high prolificacy.15,16 Several investigations show that the FecBB allele is absent in low prolific sheep breeds,17 but it is also absent in many prolific sheep, such as Olkuska, Thoka and Woodlands breeds.8

Other studies showed that no mutations of FecB and FecGH observed in some of the Iranian sheep breeds such as Lory-Bakhtiari, Arabic, Makui, Ghezel, Gharahgol, Iran Black, and Balochi. 18

It is recommended that other mutations of GDF9 and BMP15 genes need to be studied.6,8 For improvement of the Lory sheep and other Iranian flocks, introgression of big mutations such as FecB is recommended. Artificial insemination is one of the simple methods for introgression of the big mutations to the sheep flocks by importing sperm of mutation carriers such as Australian Booroola Merino, Indian Garole, Indonesian Javanese and Small-tailed Han Hu sheep of China.

References

  • 1.Fabre S, Pierre A, Mulsant P, et al. Regulation of ovulation rate in mammals: contribution of sheep genetic models. Reprod Biol Endocrinol. 2006;4(20):20–31. doi: 10.1186/1477-7827-4-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Montgomery GW, Crawford AM, Penty JM, et al. The ovine Booroola fecundity gene (FecB) is linked to markers from a region of human chromosome 4q. Nat Genet. 1993;4:410–414. doi: 10.1038/ng0893-410. [DOI] [PubMed] [Google Scholar]
  • 3.Wilson T, Wu XY, Juengel JL, et al. Highly prolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphogenetic protein IB receptor (ALK-6) that is expressed in both oocytes and granulosa cells. Biol Reprod. 2001;64(4):1225–1235. doi: 10.1095/biolreprod64.4.1225. [DOI] [PubMed] [Google Scholar]
  • 4.Mulsant P, Lecerf F, Fabre S, et al. Mutation in bone morphogenetic protein receptor-IB is associated with increased ovulation rate in Booroola Merino ewes. Proc Natl Acad Sci USA. 2001;98(9):5104–5109. doi: 10.1073/pnas.091577598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.McNatty KP, Lun S, Heath DA, et al. Differences in ovarian activity between Booroola Mérino ewes which were homozygous, heterozygous and non-carriers of a major gene influencing their ovulation rate. J Reprod Fert. 1986;77(1):193–205. doi: 10.1530/jrf.0.0770193. [DOI] [PubMed] [Google Scholar]
  • 6.Hanrahan JP, Gregan SM, Mulsant P, et al. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries) Biol Reprod. 2004;70(4):900–909. doi: 10.1095/biolreprod.103.023093. [DOI] [PubMed] [Google Scholar]
  • 7.McNatty KP, Galloway SM, Wilson T, et al. Physiological effects of major genes affecting ovulation rate in sheep. Genet Sel Evol. 2005;37(Suppl. 1):25–38. doi: 10.1186/1297-9686-37-S1-S25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hua GH, Chena SL, Ai JT, et al. None of polymorphism of ovine fecundity major genes FecB and FecX was tested in goat. Anim Reprod Sci. 2008;108(3):279–286. doi: 10.1016/j.anireprosci.2007.08.013. [DOI] [PubMed] [Google Scholar]
  • 9.Mohammadi G, Saberivand A. Modified method to extract DNA from mammalian whole blood for PCR-based methods. Iran Vet J. 2012;8(2):93–100. [Google Scholar]
  • 10.Davis GH, Galloway SM, Ross IK, et al. DNA tests in prolific sheep from eight countries provide new evidence on origin of the Booroola (FecB) mutation. Biol Reprod. 2002;66(6):1869–1874. doi: 10.1095/biolreprod66.6.1869. [DOI] [PubMed] [Google Scholar]
  • 11.Crawford AM, Dodds KG, Ede AJ, et al. An autosomal genetic linkage map of the sheep genome. Genetics. 1995;140(2):703–724. doi: 10.1093/genetics/140.2.703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Galloway SM, McNatty KP, Cambridge LM, et al. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat Genet. 2000;25:279–283. doi: 10.1038/77033. [DOI] [PubMed] [Google Scholar]
  • 13.Bodin L, San Cristobal M, Lecerf F, et al. Segregation of a major gene influencing ovulation in progeny of Lacaune meat sheep. Genet Sel Evol. 2002;34(4):447–464. doi: 10.1186/1297-9686-34-4-447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Souza CJ, MacDougall C, Campbell BK, et al. The Booroola (FecB) phenotype is associated with a mutation in the bone morphogenetic receptor type 1 B (BMPR1B) gene. J Endocrinol. 2001;169(Rapid communication):1–6. doi: 10.1677/joe.0.169r001. [DOI] [PubMed] [Google Scholar]
  • 15.Davis GH, Balakrishnan L, Ross IK, et al. Investigation of the Booroola (FecB) and Inverdale (FecXI) mutations in 21 prolific breeds and strains of sheep sampled in 13 countries. Anim Reprod Sci. 2006;92(1):87–96. doi: 10.1016/j.anireprosci.2005.06.001. [DOI] [PubMed] [Google Scholar]
  • 16.Guan F, Liu SR, Shi GQ, et al. Polymorphism of FecB gene in nine sheep breeds or strains and its effects on litter size, lamb growth and development. Anim Reprod Sci. 2007;99:44–52. doi: 10.1016/j.anireprosci.2006.04.048. [DOI] [PubMed] [Google Scholar]
  • 17.Hua GH, Yang LG. A review of research progress of FecB gene in Chinese breeds of sheep. Anim Reprod Sci. 2009;116(1):1–9. doi: 10.1016/j.anireprosci.2009.01.001. [DOI] [PubMed] [Google Scholar]
  • 18.Mohammadi G, Nasir Beygi MT, Alimahmoudi M, et al. Determination of polymorphism of FecB gene in Lory-Bakhteyarian and Arabian sheep of Khouzestan province by PCR-RFLP. Iran Vet J. 2009;5(3):54–59. [Google Scholar]

Articles from Veterinary Research Forum : an International Quarterly Journal are provided here courtesy of Faculty of Veterinary Medicine, Urmia University, Urmia, Iran

RESOURCES