Skip to main content
NCBI home page
Canadian Journal of Veterinary Research logoLink to Canadian Journal of Veterinary Research
. 2015 Jan;79(1):39–45.

Blocking the expression of syntaxin 4 interferes with initial phagocytosis of Brucella melitensis in macrophages

Alfredo Castañeda-Ramírez 1, Diana González-Rodríguez 1, J Aide Hernández-Pineda 1, Antonio Verdugo-Rodríguez 1,✉
PMCID: PMC4283232  PMID: 25673907

Abstract

Brucella melitensis is the Brucella species most frequently associated with brucellosis in humans. It is also the causative agent of the disease in goats and other ruminants. Although significant aspects of the pathogenesis of infection by this intracellular pathogen have been clarified, several events during invasion of host cells remain to be elucidated. In this study, infections of human macrophages from the THP-1 monocyte cell line were conducted with B. melitensis Bm133 wild-type strain and a strain of Salmonella serovar Enteritidis as a control. A multiplicity of infection of 100 was used in trials focused on defining the relative expression of syntaxin 4 (STX4), a soluble N-ethylmaleimide-sensitive factor attachment protein receptor, in the early events of phagocytosis (at 15, 30, 45, and 60 min). Immunoblot assays were also done to visualize expression of the protein in cells infected with either bacterial strain. The expression of STX4 was not significantly different in cells infected with B. melitensis strain Bm133 compared to that observed in cells infected with S. Enteritidis. When the expression of STX4 mRNA was inhibited with short or small interfering, or silencing, RNA in the THP-1 cells, the survival of B. melitensis was significantly reduced at time 0, when gentamicin treatment of cultures was begun (after 1 h of phagocytosis), and also at 2 h and 12 h after infection.

Introduction

Brucellosis is one of the most important zoonotic and infectious diseases distributed worldwide that is characterized by chronic infection in humans and animals. These infections are caused by multiple species of Brucella, although B. melitensis is the species most frequently associated with brucellosis in humans, and it is the causative agent of the disease in goats. More than 500 000 new cases per year are reported globally (1), predominantly in developing countries. A Gram-negative coccobacillus, B. melitensis produces infertility, abortion, fever, and septicemia in natural artiodactyl hosts (e.g., sheep, goats, and cattle) and undulant fever, debilitation, and disability in humans (2).

All species of the Brucella genus are facultative intracellular pathogens that possess the ability to survive and multiply in professional and nonprofessional phagocytic cells (3). These microorganisms do not have classic virulence factors such as exotoxins, capsules, fimbriae, pili, virulence plasmids, and proteases (4). Nevertheless, several mechanisms used by Brucella to invade and survive within host cells have been characterized. The main virulence factors described for Brucella are as follows (5–7): a lipopolysaccharide (LPS), an atypical molecule with reduced endotoxic biologic activity compared with enterobacterial LPS, which is a strong inducer of proinflammatory changes in the host; cyclic β-glucans, which are involved in invasion and intracellular establishment of the bacteria; and the type IV secretion system encoded by the virB operon, whose integrity is essential for intracellular replication of the organism. More recently, some factors that can be translocated to the cytoplasm of the host cell by the type IV secretion system have been identified (8,9); unfortunately, none of these have been associated with virulence, and the search in this field continues.

