Skip to main content
Nature Portfolio logoLink to Nature Portfolio
letter
. 2014 Sep 26;29(1):237–241. doi: 10.1038/leu.2014.261

Targeted mutational profiling of peripheral T-cell lymphoma not otherwise specified highlights new mechanisms in a heterogeneous pathogenesis

J H Schatz 1,2,3,*, S M Horwitz 4,*, J Teruya-Feldstein 5, M A Lunning 4, A Viale 6, K Huberman 6, N D Socci 7, N Lailler 6, A Heguy 8, I Dolgalev 8, J C Migliacci 4, M Pirun 7, M L Palomba 4, D M Weinstock 9, H-G Wendel 10
PMCID: PMC4286477  NIHMSID: NIHMS623246  PMID: 25257991

Peripheral T-cell lymphoma not otherwise specified (PTCL-NOS) is a diagnosis of exclusion making up the largest fraction (25–30%) of PTCL. Although traditionally considered a ‘wastebasket’ diagnosis, recent gene-expression results suggest the disease comprises two biologic sub-entities characterized by expression of the transcription factors GATA3 or TBX21 and their target genes.1 The mutational landscape of PTCL-NOS remains largely undefined.

We sought a better understanding the disease using a targeted deep-sequencing approach to identify pathogenic mechanisms and potential therapeutic targets that might fuel further studies. There is a substantial need for new therapies for PTCL-NOS, which leads to the death of more than two-thirds of patients within 5 years of diagnosis.2 The median age of onset for PTCL-NOS is 60, two-thirds of patients are male, and 69% have advanced-stage at diagnosis. Front line treatment remains CHOP (cyclophosphamide, doxorubicin, vincristine and prednisone) or other CHOP-based combinations optimized for use in B-cell lymphomas. Efforts to address the substantial unmet clinical need of PTCL-NOS patients are hampered by poor understanding of its biology, thwarting the development of specific therapies.

We collected 61 formalin-fixed paraffin embedded (FFPE) tumor samples from patients seen at Memorial Sloan-Kettering Cancer Center (MSKCC) with original diagnosis of PTCL-NOS, anaplastic large-cell lymphoma (ALCL) or angioimmunoblastic T-cell lymphoma (AITL). After re-review (JTF) of pathology and clinical factors, 31 cases met criteria for inclusion in this study of PTCL-NOS, lacking features indicative of other PTCL types. Pathologic details including morphology and immunophenotype are provided in Supplementary Table 1. In particular, we excluded cases with features of AITL because several studies have illuminated its mutational landscape,3, 4, 5, 6, 7 while our interest was in PTCL-NOS, for which few disease-specific recurrent mutational targets have been reported. We chose 237 genes for deep sequencing that have been reported as recurrent mutational targets in other hematologic cancers (Supplementary Table 2).

Analyzed tumor samples came from patients who consented to institutional tissue banking and analysis protocols, approved by the MSKCC Institutional Review Board and in compliance with the Declaration of Helsinki. Specific authorization for use and collection of de-identified clinical data came from the Human Biospecimen Use Committee. We isolated DNA from FFPE scrolls using the Formapure kit from Beckman Coulter Genomics in a semi-automated fashion on a Biomek NX liquid Handler. Illumina-compatible libraries were prepared from ~250 ng of sheared DNA (~150 bp in size) on a Biomek SPRI-Works HT robot using the Kapa Biosystems High Throughput library preparation kit with SPRI solution (magnetic beads) and amplified using the Kapa Standard PCR Library Amplification/Illumina series. During library preparation, adapters with barcodes were added to the DNA fragments for sample identification. All exons of the 237 genes were captured using the Nimblegen system (Roche SeqCap EZ Custom bait hybridization probes). The samples were then pooled and run on an Illumina HiSeq sequencer.

