Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 1.
Published in final edited form as: Reproduction. 2014 Nov 10;149(2):203–212. doi: 10.1530/REP-14-0445

Requirement of the transcription factor USF1 in bovine oocyte and early embryonic development

Tirtha K Datta A,B,D,#, Sandeep K Rajput A,B,#, Gabbine Wee A,B, KyungBon Lee A,B,E, Joseph K Folger A,B, George W Smith A,B,C,✉
PMCID: PMC4286489  NIHMSID: NIHMS641870  PMID: 25385722

Abstract

Upstream stimulating factor 1 (USF1) is a basic helix loop helix transcription factor that specifically binds to E-box DNA motifs, known cis-elements of key oocyte expressed genes essential for oocyte and early embryo development. However, the functional and regulatory role of USF1 in bovine oocyte and embryo development is not understood. In this study, we demonstrated that USF1 mRNA is maternal in origin and expressed in a stage specific manner during the course of oocyte maturation and preimplantation embryonic development. Immunocytochemical analysis showed detectable USF1 protein during oocyte maturation and early embryonic development with increased abundance at 8–16 cell stage of embryo development, suggesting a potential role in embryonic genome activation. Knockdown of USF1 in germinal vesicle stage oocytes did not impact meiotic maturation or cumulus expansion, but caused significant changes in mRNA abundance for genes associated with oocyte developmental competence. Furthermore, siRNA mediated depletion of USF1 in presumptive zygote stage embryos demonstrated that USF1 is required for early embryonic development to the blastocyst stage. A similar (USF2) yet unique (TWIST2) expression pattern during oocyte and early embryonic development for related E-box binding transcription factors known to cooperatively bind USF1 suggest a potential link to USF1 action. This study demonstrates that USF1 is a maternally derived transcription factor required for bovine early embryonic development which also functions in regulation of JY-1, GDF9 and FST genes associated with oocyte competence.

Additional keywords: Embryo, siRNA knockdown, E-box, basic helix-loop-helix, transcriptional regulation

Introduction

In mammals, oocytes specific genes play a key role in regulation of the reproductive process and are critical to both ovarian folliculogenesis and early embryogenesis (Rajput et al. 2013). The products of these genes which are expressed, stored and secreted during oogenesis control the follicular microenvironment and promote oocyte competence for successful fertilization and subsequent embryonic development (De Sousa et al. 1998). Several studies have revealed that aberrant expression of these maternal transcripts is directly associated with infertility due to either complete growth arrest or compromised development of oocyte and preimplantation embryos. For example, targeted deletion of Gdf9, expressed throughout most stages of folliculogenesis, causes a block in follicular development at the primary follicle stage and complete infertility in mice (Dong et al. 1996). Oocyte expressed GDF9 protein also is an important paracrine regulator of surrounding granulosa/cumulus cell functions, which in turn affects competency of the oocyte to develop into a blastocyst after fertilization (Mottershead et al. 2012, Mottershead et al. 2013, Peng et al. 2013). Similarly, the bovine specific protein JY-1 plays a functional role in regulation of follicular function and early embryogenesis (Lee et al. 2014b). Supplementation of bovine granulosa cell culture media with recombinant JY-1 protein modulates FSH induced steroidogenesis. Depletion of JY-1 transcripts in germinal vesicle stage oocytes demonstrated adverse effects on nuclear maturation and expansion of surrounding cumulus cells, which retards early embryonic development after in vitro fertilization. Likewise, siRNA mediated knockdown of maternal JY-1 transcripts in zygote stage embryos demonstrated a functional requirement for JY-1 post fertilization (Bettegowda et al. 2007). Supplementation of recombinant JY-1 (rJY-1) protein during oocyte and embryo culture rescued the effect of JY-1 knockdown on cumulus expansion and meiotic maturation and blastocyst development, respectively (Lee et al. 2014b). In addition to JY-1, our laboratory has previously characterized the functional role of maternal (oocyte-derived) follistatin (FST) in promoting bovine early embryogenesis. Depletion of maternal FST in zygotes not only reduced the number of embryos developing to 8–16 cell stage and blastocyst stage but also decreased the number of total and TE cells in blastocyst (Lee et al. 2009).

Over the last decades, the functional role of numerous oocyte expressed/specific transcripts has been identified during folliculogenesis (Nobox, Figla, c-Kit) (Soyal et al. 2000, Rajkovic et al. 2004, Hutt et al. 2006), fertilization (Zp genes) (Dean 1992), early cleavage (NALP, Zar1, Npm2) (Tong et al. 2000, Burns et al. 2003, Wu et al. 2003, Peng et al. 2012) and embryonic genome activation (Brg1, H1oo) (Tanaka et al. 2001, Saeki et al. 2005, Bultman et al. 2006) using different gene knockdown strategies in mammals. The majority of oocyte expressed genes involved in fertilization and embryonic development display highly conserved structural and functional properties among different mammalian species (Sylvestre et al. 2013). However, understanding of how these maternally expressed genes are transcriptionally regulated and hence fundamental mechanisms regulating oogenesis and early embryonic development remains poorly understood due to limited characterization of oocyte expressed transcription factors in mammals. Comprehensive computational, mutational and functional analysis of the promoters of several of these oocyte specific genes including GDF9, JY-1, FST, ZP genes, NALP genes, H1oo, and Npm2 revealed common cis-acting regulatory elements known as E-box, present within 200bp upstream of the transcription start site and critically important for their transcriptional regulation during oogenesis (Liang et al. 1997, Yan et al. 2006, Bettegowda et al. 2007, Tsunemoto et al. 2008). Interestingly, this conserved and canonical E box (CANNTG) DNA element is a well characterized binding site for FIG-alpha, upstream stimulatory factor 1 (USF1), USF2 and TWIST2 and other transcription factors of the basic helix-loop-helix (bHLH) and leucine zipper family. The functional role of oocyte expressed FIGalpha has been well documented in transcriptional regulation of zona pellucida genes (ZP-1, ZP-2 and Zp3) necessary for fertilization (Liang et al. 1997), and NALP family of genes (Joshi et al. 2007) essential for early embryonic development beyond the 2-cell stage in mice (Tong et al. 2000). Moreover, E-box dependent regulatory roles of USF1, USF2 and TWIST2 transcription factors have been clearly demonstrated in transcriptional regulation of genes associated with stress, immune responses and the cell cycle and proliferation in different somatic and cancer tissues (Corre & Galibert 2005, Xue & Hemmings 2012). To our knowledge, the temporal expression and potential functional role of USF1, USF2 and TWIST2 in oocytes and early embryos has not been reported previously.