Despite the great advances in the investigation of mechanisms for intracellular replication and new findings of genetic elements in the bacteria (10), it has not yet been possible to fully clarify the mechanisms by which Brucella modifies the intracellular environment of macrophages to escape lysosomal destruction, establishing itself within favorable replication vacuoles (11). On the other hand, it has been found that Brucella and other intracellular pathogens are able to modify proteins to control intracellular traffic in their course of invasion and intracellular colonization (12). Proteins of the Rab family of guanosine triphosphatases (GTPases) and the Sar family of GTPases, as well as proteins of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) family, can be affected by intracellular microorganisms. For instance, Fratti, Chua, and Deretic (13), in experiments done with Mycobacterium tuberculosis var. bovis BCG, found that proteins of the vesicle (v)-SNARE type, such as cellubrevin, or vesicle-associated membrane protein 3 (VAMP3), are degraded, which affects phagosomal maturation. In the case of Legionella pneumophila, Shohdy et al (14) found that vacuole protein-sorting inhibitor proteins translocated by the Icm/Dot type IV secretion system possess a large coiled-coil region that can form complexes with SNARE proteins such as EEA1 and Uso1p, which also possess coiled-coil regions; hence, they speculated that L. pneumophila effectors may interact with similar host proteins via their coiled-coil regions, potentially interfering with their function. Delevoye et al (15) found that Chlamydia trachomatis is able to mimic the effect of VAMP3, promoting the recruitment of intracellular vesicles around inclusions in which the organism is established. Additionally, Murray et al (16) found that the secretion of tumor necrosis factor alpha is associated with phagocytosis of microorganisms, coupling endocytosis with exocytosis, crucial events in host defence. Whereas VAMP3 is present on the vesicles for secretion, syntaxin 4 (STX4) and synaptosomal protein 25 (SNAP25), a target (t)-SNARE, are associated with the cell membrane (16,17). Recognition and fusion events involving these proteins are fundamental for the 2-coupled processes to operate successfully (18). For example, a 4-helix bundle in which these 3 proteins participate has to be coupled to the transmembrane region to be fused (19,20). The number of SNARE complexes at the sites of membrane fusion influences the ability of PC12 cells to fuse secretory granules to plasma membrane; in addition, lipid components can interfere with coupling of the 4-helix bundle to the transmembrane region, thus abolishing membrane fusion (20). It is also known that phosphorylation and palmitoylation of SNARE proteins can regulate neurotransmitter release from synaptic vesicles of neurons (21). Therefore, it would be reasonable to assume that the complex formed by VAMP3, STX4, and SNAP25 can be influenced by the number of each protein in the plasma membrane or the vesicular membrane, as well as by acquisition of the necessary protein biochemical properties to perform a normal function (17,22). Hence, any interference with these characteristics may lead to disturbances in the endocytic pathways. In a study done in mouse macrophages, replication of B. abortus was inhibited by blocking the expression of Sar 1 GTPase, which is involved in the movement of vesicles from the endoplasmic reticulum to the Golgi apparatus (12). Recently, Castañeda et al (23), studying the role of VAMP3 in B. melitensis infection of murine macrophages, found that transient inhibition of the protein did not affect bacterial survival. Despite this, other SNARE proteins involved in vesicle sorting to nascent phagosomes could be modified for B. melitensis, mostly at early stages of phagocytosis with endocytosis–exocytosis events in which VAMP3, STX4, and SNAP25 participate. Veale, Offenhäuser, and Murray (24) recently found that STX4/SNAP23 proteins located at the plasma membrane are key regulators in focal exocytosis of recycling compartments at that site, both in macrophages and in other cell types, and that suppression of STX4 interferes with lamellipodia extension and plasma membrane tension in macrophage migration. Consequently, we hypothesized that alteration in the levels of VAMP3, STX4, or SNAP25 might influence the vesicular traffic associated with B. melitensis internalization, allowing the bacteria to evade phagosome–lysosome fusion and eventually locate themselves in vacuoles with endoplasmic reticulum characteristics, which these microorganisms require for replication (25).

Materials and methods

Bacterial strains

For infection assays, we used B. melitensis biotype 1 strain Bm133 (10) grown in DIFCO Brucella broth (Becton Dickinson, Lawrence, Kansas, USA) for 20 h at 37°C. Procedures with the bacteria were done in the class III biosafety unit of the Microbiology and Immunology Department, Faculty of Veterinary Medicine, National Autonomous University of Mexico. In addition, we used the American Type Culture Collection (ATCC) 49214 strain of Salmonella serovar Enteritidis, which was grown in Luria–Bertani (LB) broth and incubated at 37°C.