Reads were aligned to the hg19 build of the human genome using BWA 0.6.2-r126 followed by duplicate removal using Picard-Tools-1.55. The Genome Analysis Toolkit (GATK-2.6–3-gdee51c4) was used to perform local realignment around known indels and base quality score recalibration. Variant detection was performed using the GATK Unified Genotyper. Quality settings in the GATK HaplotypeCaller resulted in the elimination of candidate variants at very low allele frequency, which while improving the overall confidence of reported mutations likely also excluded some tumor-specific sub-clonal variants. Variants were annotated with the SNPeff annotation program to identify protein-coding changes and cross-referenced against the dbSNP132, 1000 Genomes and Catalog of Somatic Mutations in Cancer (COSMIC) databases. We eliminated variants listed in dbSNP132 or 1000 genomes and reviewed all remaining variants manually in IGV 2.3 browser, resulting in the elimination of additional mutation calls based on sequencing quality, allele frequency (if similar to known single-nucleotide polymorphisms (SNPs) in the same sample) and by searching the internet to identify additional SNPs. Mean sequencing depth was 232X (range 6–701). Cases with mean sequencing depth <100X (7 of 31) were included only if mutations were confirmed by targeting validation sequencing (see below), resulting in inclusion of four and exclusion of three such cases. This left 28 total cases for which we report mutations. Targeted validation sequencing of all mutations was performed with Illumina miSeq after re-amplification of DNA from the FFPE tumor samples, again using the Nimblegen capture system.

Of 28 patients, 25 with available demographic data were an average age of 52 years at diagnosis (range 9–76), with 11/25 age⩾60 and 13/25 male. Treatment and survival data were available for 23 patients followed long term at MSKCC. The majority of these (16) received CHOP or CHOP-like chemotherapy (Supplementary Figure 1A), whereas three received more intensive chemotherapy. Median event-free survival was 11.5 months, whereas median overall survival (OS) was 40.2 months (Supplementary Figure 1B). Subjects showed somewhat lower average age and less male predominance than is typical.2 There was no OS difference between cases with nodal or extranodal presentation (Supplementary Figure 1C). Twenty-four of 28 samples were pretreatment and 4 were relapsed.

Table 1 shows 89 protein-coding mutations found in the 28 cases, affecting 59 genes, including 74 single-nucleotide variants and 15 indels. There was a mean of 3.0 mutations per case (range 0–11). There was no significant difference between the mutational load in the four relapsed samples and others (P=0.283), but we can’t exclude the possibility some mutations detected in these four samples were not present at diagnosis. Lack of germ-line DNA to confirm the somatic nature of mutations introduces the possibility that some mutations in Table 1 are SNPs that are not reported in dbSNP132 or detected in the 1000 genomes project. We therefore limited further analysis to genes either recurrently mutated or containing mutations previously shown to be tumor specific in other studies. Figure 1 shows breakdown of genes affected by such mutations by functional category and whether cases had a nodal or extranodal presentation.

Table 1. Protein-affecting variants by gene and case.