In the present study, we investigated the temporal expression of USF1, USF2 and TWIST2 during oocyte and early embryogenesis in cattle. The functional role of USF1 in early embryonic development and transcriptional regulation of select oocyte expressed genes containing an E-box motif in their promoter region was analyzed using siRNA mediated gene knockdown in cumulus enclosed oocytes prior to initiation of meiotic maturation. Results support a potential regulatory role for above transcription factors in bovine oocyte and early embryonic development.

Materials and methods

All chemicals and reagents used were obtained from Sigma-Aldrich (St. Louis, MO) unless specified

In vitro oocyte and embryo culture

In vitro maturation of oocytes, in vitro fertilization and embryo culture to the blastocyst stage were conducted as described previously (Bettegowda et al. 2006). Briefly, cattle ovaries were obtained from a local slaughterhouse and cumulus-oocyte complexes (COCs) were aspirated from 2–7 mm antral follicles. Germinal vesicle (GV) stage oocytes enclosed by a minimum of three compact layers of cumulus cells and containing homogenous cytoplasm were collected immediately after aspiration. COCs were cultured for 24 hours (h) in maturation medium (Medium-199, 10% FBS; Gibco-BRL, Grand Island, NY) containing 1 IU/mL FSH, 5 IU/mL LH, and 1 μg/mL estradiol–17β to induce meiotic maturation. Matured oocytes were fertilized with Percoll-purified motile spermatozoa and incubated for 20 h at 38.5°C under 5% CO2 in humidified air. After fertilization, presumptive zygotes (n=20 per treatment; defined below) were vortexed for 6 minute to completely remove the excess sperm and cumulus cells and washed zygotes cultured in potassium simplex optimization medium (KSOM; Specialty Media, Phillipsburg, NJ) supplemented with 0.3% BSA at 38.5°C in humidified air and 5% CO2. The embryos were then transferred into fresh KSOM with 0.3% BSA and 10% fetal bovine serum at 72 h post insemination and further cultured until the blastocyst stage (d 7).

Sample collection for RNA analysis and immunostaining

GV and metaphase II (MII) stage oocytes were collected immediately after aspiration and 24 h after in vitro maturation respectively. Both GV and MII stage oocytes were stripped of cumulus cells by vortexing for 5 min in Hepes-TALP containing 0.1% hyaluronidase. At approximately 20h post fertilization, presumptive zygotes were denuded by vortexing, washed and used for experimental analysis. In addition, embryos at 2-cell (C), 4C, 8C and 16C stage were collected at 33, 44, 52 and 72 h postfertilization, respectively, and morula and blastocysts were collected at 5 and 7 d postfertilization respectively. For each stage of collected oocytes and embryos, four replicates were taken for real-time PCR analysis and immunofluorescent staining.

Quantitative real-time RT-PCR

Procedures used for RNA isolation, cDNA synthesis and quantitative real-time RT-PCR to analyze the transcript abundance in GV and MII stage oocytes and early embryos samples (n= 4 pools of 10 oocytes/embryos per group) were performed as described previously (Bettegowda et al. 2006). RPS18 was used as endogenous control to normalize the gene expression data. See Table 1 for the list of primer sequences used in real-time PCR. For all genes no template controls showed no amplification and melting curves were run for all samples showing a single product.

Table 1.

Primers used for qRT-PCR

Gene name Accession number Primer Sequence (5′ → 3′)
USF1 NM_001001161 F: TGGCCGGACTTAGCACTCA
R: TCCGAGGAACTGGTCCTTCTT
USF2 NM_001001162 F: AAGGAGAGCTCAGCATAATGAAGTG
R: GAAAGCTGGACGATCCAGTTG
TWIST2 NM_001083748 F: TCGCCGGTCCATCTCTCA
R: AAGGTTGGGTCTATGAACACTCTCA
JY-1 NM_001110098 F: TTGGAACTTCCATGGACGACC
R: ATTTGCTGGTGATCCCAAGAG
GDF9 NM_174681.2 F: GGAATCTGAGGCTGAGACTTGG
R: GTGAAAAGCCTGAGCACTTGTG
FST BF774514 F F: CAGAGCTGCAAGTCCAGTACCA
R: CATGTAGAGCTGCCTGGACAGA
RPS18 NM_001033614 F: GTGGTGTTGAGGAAAGCAGACA
R: TGATCACACGTTCCACCTCATC
Open in a new tab

Immunofluorescent staining

Immunofluorescent staining was performed for USF1 protein localization in oocytes and embryos according to previously published protocols (Tripurani et al. 2011). After fixation, permeabilization and blocking, samples were probed with commercially available rabbit polyclonal anti-USF1 antibody [1:200 (v/v), Santa Cruz Biotechnology, sc229] and corresponding fluorescein isothiocyanate-conjugated secondary antibody [0.5% (w/v) F9887; Sigma-Aldrich, St. Louis, MO]. Immunostaining experiments were replicated four times using at least 10–12 oocytes/embryos per sample. Oocytes and embryos incubated without the primary USF1 antibodies were used as negative controls.