Cell culture and infection

Cells from the human monocyte THP-1 cell line (ATCC 9184) were incubated at 37°C in 5% CO2 and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (Life Technologies, Carlsbad, California, USA), 2 mM glutamine, 1 mM sodium pyruvate, 0.05 mM 2-mercaptoethanol, 0.45% glucose, 25 mM HEPES buffer, and a mixture of 100 IU of penicillin and 100 μg of streptomycin per milliliter (Gibco-Invitrogen, Carlsbad, California, USA). For infection, 3.5 × 106 cells per well were cultured in 24-well plates and subsequently differentiated into macrophage-like cells by incubation with 1α,25-dihydroxyvitamin D3 (vitamin D3; Sigma- Aldrich, St. Louis, Missouri, USA) for 72 h at a concentration of 10−7 M or phorbol myristate acetate (PMA), 160 nM (Sigma-Aldrich). Macrophages were infected with B. melitensis Bm133 or S. Enteritidis at a multiplicity of infection (MOI) of 100 on ice. The plates with the infected cells were centrifuged at 2000 × g for 10 min at 4°C to synchronize the infections and subsequently incubated at 37°C in 5% CO2 for 15, 30, 45, and 60 min. Three independent experiments were done.

RNA extraction

Total RNA was isolated by phenol extraction with TRIzol (Life Technologies) from the infected macrophages at each time after infection (15, 30, 45, and 60 min), with a method previously described (26).

Primer design

To design primers, we used mRNA sequences reported in GenBank (National Center for Biotechnology Information, Bethesda, Maryland, USA) for Homo sapiens genes encoding the proteins glyceraldehyde-3-phosphate dehydrogenase (G3PDH) (G3PDH M33197.1; forward, AAGGTCGGAGTCAACGGATTTGGT; reverse, AAGCTTCCCGTTCTCAGCCTTGA and STX4 (STX4 NM_004604.3; forward, GAACCTGCGCGATGAGATCAAACA; reverse, TCCCGG TATTCGGACTGCATTGAA). The former was used as the normalizer control.

Real-time quantitative polymerase chain reaction (qRT-PCR)

We used the SYBR Greener Two-Step qRT-PCR system (Life Technologies) according to the manufacturer’s instructions. The assays were done in the LightCycler kit 480 (Roche, Basel, Switzerland) and the results analyzed with use of the Pfaffl equation (27), indicating changes in the expression of the target genes. The PCR conditions were 1 cycle of 10 min at 90°C, followed by 40 cycles with denaturation at 95°C for 15 s, alignment at 60°C for 15 s, and extension at 72°C for 40 s, and, finally, 1 cycle at 95°C for 10 min and 1 cycle at 65°C for 2 min.

Extraction of membrane proteins

We used the method described by Corvera and Czech (28). Briefly, differentiated cells were grown in 24-well plates for infection. The medium was removed, and the cells were washed twice with cold phosphate-buffered saline (PBS). Lysis buffer (1% Triton X-100, 0.2% deoxycholate, and 0.1% sodium dodecyl sulfate) was added to the cells and the mixture incubated for 5 min at 4°C. The protein extract was then collected. Subsequently, the proteins were precipitated with 10% trichloroacetic acid and centrifuged at 12 000 × g for 10 min at 4°C. The supernatant was decanted and the pellet washed with cold absolute ethanol. Centrifugation was repeated at 13 000 × g for 10 min at 4°C and the ethanol carefully decanted. Finally, the pellet was suspended in 16 mM Tris, pH 8.3, and the extract stored at −80°C until used. Quantification of proteins was done by the Bradford method (29).

Polyacrylamide gel electrophoresis and immunoblotting

Gels of 12% acrylamide were prepared and proteins separated by electrophoresis and then transferred to a nitrocellulose membrane. For Western blotting, we used a murine monoclonal anti-STX4 antibody (Abcam, Cambridge, England) as the primary antibody and mouse peroxidase-conjugated anti-IgG (Sigma-Aldrich) as the secondary antibody. The same procedure was used with murine anti-human β-actin as the control primary antibody (Sigma-Aldrich) and mouse peroxidase-conjugated anti-IgG as the secondary antibody. We used 4-chloro-1-naphthol solution (Sigma-Aldrich) for development.