Gene Case CHR POS REF ALT Mutant Allele Fraction Type Effect Previous Report
ALMS1 T06 chr2 73 676 742 T A 0.39444 Missense p.S1029T None
ALPK2 T46 chr18 56 203 629 C T 0.35000 Missense p.G1264S None
APC 99–31720 chr5 112 164 629 G A 0.50131 Missense p.S568N COSMIC
APC T52 chr5 112 176 308 G A 0.42678 Missense p.E1673K COSMIC
ARID1B T11 chr6 157 099 420 G GCAGCAA 0.33333 Codon insertion p.119_120insQQ None
ARID1B T33 chr6 157 431 662 G A 0.42798 Missense p.A709T None
ARID1B T56 chr6 157 528 066 CTG C 0.44118 Frameshift p.C1932fs None
ARID2 99–31720 chr12 46 125 011 GA G 0.28737 Frameshift p.N67fs COSMIC
ATM T37 chr11 108 160 480 T G 0.44118 Missense p.F1463C COSMIC
BCL6 T34 chr3 187 447 027 T C 0.41648 Missense p.N389S None
BCL9 T55 chr1 147 095 762 C T 0.41615 Missense p.P1095S None
BCORL1 T11 chrX 129 150 080 C T 0.53977 Missense p.T1111M COSMIC
BCORL1 T46 chrX 129 147 806 C T 0.47740 Missense p.P353L None
BRCA2 T39 chr13 32 906 921 A G 0.40000 Missense p.K436E None
BRD4 T37 chr19 15 376 223 G A 0.44444 Missense p.A264V None
BRIP1 T81 chr17 59 885 858 C G 0.42308 Missense p.E296D None
CD58 T39 chr1 117 061 887 T C 0.85185 Missense p.I237V None
CDH23 T34 chr10 73 501 454 G A 0.40785 Missense p.V1541M None
CHD8 T46 chr14 21 894 360 G T 0.46903 Missense p.T269N None
CHD8 T55 chr14 21 859 651 C T 0.48592 Missense p.E2067K None
CIITA T55 chr16 11 004 047 C T 0.44654 Missense p.T940M None
CIITA T56 chr16 11 000 940 G A 0.43501 Missense p.G531S None
CMYA5 T33 chr5 79 034 658 G C 0.36957 Missense p.S3357T None
COL6A3 T39 chr2 238 296 329 G A 0.42345 Missense p.P403L COSMIC
COL6A3 T55 chr2 238 277 596 G A 0.38728 Missense p.R1504W COSMIC
CREBBP T33 chr16 3 824 628 C G 0.40741 Missense p.R704P None
CREBBP T52 chr16 3 778 708 C T 0.42241 Missense p.G2076S None
CUL9 T34 chr6 43 154 017 C G 0.51064 Missense p.Q359E Ref. 15
DDX3X T46 chrX 41 204 494 A T 0.48918 Nonsense p.R363* None
DNMT3A T09 chr2 25 463 248 G A 0.30313 Missense p.R749C COSMIC
DNMT3A T26 chr2 25 467 432 CAT C 0.19303 Frameshift p.M548fs None
FBXW7 T39 chr4 153 332 910 C CAGG 0.42920 Codon insertion p.15_16insP COSMIC
FBXW7 T81 chr4 153 268 155 TG T 0.17647 Frameshift p.Q100fs COSMIC
FOXO1 99–31720 chr13 41 240 039 C G 0.31250 Missense p.G104A None
FOXO1 T46 chr13 41 240 273 G A 0.25547 Missense p.P26L None
FYB T59 chr5 39 202 971 C A 0.37037 Missense p.G31V None
IDH2 T06 chr15 90 645 600 A G 0.41176 Missense p.V8A None
IL7R T39 chr5 35 876 541 C T 0.45918 Nonsense p.Q445* None
IRF4 T39 chr6 394 888 C G 0.37700 Missense p.T95R None
IRF8 T39 chr16 85 936 739 T A 0.38928 Missense p.W40R None
JAK3 T52 chr19 17 937 710 G A 0.44845 Missense p.L1073F None
KDM4C T46 chr9 7 046 915 T A 0.30758 Missense p.N771K None
KDM6A 99–31720 chrX 44 941 837 G GT 0.54369 Frameshift p.R1054fs None
KDM6A T46 chrX 44 733 220 C T 0.42655 Missense p.A71V None
KDM6A T56 chrX 44 913 193 C CT 0.41379 Frameshift p.G291fs None
KIAA1618 T52 chr17 78 264 463 AGAG A 0.42010 Codon deletion p.G404del None
LRRK1 T34 chr15 101 514 110 C T 0.36364 Missense p.R67C None
LRRK1 T34 chr15 101 549 251 C G 0.34553 Missense p.D324E None
LRRK1 T59 chr15 101 567 909 G A 0.41379 Missense p.D865N None
MLL T33 chr11 118 366 578 C T 0.32051 Missense p.P1840S None
MLL T46 chr11 118 373 835 A G 0.43956 Missense p.M2407V None
MLL2 99–31720 chr12 49 434 709 G A 0.51190 Missense p.R2282W None
MLL2 T08 chr12 49 445 392 G T 0.51471 Missense p.P692T Ref. 8
MLL2 T73 chr12 49 433 883 G A 0.44056 Missense p.P2557L None
MLL2 T81 chr12 49 448 530 C G 0.32143 Missense p.G61R None
MPDZ T39 chr9 13 192 237 C A 0.67901 Nonsense p.E621* None
NF1 T69 chr17 29 553 477 A AC 0.30303 Frameshift p.P678fs COSMIC
PASD1 T34 chrX 150 844 560 C T 0.39912 Missense p.A756V None
PASK T06 chr2 242 080 117 C T 0.41535 Missense p.C83Y None
PCLO T04 chr7 82 763 889 T A 0.31897 Missense p.S993C None
PCLO T39 chr7 82 546 098 C T 0.41736 Missense p.G3735E None
PCLO T39 chr7 82 583 972 G T 0.40136 Missense p.D2099E None
PCLO T46 chr7 82 595 148 T G 0.25290 Missense p.E1319A None
PHLPP T04 chr18 60 645 819 G A 0.47619 Missense p.G925S None
PLCG2 T55 chr16 81 902 872 G A 0.48000 Missense p.S178N None
RELN T37 chr7 103 136 199 T C 0.48413 Missense p.I3114V None
SAMD9 T55 chr7 92 731 734 C A 0.38095 Missense p.R1226I None
SETBP1 T38 chr18 42 456 670 C CTCTT 0.19608 Frameshift p.T228fs None
SETBP1 T56 chr18 42 456 691 A C 0.25641 Missense p.E234D None
SMARCA2 T73 chr9 2 039 844 A T 0.41176 Missense p.Q245L None
STAT5B T81 chr17 40 375 521 C G 0.38710 Missense p.Q143H None
TET1 T34 chr10 70 333 197 G C 0.42177 Missense p.A368P None
TET1 T58 chr10 70 426 857 C T 0.38255 Missense p.T1506I None
TET2 T31 chr4 106 193 809 CT C 0.36364 Frameshift p.S1424fs COSMIC
TET2 T65 chr4 106 157 694 GCAATATTT G 0.30000 Frameshift p.Q866fs COSMIC
TET2 T69 chr4 106 164 733 C T 0.28571 Missense p.R1201C None
TNFAIP3 T02 chr6 138 195 991 A G 0.39706 Missense p.N102S COSMIC
TNFAIP3 T37 chr6 138 201 240 A C 0.48916 Missense p.T647P COSMIC
TNFAIP3 T73 chr6 138 201 240 A C 0.37647 Missense p.T647P COSMIC
TNFRSF14 T61 chr1 2 488 104 A G 0.16413 Missense; Start codon p.M1V COSMIC
TP53 T04 chr17 7 579 492 TCTGGGAGCTTCATCTGGAC T 0.31169 Frameshift p.G59fs COSMIC
TP53 T56 chr17 7 578 190 T C 0.86620 Missense p.Y220C COSMIC
TRAF3 T73 chr14 103 363 658 C T 0.52830 Nonsense p.Q294* COSMIC
ULK4 T81 chr3 41 860 984 C CT 0.21053 Frameshift p.N594fs None
ZAP70 T38 chr2 98 351 166 G C 0.21287 Missense p.R358P None
ZAP70 T39 chr2 98 354 531 C T 0.36923 Missense p.P566L None
ZFHX3 T34 chr16 72 831 834 C A 0.37500 Missense p.G1583C None
ZMYM3 T38 chrX 70 469 934 G C 0.33333 Missense p.P398R None
ZNF608 T46 chr5 123 985 372 A G 0.39334 Missense p.V394A None