Identification of USF1 transcript origin in early embryos

To determine the origin of USF1 transcripts in early embryos (maternal versus zygotic), presumptive zygotes were cultured in KSOM containing 0.3% BSA in the presence and absence of a transcription inhibitor (50 μg /mL α-amanitin). After 52 h of in vitro culture, pools of 8-cell embryos were collected within treatment (n = 10 embryos per pool; n = 4 replicates for α-amanitin and untreated controls) and subjected to real-time quantification of USF-1 transcript abundance as described above.

Design and validation of siRNA mediated USF1 knockdown

Microinjection of USF1 siRNA was performed to knockdown endogenous USF1 in bovine embryos using our previously published procedures (Bettegowda et al. 2007). Two distinct siRNA species were designed against the open reading frame of bovine USF1 mRNA using publicly available siRNA design algorithm (siRNA target finder; Ambion, Austin, TX; species 1 sense 5′-AATTCCTCCCTGCAACACTTCCCTGTCTC-3′, antisense 5′-AAGAAGTGTTGCAGGGAGGAACCTGTCTC-3′, species 2 sense 5′-AACATCATTGTCCAGCTGTAGCCTGTCTC-3′, antisense 5′-AACTACAGCTGGAC AATGATGCCTGTCTC-3′). All candidate siRNA were interrogated by using the basic local alignment tool program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to rule out homology off targets to any other known genes in the bovine expressed sequence tag and genomic database. The USF1 siRNA species were synthesized with the Silencer siRNA construction kit (Ambion) by following the manufacturer’s protocol.

Microinjection of USF1 siRNA into bovine embryos and subsequent early embryo culture experiments were performed as described previously (Bettegowda et al. 2007). Individual USF1 siRNA were validated for specificity and efficacy of USF1 mRNA and protein knockdown in early embryos. Presumptive zygotes collected at 16–18 hours post insemination (hpi) were microinjected with 50 μM cocktail of USF1 siRNA species (USF1-siRNA-S1 and S2) and four cell embryos were collected at 42–44 hpi for real-time PCR analysis of USF1 mRNA. Uninjected embryos and embryos injected with negative control siRNA (Universal control species 1; Ambion) were used as control groups (n = 4 experimental replicates with 10 embryos per group). Efficiency of USF1 siRNA species in reducing USF1 protein was determined by USF1 immunostaining of 8-cell embryos collected 72 hpi (n= 10 embryos for uninjected, negative control siRNA injected and USF1 siRNA species injected).

Effect of USF-1 depletion on embryonic development

To determine the effect of USF1 ablation on early embryonic development, proportion of USF1 siRNA injected presumptive zygotes that cleaved 48 hpi, reached 8–16C (72 hpi) and blastocyst stage (7 d after insemination) were recorded and compared with uninjected and negative control siRNA injected embryos. Each experiment was replicated 6 times with 50 embryos per treatment.

Effect of USF1 depletion on oocyte maturation, cumulus expansion and abundance of specific oocyte-expressed transcripts

To determine the functional requirement of USF-1 for meiotic maturation, cumulus expansion and knockdown effects on mRNA abundance for select E-box containing genes, cumulus-enclosed GV stage oocytes were microinjected with USF-1 siRNA cocktail and pre-incubated for 48 h in 50 μM S-roscovitine containing maturation medium to arrest meiotic maturation and allow sufficient time for USF-1 knockdown using our previously published procedures (Lee et al. 2014b). Then, COCs were washed thoroughly in maturation media to completely remove the S-roscovitine and subjected to meiotic maturation for 24 h as described above. Uninjected and negative control siRNA injected COCs were also subjected to the same S-roscovitine treatment and used as control groups. After 24 h of in vitro maturation, effects of treatments on cumulus expansion and progression to metaphase II were determined (n= 20 oocytes per group; n= 4 replicates) as we described previously (Lee et al. 2014). Additional oocytes were stripped of cumulus cells and used for real-time quantification of transcripts for USF1 and related bHLH transcription factors (USF2, TWIST2) and select genes linked to bovine oocyte competence (JY-1, GDF9 and FST ; n= 10 oocytes per group; n= 4 replicates).

Statistical analysis

Relative expression of mRNA was analyzed in SAS using a one way ANOVA with differences in means detected by Fisher’s protected least significant difference (PLSD). Embryo development data was calculated based on the total number of zygotes and was arc-sine transformed before analysis using a one way ANOVA. Similar statistical analysis as for embryos was used for determination of effects of treatments on meiotic maturation and cumulus expansion. Differences between means were also detected using PLSD. All data are presented untransformed.

Results

Expression characterization of USF1 mRNA and protein at different stages of oocyte and early embryo development

Quantitative real-time PCR was performed to characterize temporal changes in abundance of USF1 transcripts during meiotic maturation and early embryonic development. USF1 mRNA abundance was quite stable during meiotic maturation and pronuclear (PN) stage, increased (P < 0.001) at 2C stage relative to the metaphase II (MII) stage, and then was considerably decreased (<0.007) after the 8C stage to barely detectable levels at blastocyst stage (Fig. 1A). To determine the origin of the USF1 transcripts (maternal versus zygotic) present in early embryos, zygotes were cultured in the presence of the transcriptional inhibitor alpha-amanitin (Fig. 1B) and mRNA abundance was analyzed by real-time PCR at 8C stage. The abundance of USF1 transcripts was higher in α-amanitin treated compared to control 8-cell stage embryos, indicating that transcripts detected were maternal in origin and also suggests that embryonic transcription is necessary for normal degradation of USF1 mRNAs after 8C stage of embryonic development.