Inhibition of expression of STX4

For silencing the expression of STX4, THP-1 differentiated cells were transfected with the siRNA (short or short interfering, or silencing, RNA) Flexitube predesigned system for STX4 (Qiagen, Hilden, Germany), which contains 4 oligonucleotides, each 21 nucleotides long, targeting 4 sites in the STX4 mRNA; siRNA for G3PDH (PDSiRNA; Sigma-Aldrich) with the sequence 5′-CACAUGGCCUCCAAGGAGU-3′, was used as a positive control. Transfection was done with the HiPerfect Reagent (Qiagen).

Gentamicin protection (GP) assay

For this assay, previously described (30), SiRNA-treated cells cultured in 24-well plates were infected with B. melitensis Bm133 or S. Enteritidis at an MOI of 100 for 1 h and then treated with RPMI 1640 medium plus 100 μg/mL of gentamicin for 2 h. All extracellular bacteria were rapidly killed, whereas those within the cells were not. After 2 h the antibiotic concentration in the culture medium was changed to 10 mg/mL to assess survival of the bacteria, this time being considered time 0. Bacteria were collected 0, 2, 4, 8, 12, 24, and 36 h after infection. For counting colony-forming units (CFU), cells were lysed with 0.2% Triton X-100, diluted in cold PBS, plated in Brucella agar, and incubated for 72 h at 37°C. The same method was used for both B. melitensis and S. Enteritidis infection.

Statistical analysis

The results represented 3 independent experiments. The qRT-PCR results were analyzed by means of the Pfaffl equation. Statistical analysis was done with Student’s t-test and 2-way analysis of variance for normally distributed data and with the Mann–Whitney U-test for data without normal distribution. A P-value of ≤ 0.05 was considered to be significant. Graphs were generated with GraphPad Prism V 5.0 (GraphPad Software, San Diego, California, USA).

Results

Since it has been reported that the mitogen chosen for differentiation of human monocytes of the THP-1 cell line can influence the expression of proteins of the SNARE family (31,32), we first determined if differentiation with vitamin D3 or with PMA would affect STX4 expression. We observed that differentiation with PMA induced a significant increase in STX4 expression as determined by RT-PCR (Figure 1), whereas the changes induced by vitamin D3 differentiation were not significant. Consequently, we decided to differentiate THP-1 cells with vitamin D3 (THP-1-V3) in subsequent experiments. We then studied whether the expression of STX4 could be modified by infection of THP-1-V3 cells with B. melitensis or with S. Enteritidis. Salmonella Enteritidis is a facultative intracellular pathogen that induces a strong response of the infected cells since it has an LPS with proinflammatory properties, similar to other enterobacteria. Using RT-PCR and Western blotting, we observed that STX4 expression did not change significantly in the early stages of the phagocytosis of B. melitensis when determining the protein expression at 15, 30, 45, and 60 min after infection (Figures 2A and 3B). These findings were similar in cells infected with S. Enteritidis (Figures 2B and 3A). Hence, we questioned if B. melitensis infection of THP-1-V3 cells lacking STX4 affects bacterial survival. Again, infection with S. Enteritidis was used as a control. We found that the treatment of THP-1-V3 cells with siRNA strongly reduced the expression of STX4, by 82% at 20 h after treatment (Figure 4). Thus, infection was carried out at this point.

Figure 1.

Figure 1

Open in a new tab

Relative expression of syntaxin 4 (STX4) mRNA in human monocyte THP-1 cells differentiated into macrophage-like cells after incubation for 30, 60, or 120 min with phorbol myristate acetate (PMA, black bars) or 1α,25-dihydroxyvitamin D3 (vitamin D3, grey bars). The number 1 in the Y-axis represents expression in cells without mitogen treatment.

Figure 2.

Figure 2

Open in a new tab

Relative expression of STX4 mRNA in THP-1 cells differentiated with vitamin D3 (THP-1-V3 cells) 15, 30, 45, and 60 min after infection by Brucella melitensis or Salmonella serovar Enteritidis. The number 1 in the Y-axis represents expression in uninfected cells.

Figure 3.