Figure 1.

Figure 1

Distribution of mutations in 28 diagnostic peripheral T-cell lymphoma not otherwise specified (PTCL-NOS) cases. Included are all genes affected in multiple cases, or those affected in single cases with mutations listed in COSMIC or other reports as indicated in Table 1. Nodal: original presentation as nodal disease (black boxes) vs original extranodal presentation (white boxes).

As seen in other hematologic cancers, epigenetic regulation is the most mutated category overall. Regulators of histone methylation were mutated in 25% of cases, including MLL28 (4/28 cases), KDM6A (3/28) and MLL (2/28). Regulators of DNA methylation also were affected in 25% of cases. TET2 showed previously reported frameshifts in two cases and a missense mutation in a third, whereas DNMT3A had a frameshift in one case and a previously reported missense mutation in a second. The significance of two previously unreported TET1 missense mutations is less clear. There was no overlap between cases with histone methylation and DNA methylation alterations (Supplementary Figure 2A). Chromatin remodeling mediated by SWI/SNF complex activity is affected in 18%, specifically, ARID1B (3/28 cases), ARID2 (1/28) and SMARCA2 (1/28). These frequencies are similar to a recent meta-analysis of 44 cancer-sequencing studies.9 Overall, epigenetic regulators emerge as recurrent targets of somatic mutations in PTCL-NOS.