Figure 1. Expression characterization of USF1 mRNA during oocyte and early embryo development.

Figure 1

Open in a new tab

(A) Relative abundance of USF1 transcript during meiotic maturation [GV and MII stage of oocytes] and at different developmental stages of early embryos [pronuclear (PN), 2-cell (2C), 4-cell (4C), 8-cell (8C), 16-cell (16C), morula (MO) and blastocyst (BL) stage]. (B) Relative amount of USF1 mRNA in 8C embryos cultured in the presence of α-amanitin is significantly different from control embryos. Data were normalized relative to abundance of endogenous control (RPS18) and are shown as mean ± SEM. Values with different superscripts indicate significant differences (P < 0.05).

The abundance and localization of USF1 protein was investigated by immunocytochemical analysis (Fig. 2) which demonstrated increased USF1 protein at MII stage relative to GV stage and minimally decreased USF1 protein at zygote and 2-cell stage of embryo development. The abundance of USF1 protein increased by the 4 cell stage and at 8 cell stage during early embryonic development. After the 8-cell stage, abundance of USF1 protein slightly declined at 16 cell stage and then remained stable during the stages leading up to the blastocyst stage.

Figure 2. Spatiotemporal expression of USF1 protein during oocyte maturation and early embryonic development.

Figure 2

Open in a new tab

Immunofluorescent localization of USF1 protein at different stages of bovine oocyte and preimplantation embryo development. Nuclear DNA was stained with 4′,6-diamidino-2-phenylindole. Neg, Negative control embryos incubated in absence of USF1 antibody.

USF1 knockdown effect on bovine early embryonic development

To determine the effect of USF1 depletion on early embryonic development, siRNA mediated gene silencing procedures were validated in bovine embryos. Microinjection of USF1 siRNA cocktail at zygote stage of embryo development significantly reduced (P<0.05) the abundance of USF1 mRNA by ≈90% in resulting 4C stage embryos relative to the uninjected and negative control siRNA-injected embryos as determined by real-time PCR (Fig. 3A) To further confirm the efficacy of USF1 siRNA, USF1 immunostaining was performed in resulting 8C stage embryos. A specific reduction of USF1 protein to was observed compared to both uninjected and negative siRNA control injected embryos (Fig. 3B)

Figure 3. Effect of zygote USF1 siRNA microinjection on USF1 mRNA and protein level in resulting 4-cell and 8-cell embryos respectively.

Figure 3

Open in a new tab

(A) Effect of siRNA microinjection at pronuclear stage of embryo on abundance of USF1 transcript in resulting 4 cell embryos (10 embryos per group, 4 replicates). Data were normalized relative to abundance of endogenous control RPS18 and shown as mean ± SEM. Values with different letters indicate significant difference (P < 0.05) (B) Effect of RNAi mediated depletion of USF1 in bovine zygotes on USF1 protein level in resulting eight-cell embryos as determined by immunofluorescent staining (n = 4). Uninjected embryos and embryos injected with a nonspecific siRNA (Negative control siRNA) served as controls. Nuclear DNA was stained with 4′,6-diamidino-2-phenylindole (DAPI).

Effect of the USF1 knockdown on early embryonic development was analyzed by microinjection of validated USF1 siRNA cocktail into bovine zygotes and analysis of subsequent effects on cleavage rate, and proportion of embryos developing to 8C stage and blastocyst stages compared to uninjected and negative control siRNA-injected embryos. USF1 siRNA injection did not affect the total cleavage rate (Fig. 4A) but reduced the proportion of IVF embryos developing to the 8C stage relative to uninjected and negative control siRNA-injected embryos (P < 0.001; Fig. 4B). A more than two fold reduction was observed in proportion of IVF embryos developing to blastocyst stage for USF1 siRNA injected embryos compared to uninjected and negative control siRNA-injected embryos (P < 0.001; Fig. 4C).

Figure 4. Requirement of USF1 for bovine early embryonic development.

Figure 4

Open in a new tab

Presumptive zygotes were microinjected (16–18 h post fertilization) with either USF1 siRNA (cocktail) or universal negative control siRNA (Neg. Control siRNA) species 1 (Ambion) or served as uninjected controls. Presumptive zygotes were then cultured in KSOM medium supplemented with 0.3 % BSA (50 presumptive zygotes per group, 6 replicates). The 8–16 cell stage embryos were separated 72 h post insemination (hpi) and cultured in fresh KSOM medium supplemented with 0.3 % BSA and 10 % FBS until d 7. Effect of USF1 depletion on (A) total cleavage rate (determined 48 hpi) (B) proportion of embryos developing to the 8–16 cell stage (72 hpi) and (C) proportion of embryos developing to the blastocyst stage (d 7). Data are shown as mean ± SEM. Values with different superscripts across treatments indicate significant differences (P < 0.001).