Figure 3

Open in a new tab

Expression of STX4 protein extracts from THP-1-V3 cells 15, 30, 45, and 60 min after infection by (A) S. Enteritidis (SE) or (B) B. melitensis (BM), analyzed by Western blotting, and the corresponding values for uninfected cells. Panel C shows the values for protein extracts from cells infected with B. melitensis and revealed with anti-β-actin as a control primary antibody.

Figure 4.

Figure 4

Open in a new tab

A — Relative expression of STX4 mRNA in THP-1-V3 cells treated with short or small interfering, or silencing, RNA (siRNA) for STX4. ERU — expression relative units, as determined with the Pfaffl equation (27) from the results of real-time polymerase chain reaction. The maximum inhibition was 82%, at 20 h after treatment. B — Western blot of STX4 protein extracts from the cells 12, 16, 20, and 24 h after treatment with siRNA for STX4 (top panel) or control treatment with siRNA for glyceraldehyde-3- phosphate dehydrogenase (lower panel). MW — molecular weight.

The GP assay, used to evaluate the survival of B. melitensis, showed a significant reduction 1 h after infection, when gentamicin treatment was started, in the invasion by B. melitensis of THP-1-V3 cells lacking STX4 compared with cells not treated with siRNA as well as after another 2, 12, and 24 h (Figure 5). In the case of S. Enteritidis, significant differences were detected at 8, 12, and 24 h after infection of the THP-1-V3 cells treated with siRNA for STX4 (Figure 5).

Figure 5.

Figure 5

Open in a new tab

Survival of (A) B. melitensis and (B) S. Enteritidis in THP-1-V3 cells treated with siRNA for STX4 (black bars) or untreated (grey bars), as determined by the gentamicin protection assay. Time 0 represents the start of gentamicin treatment of cultures, after 1 h of phagocytosis. CFU — colony-forming units recovered. Asterisks indicate a significant difference (P ≤ 0.05).

Discussion

The findings reported here allow us to suggest that, to a certain extent, STX4 affects the invasion of THP-1 cells by B. melitensis in the first minutes after infection. In the early stages of phagocytosis, bacterial invasion is also modulated by the fusion of vesicles mediated by STX4/SNAP23/VAMP3 SNARE proteins that is required for expansion of the phagocytic cup during engulfment of a microbe (16,33). Therefore, it is reasonable to suppose that STX4 as well as the other SNARE proteins may be involved in the invasion of macrophages by intracellular pathogens. This phenomenon has been reported for cells infected by several intracellular bacteria that are capable of recruiting SNARE proteins or modulating their expression. These bacteria employ diverse virulence factors to modify these proteins in host cells and thus access the intracellular milieu and replicate inside permissive vacuoles in professional and nonprofessional phagocytes. This is the case for intracellular bacteria such as L. pneumophila and C. trachomatis (14,15).

Throughout phagocytosis, macrophages require membrane sources to form pseudopods and phagosomes in which organisms are engulfed (34,35). Focal exocytosis of recycling endosomes and vesicles originating in the endoplasmic reticulum constitute the main sources of the membrane requirements (33). These processes are regulated by interactions of the STX4/SNAP25/VAMP3 SNARE proteins in terms of numbers of complexes formed and protein biochemical properties (20,24). Data obtained in this work allow us to speculate that the reduction in the rate of phagocytosis of B. melitensis early in the GP assay was related to the lack of STX4 expression, which probably reduced the membrane remodeling necessary for engulfment of the microorganism. Additionally, modifications in the expression of STX4 in the course of infection of THP-1-V3 cells might indicate bacterial participation in the reduction of vesicular secretion, as previously proposed (36). Watarai et al (37) reported that the genesis of replicative vacuoles induces different morphologic changes when macrophages are infected by virB mutants of Brucella compared with infection by wild-type strains. They suggested that Brucella effectors directly or indirectly interact with lipid raft proteins, sites of high presence of STX4, after contact of the macrophage with the bacterium. The significant differences in bacterial counts after longer periods of infection (2 and 12 h) also suggest that B. melitensis may be affected by the absence of STX4. However, it is possible that some bacterial mechanisms allowed B. melitensis to prevail up to end of the experiment and even to replicate in siRNA-treated cells more than in untreated cells at 24 h, suggesting an apparent readaptation of bacteria within these cells. The tracking of cellular events at late stages of infection would be interesting.