Activation of T-cell receptor (TCR) signaling is a known pathogenic mechanism in PTCL-NOS containing t(5;9)(q33;q22), found in <10 percent of cases.10 The resulting ITK-SYK fusion kinase localizes to lipid-rafts and mimics constitutive TCR activation.11 Our data highlight additional mechanisms activating TCR and downstream signaling. TNFAIP3, encoding the A20-negative regulator of NF-kB activation, had missense mutations in 11% (3/28) of cases, all of which are reported in the COSMIC. A20 is known to be a key regulator of NF-kB activation in T cells after TCR stimulation.12 WNT/β-Catenin negative regulators APC and CHD8 were affected in two cases each, or 14% (4/28) overall. Three additional genes with known suppressive roles in TCR activation had mutations previously reported in COSMIC: NF1 (frameshift), TNFRSF14 (missense affecting the start codon) and TRAF3 (nonsense). Overall, 46% (13/28) had at least one mutation in TCR or downstream mediators, expanding the role for these processes in PTCL-NOS pathogenesis.

The TP53 tumor suppressor gene had loss-of-function alterations in two cases, consistent with prior reports showing it is not mutated at a high rate in PTCL.13,14 Additional affected suppressors include the ATM DNA-repair kinase (one case) and the transcription factors FOXO1 and BCORL1 (two cases each).

Examination of survival effects (Supplementary Figure 2B) showed cases with alterations in histone methylation (MLL2, KDM6A, or MLL; P=0.0198) had worse OS than unaffected cases, whereas there was no such effect for either DNA methylation (TET2, DNMT3A, or TET1; P=0.2694) or signaling (TNFAIP3, APC, CHD8, ZAP70, NF1, TNFRSF14, or TRAF3; P=0.6695). We also examined differences in mutational patterns between cases with nodal or extranodal presentation (Supplementary Table 3). Although there was no significant difference in the above categories, interestingly all four cases affected by WNT/β-Catenin alterations were in the extranodal category (P=0.003).

Our study sheds new light on pathogenesis of a poorly understood clinical entity in need of better therapeutic options and for which poor sample availability has limited interrogation of the mutational landscape to date. Although some findings are confirmatory, others highlight novel disease mechanisms or better define frequency or prognostic implications. In particular, histone methylation alterations were present in a quarter of cases and associated with a worse OS. We believe studies in additional case series are warranted for elaboration of this result. Frequent mutations in regulators of TCR signaling meanwhile highlight mechanisms of activation, further extending the importance of this pathway beyond cases containing the previously identified ITK-SYK fusion kinase. The clustering of all mutations affecting WNT/β-Catenin mediators APC or CHD8 in cases with an extranodal presentation represented a significant difference that should be explored in additional cases and could shed new light on extranodal PTCL-NOS. Therapeutic opportunities from some results are limited. Loss of function of A20, for example, does not easily lend itself to targeted treatment, as NF-kB Inducing Kinase inhibitors have not made their way to clinical evaluation. Low frequency of TP53 mutations, however, highlights a potential for MDM2 inhibition in PTCL-NOS. In sum, we identify promising candidates for evaluation in additional cases and functional studies and to aid the development of better model systems for one of the least well understood hematologic malignancies.

Acknowledgments

This research was supported by Cycle for Survival (JS and all MSKCC authors), the Gabrielle’s Angel Foundation (JS), the Lymphoma Research Foundation (JS), NCI R01-CA142798-01 (HGW), the Leukemia Research Foundation (HGW), the Experimental Therapeutics Center at MSKCC (HGW), the American Cancer Society 10284 (HGW), the Geoffrey Beene Cancer Center (HGW), an American Cancer Society Research Scholar Grant (DW) and Nonna’s Garden Fund (SH).

Author Contributions

JS designed the research and wrote the manuscript. HGW, SH and DW designed the research and edited the manuscript. ML, AV, AH and KH designed the research. JT-F designed the research and reviewed the pathology of included cases. NL, ID, NS and MP performed bioinformatic analyses. JM collected and helped analyze clinical data.15

Footnotes

Supplementary Information accompanies this paper on the Leukemia website (http://www.nature.com/leu)

The authors declare no conflict of interest.