Effect of USF1 knockdown in germinal vesicle stage oocytes on progression to metaphase II, cumulus expansion and transcript abundance for select oocyte-expressed genes during bovine oocyte maturation in vitro

Given the observed effect of USF1 siRNA knockdown on early embryonic development, we investigated the functional role of USF1 transcription factor in meiotic maturation, cumulus expansion and regulation of TWIST2, JY-1 GDF9 and FST genes, carrying USF1 binding element (E-box) in their promoter region and/or essentially required for the developmental competence of bovine oocytes. Microinjection of USF1 siRNA into GV stage oocytes did not impact subsequent rates of meiotic maturation and cumulus expansion following in vitro maturation (See supplementary data). However, real-time PCR analysis demonstrated that USF1 siRNA injection resulted in a > 95% decrease in USF1 transcript abundance following 48 h culture in S-roscovitine and subsequent in vitro maturation (P<0.0001; Fig. 5A). TWIST2 and JY1 mRNA abundance were increased in USF1 siRNA injected oocytes collected at MII stage of meiotic maturation compared to uninjected and negative siRNA control injected oocytes (P<0.0003; Fig. 5B and 5C respectively). In contrast, GDF9 and FST transcript abundance were reduced in USF1 siRNA injected oocytes relative to uninjected and negative control siRNA injected oocytes collected at MII stage (P<0.0001; 5D and P<0.003; 5E respectively). Negative control siRNA injection resulted in a modest decrease in GDF9 transcript abundance compared to uninjected group suggesting a modest off-target effect of negative control siRNA on GDF9 expression, but GDF9 transcript abundance in USF1 siRNA injected oocytes was lower than both control groups (uninjected and negative control siRNA injected). These results suggest that USF1 potentially functions as a regulator of GDF9, FST, TWIST2 and JY-1 transcript abundance during oocyte maturation. However, abundance of USF2 mRNA was not altered in response to USF1 siRNA injection (Fig. 5F).

Figure 5. USF1 siRNA injection in GV stage oocytes affects the mRNA abundance of specific oocyte expressed genes in resulting MII stage oocytes following in vitro maturation.

Figure 5

Open in a new tab

Samples of cDNA collected from MII stage oocytes were subjected to real time RT-PCR analysis for quantification of USF1 (A), TWIST2 (B) JY-1 (C) GDF9 (D) FST (E) and USF2 (F) mRNA. Data were normalized relative to abundance of endogenous control RPS18 and shown as mean ± SEM. Values with different letters indicate statistical difference (P < 0.0001).

Temporal regulation of mRNA for USF2 and TWIST2 transcription factors during oocyte maturation and early embryonic development: Potential link to USF1 action

Temporal changes in USF2 and TWIST2 transcript abundance were established and compared to results obtained for USF1 to determine potential association of these transcription factors (Garcia-Sanz et al. 2013) in transcriptional regulation of JY-1, GDF9 and other genes containing multiple E-box binding elements in their promoter regions. In comparison with USF1, USF2 transcript abundance displayed similar changes during oocyte and early embryonic development (Fig. 1A; Fig. 6A respectively). On the other hand, temporal changes in TWIST2 mRNA abundance were distinct from those observed for USF1 and USF2 (Fig. 6B). Abundance of TWIST2 mRNA was elevated during meiotic maturation (P<0.0001), decreased (P<0.0005) at the pronuclear and two-cell stages relative to the metaphase II (MII) stage, and then significantly increased (P<0.05) by 4C stage. After 4C stage, the abundance of TWIST2 transcripts progressively decreased through the 16C stage and was barely detectable at morula and blastocyst stages.

Figure 6. Expression characterization of USF2 and TWIST2 mRNA during oocyte and early embryo development.

Figure 6

Open in a new tab

Real-time PCR analysis for quantification of USF2 (A) and TWIST2 (B) mRNA during meiotic maturation [GV and MII stage of oocytes] and at different developmental stages of early embryos [pronuclear (PN), 2-cell (2C), 4-cell (4C), 8-cell (8C), 16-cell (16C), morula (MO) and blastocyst (BL) stage]. Transcript levels were normalized relative to abundance of endogenous control (RPS18) RNA and are shown as mean ± SEM. Time points without a common letter (a, b, c, d and e) are significantly different (P < 0.05)

Discussion

Results of the present study established temporal expression of USF1 mRNA and protein during bovine oocyte maturation and early embryogenesis and a functional requirement of this bovine oocyte expressed USF1 transcription factor for early embryogenesis and regulation of genes involved in oocyte competence and early embryonic development. However, results suggest that USF1 knockdown in GV stage oocytes does not impact meiotic maturation and cumulus expansion. To our knowledge, a functional role for USF1 in early embryogenesis and potential regulation of genes linked to oocyte competence has not been reported previously.

USF1 is a member of the bHLH leucine zipper family which has been implicated in tissue specific transcriptional regulation of a wide range of genes (Littlewood & Evan 1998). Most commonly, this transcription factor binds to a pyrimidine-rich initiator (Inr) elements or E-box motifs of the promoter region as homodimers or a heterodimer (USF1/2) and might act with or without association with other E-box binding transcription factors of bHLH family (Garcia-Sanz et al. 2013). The USF1/USF2 heterodimer is a major DNA binding form present in most tissues and cell types compared to the homodimers (Fair et al. 1995, Rajput et al. 2013). In our experiments, we observed similar temporal changes in transcript abundance for USF1 and USF2 in bovine oocytes and early embryos suggesting a potential functional role of USF1/USF2 heterodimer in transcriptional regulation during oocyte and early embryogenesis. However, establishment of USF1/USF2 protein-protein interactions and a functional role of USF2 in bovine oocytes and early embryos will require further investigation. TWIST2 transcription factor also functions as a molecular switch to either activate or repress target genes via direct binding to conserved E-box sequences in the promoter region and recruitment of co-activator(s) or repressor(s) (Franco et al. 2011). High abundance of TWIST2 transcript at MII stage in oocytes and 4–8 cell embryonic stage suggests a potential regulatory role in control of genes associated with maturation and initial cleavage divisions during early embryonic development. Interestingly, many of the mammalian target genes for TWIST2 includes cell adhesion molecules (E-cadherin and fibronectin) and transcription factors (beta-catenin and STAT3) (Fang et al. 2011), genes involved in sperm and oocyte fusion (Takezawa et al. 2011), cleavage, compaction and in the formation of a implantation competent embryo (Bloor et al. 2002).