Salmonella Enteritidis, which has an enterobacterial type of LPS and was used as a control, induced higher levels of STX4 and showed no difference in numbers of bacteria recovered in siRNA-treated cells compared with untreated cells at most of the time points analyzed. However, significant differences were registered at 8 and 12 h, possibly showing delayed difficulty in growth because of the absence of STX4 in cells treated with siRNA. A radical difference was observed at 24 h, with greater growth of bacteria in siRNA-treated cells than in untreated cells. That could be associated with technical issues more than with a bacterial mechanism. Additionally, different internalization processes in macrophages and singular mechanisms of intracellular persistence might be the cause of these differences and the overall lower numbers of bacteria recovered by 8 h. This implies macrophage cell death, because S. Enteritidis is capable of inducing apoptosis (38). However, an increasing recovery of bacteria was observed during the course of the experiment.

We have demonstrated that differentiation of THP-1 with vitamin D3 is optimal for studying STX4 and probably other SNARE proteins, given that no significant changes were observed in the STX4 levels when THP-1 cells were infected with B. melitensis or S. Enteritidis and that the numbers of B. melitensis organisms were reduced at 0, 2, and 12 h after infection in the siRNA-treated cells in the GP assay. However, we recognize the need to continue studying this process to confirm the participation of SNARE proteins during invasion of macrophages by B. melitensis.

Acknowledgments

This work was supported by grants PAPIIT IN-222907 and PAPIIT IN-212610 from Universidad Nacional Autónoma de México. The authors wish to acknowledge Dr. Daniel Martínez for his comments on this work, Dr. Raymundo Iturbe for his technical support, María Teresa Ramírez for her support in the translation of this paper, and Francisca Muñoz for her administrative support.