Supplementary Material

Supplementary Table 1
Supplementary Table 2
Supplementary Table 3
Supplementary Figure 1
Supplementary Figure 2
Supplementary Figure Legends

References

  1. Iqbal J, Wright G, Wang C, Rosenwald A, Gascoyne RD, Weisenburger DD et al. Gene expression signatures delineate biologic and prognostic subgroups in peripheral T-cell lymphoma. Blood 2014; 123: 2915–2923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Vose J, Armitage J, Weisenburger D. International T-Cell Lymphoma Project. International peripheral T-cell and natural killer/T-cell lymphoma study: pathology findings and clinical outcomes. J Clin Oncol 2008; 26: 4124–4130. [DOI] [PubMed] [Google Scholar]
  3. Cairns RA, Iqbal J, Lemonnier F, Kucuk C, de Leval L, Jais JP et al. IDH2 mutations are frequent in angioimmunoblastic T-cell lymphoma. Blood 2012; 119: 1901–1903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Palomero T, Couronné L, Khiabanian H, Kim M-Y, Ambesi-Impiombato A, Perez-Garcia A et al. Recurrent mutations in epigenetic regulators, RHOA and FYN kinase in peripheral T cell lymphomas. Nat Genet 2014; 46: 166–170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Sakata-Yanagimoto M, Enami T, Yoshida K, Shiraishi Y, Ishii R, Miyake Y et al. Somatic RHOA mutation in angioimmunoblastic T cell lymphoma. Nat Genet 2014; 46: 171–175. [DOI] [PubMed] [Google Scholar]
  6. Lemonnier F, Couronne L, Parrens M, Jais JP, Travert M, Lamant L et al. Recurrent TET2 mutations in peripheral T-cell lymphomas correlate with TFH-like features and adverse clinical parameters. Blood 2012; 120: 1466–1469. [DOI] [PubMed] [Google Scholar]
  7. Odejide O, Weigert O, Lane AA, Toscano D, Lunning MA, Kopp N et al. A targeted mutational landscape of angioimmunoblastic T cell lymphoma. Blood 2013; 123: 1293–1296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Rossi D, Pasqualucci L, Trifonov V, Fangazio M, Bruscaggin A, Rasi S et al. The coding genome of splenic marginal zone lymphoma: activation of NOTCH2 and other pathways regulating marginal zone development. J Exp Med 2012; 209: 1537–1551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kadoch C, Hargreaves DC, Hodges C, Elias L, Ho L, Ranish J et al. Proteomic and bioinformatic analysis of mammalian SWI/SNF complexes identifies extensive roles in human malignancy. Nat Genet 2013; 45: 592–601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Streubel B, Vinatzer U, Willheim M, Raderer M, Chott A. Novel t(5;9)(q33;q22) fuses ITK to SYK in unspecified peripheral T-cell lymphoma. Leukemia 2005; 20: 313–318. [DOI] [PubMed] [Google Scholar]
  11. Pechloff K, Holch J, Ferch U, Schweneker M, Brunner K, Kremer M et al. The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med 2010; 207: 1031–1044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lee EG, Boone DL, Chai S, Libby SL, Chien M. Failure to regulate TNF-induced NF-κB and cell death responses in A20-deficient mice. Science 2000; 289: 2350–2354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Matsushima AY, Cesarman E, Chadburn A, Knowles DM. Post-thymic T cell lymphomas frequently overexpress p53 protein but infrequently exhibit p53 gene mutations. Am J Pathol 1994; 144: 573–584. [PMC free article] [PubMed] [Google Scholar]
  14. Petit B, Leroy K, Kanavaros P, Boulland ML, Druet-Cabanac M, Haioun C et al. Expression of p53 protein in T- and natural killer-cell lymphomas is associated with some clinicopathologic entities but rarely related to p53 mutations. Hum Pathol 2001; 32: 196–204. [DOI] [PubMed] [Google Scholar]
  15. Chang H, Jackson DG, Kayne PS, Ross-Macdonald PB, Ryseck R-P, Siemers NO. Exome sequencing reveals comprehensive genomic alterations across eight cancer cell lines. PLoS One 2011; 6: e21097. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table 1
Supplementary Table 2
Supplementary Table 3
Supplementary Figure 1
Supplementary Figure 2
Supplementary Figure Legends

Articles from Leukemia are provided here courtesy of Nature Publishing Group

RESOURCES