The observed significant reduction in both USF1 and USF2 transcripts immediately after embryonic genome activation (occurs at 8C stage in bovine) suggests a maternal origin of these transcripts with potential depletion or degradation upon embryonic genome activation. Increased abundance of USF1 transcripts in transcriptional inhibitor (alpha-amanitin) treated embryos at 8C stage (Fig. 1B) further confirmed their maternal origin and that USF1 transcript depletion is dependent on zygotic degradation machinery activated with the onset of embryonic genome activation. A large number of maternal transcripts are degraded by zygotic decay machinery during early embryonic development in drosophila and other bilateria including zebrafish, frogs and mice (Tadros & Lipshitz 2009, Thomsen et al. 2010). We have observed similar transcription dependent degradation of maternal transcripts for TGFβ superfamily signaling pathway components in bovine embryos coincident with genome activation (Lee et al. 2014a). Results suggest that timely depletion of maternal transcription factors and signaling proteins is associated with embryo development progression.

We investigated the functional role of USF1 during meiotic maturation and early embryonic development using an effective and previously optimized siRNA based gene knockdown approaches for oocytes and embryos (Bettegowda et al. 2007, Lee et al. 2014c). siRNA based knockdown of USF1 transcripts in fertilized embryos resulted in effective reduction in proportion of embryos reaching the 8C stage and the blastocyst stage. However no effect was observed on total cleavage rates which suggest that USF1 transcription factor is potentially required for later stages of embryogenesis after initial cleavage division. Results suggest that USF1 is potentially required for development events at or after the 8-cell stage including embryonic genome activation. Moreover, USF1 contains a nuclear localization signal which directs its transport to the nucleus to regulate a broad spectrum of targeted gene transcription (McMurray & McCance 2003, Crusselle-Davis et al. 2006, Anantharaman et al. 2011). The transcriptional regulation through USF1 has previously been shown to be associated with its nuclear abundance in various cellular models (Zhang et al. 2007, van Deursen et al. 2008, Viswanathan et al. 2009). Therefore, it is likely that increased abundance of USF1 protein in 8C stage embryos (Fig. 2) coincident with embryonic genome activation is of potential functional importance in transcriptional activity of the embryonic genome.

Results of the present study provide support for a functional role of USF1 transcription factors in regulation of multiple genes linked to oocyte competence in cattle. In bovine, JY-1 and GDF9 are widely studied oocyte specific genes which contain multiple E-boxes in their regulatory region and play an important role in oocyte competence for successful early embryonic development (Yan et al. 2006, Bettegowda et al. 2007, Roy et al. 2013, Lee et al. 2014b). Our results demonstrated that siRNA mediated depletion of USF1 in GV stage oocytes significantly reduced the transcript abundance for GDF9 gene at MII stage which suggests a positive role in regulation of GDF9 mRNA abundance and presumably transcription. NOBOX and E-box motifs are the critical regulatory sequences, found in the Gdf9 promoter, responsible for its oocyte specific expression in mammals (Rajkovic et al. 2004, Yan et al. 2006). Functional analysis of promoter mutations has established an essential E-box regulatory sequence (CAGCTG) at −182 to −177 bp upstream of the Gdf9 initiation codon in mice which was found to be conserved across the 16 mammalian species including cattle (Bettegowda et al. 2007). Interestingly, it has been demonstrated that USF1 transcription factor can bind to E-box motif (CAGCTG) to regulate tissue specific transcription in mice (Fang et al. 2011)

Results support potential USF1 dependent regulation of GDF9 transcription in bovine oocytes, but further studies are needed to conclusively prove transcriptional regulation. In cattle, oocytes in the growth phase display greatest transcriptional activity (Fair et al. 1995), but direct evidence of transcriptional activity during meiotic maturation is limited. Array analysis of the bovine oocyte transcriptome revealed increased abundance of approximately 10% of the mRNAs during meiotic maturation (Dalbies-Tran & Mermillod 2003). This increase in mRNA abundance was potentially attributed to transcriptional activity at the beginning of meiotic maturation of GV oocytes aspirated from > 3mm antral follicles and cultured in vitro (Memili et al. 1998, Hendriksen et al. 2000, Tomek et al. 2002). Moreover, 24 h incubation in the presence of CDK inhibitors to maintain meiotic arrest, resulted in increased content of poly (A) mRNAs in bovine oocyte (Lequarre et al. 2004). In the present studies, we incubated USF1 siRNA injected oocytes in the presence of the CDK inhibitor roscovitine for 48 h to allow time for siRNA mediated depletion of USF1 prior to meiotic maturation. Therefore, it is possible that USF1 transcription factor knockdown reduced GDF9 expression during meiotic maturation in vitro through interaction with E-box regulatory elements present in the GDF9 promoter. However, further studies are needed to conclusively establish USF1 mediated transcriptional regulation of the GDF9 gene in bovine oocytes.