References

  • 1.Franco MP, Mulder M, Gilman RH, Smits HL. Human brucellosis. Lancet Infect Dis. 2007;7:775–86. doi: 10.1016/S1473-3099(07)70286-4. [DOI] [PubMed] [Google Scholar]
  • 2.Adams LG, Schutta CL. Natural resistance against brucellosis: A review. Open Vet Sci J. 2010;4:61–71. [Google Scholar]
  • 3.Furgier E, Pappas G, Gorvel JP. Virulence factors in brucellosis: Implications for aetiopathogenesis and treatment. Exp Rev Mol Med. 2007;3:1–10. doi: 10.1017/S1462399407000543. [DOI] [PubMed] [Google Scholar]
  • 4.Carvalho Neta AV, Mol JPS, Xavier MN, Paixão TA, Lage AP, Santos RL. Pathogenesis of bovine brucellosis. Vet J. 2010;184:146–155. doi: 10.1016/j.tvjl.2009.04.010. [DOI] [PubMed] [Google Scholar]
  • 5.Lapaque N, Moriyon I, Moreno E, Gorvel JP. Brucella lipopolysaccharide acts as a virulence factor. Curr Opin Microbiol. 2005;8:60–66. doi: 10.1016/j.mib.2004.12.003. [DOI] [PubMed] [Google Scholar]
  • 6.Arellano-Reynoso B, Lapaque N, Salcedo S, et al. Cyclic β-1–2 glucan is a Brucella virulence factor required for intracellular survival. Nature Immunol. 2005;6:618–625. doi: 10.1038/ni1202. [DOI] [PubMed] [Google Scholar]
  • 7.den Hartigh AB, Rolán HG, de Jong MF, Tsolis RM. VirB3 to VirB6 and VirB8 to VirB11, but not VirB7, are essential for mediating persistence of Brucella in the reticuloendothelial system. J Bacteriol. 2008;190:4427–4436. doi: 10.1128/JB.00406-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Marchesini MI, Herrmann CK, Salcedo SP, Gorvel JP, Comerci DJ. In search of Brucella abortus type IV secretion substrates: Screening and identification of four proteins translocated into host cells through VirB system. Cell Microbiol. 2011;13:1261–1274. doi: 10.1111/j.1462-5822.2011.01618.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.de Jong MF, Sun YH, den Hartigh AB, van Dijl JM, Tsolis RM. Identification of VceA and VceC, two members of the VjbR regulon that are translocated into macrophages by the Brucella type IV secretion system. Mol Microbiol. 2008;70:1378–1396. doi: 10.1111/j.1365-2958.2008.06487.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hernández-Castro R, Verdugo-Rodríguez A, Puente JL, Suárez-Güemes F. The BMEI0216 gene of Brucella melitensis is required for internalization in HeLa cells. Microb Pathog. 2008;44:28–33. doi: 10.1016/j.micpath.2007.08.008. [DOI] [PubMed] [Google Scholar]
  • 11.Christopher S, Umapathy BL, Ravikumar KL. Brucellosis: Review on the recent trends in pathogenicity and laboratory diagnosis. J Lab Physicians. 2010;2:55–60. doi: 10.4103/0974-2727.72149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Celli J, Salcedo SP, Gorvel JP. Brucella coopts the small GTPase Sar1 for intracellular replication. Proc Natl Acad Sci U S A. 2005;102:1673–1678. doi: 10.1073/pnas.0406873102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fratti RA, Chua J, Deretic V. Cellubrevin alterations and Mycobacterium tuberculosis phagosome maturation arrest. J Biol Chem. 2002;277:17320–17326. doi: 10.1074/jbc.M200335200. Epub 2002 Feb 1. [DOI] [PubMed] [Google Scholar]
  • 14.Shohdy N, Efe JA, Emr SD, Shuman HA. Pathogen effector protein screening in yeast identifies Legionella factors that interfere with membrane trafficking. Proc Natl Acad Sci U S A. 2005;102:4866–4871. doi: 10.1073/pnas.0501315102. Epub 2005 Mar 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Delevoye C, Nilges M, Dehoux P, et al. SNARE protein mimicry by an intracellular bacterium. PLoS Pathog. 2008;4:e1000022. doi: 10.1371/journal.ppat.1000022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Murray RZ, Kay JG, Sangermani DG, Stow JL. A role for the phagosome in cytokine secretion. Science. 2005;310:1492–1495. doi: 10.1126/science.1120225. Epub 2005 Nov 10. [DOI] [PubMed] [Google Scholar]
  • 17.Kay JG, Murray RZ, Pagan JK, Stow JL. Cytokine secretion via cholesterol-rich lipid raft-associated SNARES at the phagocytic cup. J Biol Chem. 2006;281:11949–11954. doi: 10.1074/jbc.M600857200. [DOI] [PubMed] [Google Scholar]
  • 18.D’Souza-Schorey C, Chavrier P. ARF proteins: Roles in membrane traffic and beyond. Nature Rev Mol Cell Biol. 2006;7:347–358. doi: 10.1038/nrm1910. [DOI] [PubMed] [Google Scholar]
  • 19.Malsam J, Kreye S, Söllner TH. Membrane fusión: SNAREs and regulation. Cell Mol Life Sci. 2008;65:2814–2832. doi: 10.1007/s00018-008-8352-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Veale KJ, Offenhäuser C, Lei N, Stanley AC, Stow JL, Murray RZ. VAMP3 regulates podosome organisation in macrophages and together with STX4/SNAP23 mediates adhesion, cell spreading and persistent migration. Exp Cell Res. 2011;317:1817–1829. doi: 10.1016/j.yexcr.2011.04.016. [DOI] [PubMed] [Google Scholar]