Results from our previous studies demonstrated an important functional requirement of the bovine oocyte specific JY-1 gene for meiotic maturation and early embryogenesis (Bettegowda et al. 2007). However, no effect of USF1 knockdown on meiotic maturation and cumulus expansion was observed in the current studies. Depletion of JY-1 transcripts in zygote stage embryos results in considerably reduced rates of development to the 8–16 cell stage and blastocyst compared to controls. Interestingly, five putative E-box motifs have been identified within 500 bp upstream of the JY-1 transcription start site (TSS) (Bettegowda et al. 2007). Out of the five putative E-box motifs, three have CAGCTG E-box motif and the one E-box adjoining TSS has a CACGTG motif, a well-known USF transcription factor binding sequence. In the present study, siRNA based knockdown of USF1 in GV stage oocytes resulted in a significant increase in JY-1 transcripts in MII stage oocytes which suggest a potential negative regulatory role for USF1 in modulation of JY-1 transcription. Similar to other bHLH proteins, USF1 function in both transcriptional activation and repression has been previously characterized and activity (activation versus repression) is dependent upon specific binding partner in various cellular models (McMurray & McCance 2003, Crusselle-Davis et al. 2006, Anantharaman et al. 2011). The presence of multiple E-boxes at 5′ flanking region of JY-1 promoter suggests the binding of more than one bHLH transcription factor (Dec2, TWIST, and USF2) which might be working in association with USF1 to repress JY-1 transcription in oocytes.

Additionally, we have also analyzed the effect of USF1 knockdown on abundance of other transcripts linked to bovine oocyte and embryo competence (FST) and potential USF1 binding partners (USF2, TWIST2) in USF1 siRNA injected oocyte collected at MII stage. FST has been previously characterized as an important maternal (oocyte-derived) factor required for early embryo cleavage, blastocyst development and functional determinant of blastocyst cell allocation (Rajput et al. 2013). Reduced expression of FST in USF1 depleted oocytes potentially supports observed functional role of USF1 TF in early embryonic development via regulating the transcription of oocyte expressed genes. Furthermore, siRNA mediated depletion of USF1 enhanced the mRNA abundance for TWIST2 whereas abundance of USF2 mRNA remained unchanged in MII stage oocytes. In support of USF1 knockdown effects reported, in silico analysis revealed five different E-boxes within 1.3 kb upstream of the TWIST2 mRNA transcription start site (TSS) and two of them (CACCTG, CAGATG) were found to be highly conserved among mammals (unpublished). Moreover, two putative E-boxes were identified within the 5′UTR region of FST gene and one (CACCTG) showed high level of conservation, whereas E-box motifs were not detected upstream of the USF2 transcription start site (unpublished). Collectively, these results suggest that USF1 TF potentially mediates E-box dependent positive regulation of GDF9 and FST, and negative regulation of TWIST2 and JY-1 transcription

In conclusion, results of the present study provide novel information about the spatiotemporal expression pattern of USF1, USF2 and TWIST transcription factors during oocyte and early embryonic development. Results establish a functional requirement of USF1 transcription factor in embryo development to the blastocyst stage and suggest an important regulatory role of USF1 transcription factor in modulating the transcription of GDF9, FST, TWIST2 and JY-1 genes in bovine oocytes. Moreover, siRNA mediated depletion of USF1 transcription factor resulted in a similar adverse effect on early embryonic development as observed upon JY-1 and FST knockdown in fertilized embryos. Further mutation analysis of the GDF9, FST, TWIST2 and JY-1 promoter containing regulatory E-boxes and their interaction with USF1 and other associated bHLH transcription factors will provide further insight into precise molecular mechanisms involve in oocyte/embryo transcriptional regulation in cattle.

Supplementary Material

1

Acknowledgments

This study was supported by National Research Initiative competitive grant no. 2008-35203-19094 from the U.S.D.A. National Institute of Food and Agriculture and the National Institute of Child Health and Human Development of the National Institutes of Health under award number R01HD072972. Tirtha K. Datta was supported by the travel grant from Department of Biotechnlogy, Govt of India.

Footnotes

Declaration of interest

None of the authors has any financial or other potential conflict of interest related to this manuscript

Contributor Information

Tirtha K Datta, Email: tirthadatta@gmail.com.

Sandeep K Rajput, Email: srajput@msu.edu.

Gabbine Wee, Email: gabbine@dgmif.re.kr.

KyungBon Lee, Email: kblee20@gmail.com.

Joseph K Folger, Email: folgerjo@msu.edu.

George W Smith, Email: smithge7@msu.edu.