  • 21.Snyder DA, Kelly ML, Woodbury DJ. SNARE complex regulation by phosphorylation. Cell Biochem Biophys. 2006;45:111–123. doi: 10.1385/CBB:45:1:111. [DOI] [PubMed] [Google Scholar]
  • 22.Pagan JK, Wylie FG, Joseph S, et al. The t-SNARE syntaxin 4 is regulated during macrophage activation to function in membrane traffic and cytokine secretion. Curr Biol. 2003;13:156–160. doi: 10.1016/s0960-9822(03)00006-x. [DOI] [PubMed] [Google Scholar]
  • 23.Castañeda-Ramírez A, Puente JL, González-Noriega A, Verdugo Rodríguez A. Silencing of VAMP3 expression does not affect Brucella melitensis infection in mouse macrophages. Virulence. 2012;3:434–439. doi: 10.4161/viru.21251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Veale KJ, Offenhäuser C, Murray RZ. The role of the recycling endosome in regulating lamellipodia formation and macrophage migration. Commun Integr Biol. 2011;4:44–47. doi: 10.4161/cib.4.1.13569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Roop RM, II, Gaines JM, Anderson ES, Caswell CC, Martin DW. Survival of the fittest: How Brucella strains adapt to their intracellular niche in the host. Med Microbiol Immunol. 2009;198:221–238. doi: 10.1007/s00430-009-0123-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  • 27.Pfaffl M. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:2002–2007. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Corvera S, Czech M. Mechanism of insulin action on membrane protein recycling: A selective decrease in the phosphorylation state of insulin-like growth factor II receptors in the cell surface membrane. Proc Natl Acad Sci U S A. 1985;82:7314–7318. doi: 10.1073/pnas.82.21.7314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Stoscheck CM. Quantitation of protein. Methods Enzymol. 1990;182:50–68. doi: 10.1016/0076-6879(90)82008-p. [DOI] [PubMed] [Google Scholar]
  • 30.Pizarro-Cerdá J, Moreno E, Sanguedolce V, Mége JL, Gorvel JP. Virulent Brucella abortus prevents lysosome fusion and is distributed within autophagosome-like compartments. Infect Immun. 1998;66:2387–2392. doi: 10.1128/iai.66.5.2387-2392.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schwende H, Fitzke E, Ambs P, Dieter P. Differences in the state of differentiation of THP-1 cells induced by phorbol ester and 1,25-dihydroxyvitam D3. J Leukoc Biol. 1996;59:555–561. [PubMed] [Google Scholar]
  • 32.Daigneault M, Preston JA, Marriott HM, Whyte MK, Dockrell DH. The identification of markers of macrophage differentiation in PMA-stimulated THP-1 cells and monocyte-derived macrophages. PLoS One. 2010;5:e8668. doi: 10.1371/journal.pone.0008668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Allen LA, Yang C, Pessin JE. Rate and extent of phagocytosis in macrophages lacking vamp3. J Leukoc Biol. 2002;149:697–705. [PMC free article] [PubMed] [Google Scholar]
  • 34.Gagnon E, Duclos S, Rondeau C, et al. Endoplasmic reticulum-mediated phagocytosis is a mechanism of entry into macrophages. Cell. 2002;110:119–131. doi: 10.1016/s0092-8674(02)00797-3. [DOI] [PubMed] [Google Scholar]
  • 35.Touret N, Paroutis P, Terebiznik M, et al. Quantitative and dynamic assessment of the contribution of the ER to phagosome formation. Cell. 2005;123:157–170. doi: 10.1016/j.cell.2005.08.018. [DOI] [PubMed] [Google Scholar]
  • 36.Jubier-Maurin V, Boigegrain RA, Cloeckaert A, et al. Major outer membrane protein Omp25 of Brucella suis is involved in inhibition of tumor necrosis factor alpha production during infection of human macrophages. Infect Immun. 2001;69:4823–4830. doi: 10.1128/IAI.69.8.4823-4830.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Watarai M, Makino S, Fujii Y, Okamoto K, Shirahata T. Modulation of Brucella-induced macropinocytosis by lipid rafts mediates intracellular replication. Cell Microbiol. 2002;4:341–355. doi: 10.1046/j.1462-5822.2002.00195.x. [DOI] [PubMed] [Google Scholar]
  • 38.Hu M, Yang Y, Meng C, Pan Z, Jiao X. Responses of macrophages against Salmonella infection compared with phagocytosis. In Vitro Cell Dev Biol Animal. 2013;49:778–784. doi: 10.1007/s11626-013-9672-7. Epub 2013 Aug 16. [DOI] [PubMed] [Google Scholar]

Articles from Canadian Journal of Veterinary Research are provided here courtesy of Canadian Veterinary Medical Association

RESOURCES