References

  1. Anantharaman A, Lin IJ, Barrow J, Liang SY, Masannat J, Strouboulis J, Huang S, Bungert J. Role of helix-loop-helix proteins during differentiation of erythroid cells. Mol Cell Biol. 2011;31:1332–1343. doi: 10.1128/MCB.01186-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bettegowda A, Patel OV, Ireland JJ, Smith GW. Quantitative analysis of messenger RNA abundance for ribosomal protein L-15, cyclophilin-A, phosphoglycerokinase, beta-glucuronidase, glyceraldehyde 3-phosphate dehydrogenase, beta-actin, and histone H2A during bovine oocyte maturation and early embryogenesis in vitro. Mol Reprod Dev. 2006;73:267–278. doi: 10.1002/mrd.20333. [DOI] [PubMed] [Google Scholar]
  3. Bettegowda A, Yao J, Sen A, Li Q, Lee KB, Kobayashi Y, Patel OV, Coussens PM, Ireland JJ, Smith GW. JY-1, an oocyte-specific gene, regulates granulosa cell function and early embryonic development in cattle. Proc Natl Acad Sci U S A. 2007;104:17602–17607. doi: 10.1073/pnas.0706383104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bloor DJ, Metcalfe AD, Rutherford A, Brison DR, Kimber SJ. Expression of cell adhesion molecules during human preimplantation embryo development. Mol Hum Reprod. 2002;8:237–245. doi: 10.1093/molehr/8.3.237. [DOI] [PubMed] [Google Scholar]
  5. Bultman SJ, Gebuhr TC, Pan H, Svoboda P, Schultz RM, Magnuson T. Maternal BRG1 regulates zygotic genome activation in the mouse. Genes Dev. 2006;20:1744–1754. doi: 10.1101/gad.1435106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Burns KH, Viveiros MM, Ren Y, Wang P, DeMayo FJ, Frail DE, Eppig JJ, Matzuk MM. Roles of NPM2 in chromatin and nucleolar organization in oocytes and embryos. Science. 2003;300:633–636. doi: 10.1126/science.1081813. [DOI] [PubMed] [Google Scholar]
  7. Corre S, Galibert MD. Upstream stimulating factors: highly versatile stress-responsive transcription factors. Pigment Cell Res. 2005;18:337–348. doi: 10.1111/j.1600-0749.2005.00262.x. [DOI] [PubMed] [Google Scholar]
  8. Crusselle-Davis VJ, Vieira KF, Zhou Z, Anantharaman A, Bungert J. Antagonistic regulation of beta-globin gene expression by helix-loop-helix proteins USF and TFII-I. Mol Cell Biol. 2006;26:6832–6843. doi: 10.1128/MCB.01770-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dalbies-Tran R, Mermillod P. Use of heterologous complementary DNA array screening to analyze bovine oocyte transcriptome and its evolution during in vitro maturation. Biol Reprod. 2003;68:252–261. doi: 10.1095/biolreprod.102.007872. [DOI] [PubMed] [Google Scholar]
  10. De Sousa PA, Caveney A, Westhusin ME, Watson AJ. Temporal patterns of embryonic gene expression and their dependence on oogenetic factors. Theriogenology. 1998;49:115–128. doi: 10.1016/s0093-691x(97)00406-8. [DOI] [PubMed] [Google Scholar]
  11. Dean J. Biology of mammalian fertilization: role of the zona pellucida. J Clin Invest. 1992;89:1055–1059. doi: 10.1172/JCI115684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature. 1996;383:531–535. doi: 10.1038/383531a0. [DOI] [PubMed] [Google Scholar]
  13. Fair T, Hyttel P, Greve T. Bovine oocyte diameter in relation to maturational competence and transcriptional activity. Mol Reprod Dev. 1995;42:437–442. doi: 10.1002/mrd.1080420410. [DOI] [PubMed] [Google Scholar]
  14. Fang X, Cai Y, Liu J, Wang Z, Wu Q, Zhang Z, Yang CJ, Yuan L, Ouyang G. Twist2 contributes to breast cancer progression by promoting an epithelial-mesenchymal transition and cancer stem-like cell self-renewal. Oncogene. 2011;30:4707–4720. doi: 10.1038/onc.2011.181. [DOI] [PubMed] [Google Scholar]
  15. Franco HL, Casasnovas J, Rodriguez-Medina JR, Cadilla CL. Redundant or separate entities?--roles of Twist1 and Twist2 as molecular switches during gene transcription. Nucleic Acids Res. 2011;39:1177–1186. doi: 10.1093/nar/gkq890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Garcia-Sanz P, Fernandez-Perez A, Vallejo M. Differential configurations involving binding of USF transcription factors and Twist1 regulate Alx3 promoter activity in mesenchymal and pancreatic cells. Biochem J. 2013;450:199–208. doi: 10.1042/BJ20120962. [DOI] [PubMed] [Google Scholar]
  17. Hendriksen PJ, Vos PL, Steenweg WN, Bevers MM, Dieleman SJ. Bovine follicular development and its effect on the in vitro competence of oocytes. Theriogenology. 2000;53:11–20. doi: 10.1016/s0093-691x(99)00236-8. [DOI] [PubMed] [Google Scholar]
  18. Hutt KJ, McLaughlin EA, Holland MK. Kit ligand and c-Kit have diverse roles during mammalian oogenesis and folliculogenesis. Mol Hum Reprod. 2006;12:61–69. doi: 10.1093/molehr/gal010. [DOI] [PubMed] [Google Scholar]
  19. Joshi S, Davies H, Sims LP, Levy SE, Dean J. Ovarian gene expression in the absence of FIGLA, an oocyte-specific transcription factor. BMC Dev Biol. 2007;7:67. doi: 10.1186/1471-213X-7-67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lee KB, Bettegowda A, Wee G, Ireland JJ, Smith GW. Molecular determinants of oocyte competence: potential functional role for maternal (oocyte-derived) follistatin in promoting bovine early embryogenesis. Endocrinology. 2009;150:2463–2471. doi: 10.1210/en.2008-1574. [DOI] [PubMed] [Google Scholar]
  21. Lee KB, Folger JK, Rajput SK, Smith GW. Temporal regulation of mRNAs for select bone morphogenetic proteins (BMP), BMP receptors and their associated SMAD proteins during bovine early embryonic development: effects of exogenous BMP2 on embryo developmental progression. Reprod Biol Endocrinol. 2014a;12:67. doi: 10.1186/1477-7827-12-67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lee KB, Wee G, Zhang K, Folger JK, Knott JG, Smith GW. Functional role of the bovine oocyte-specific protein JY-1 in meiotic maturation, cumulus expansion, and subsequent embryonic development. Biol Reprod. 2014b;90:69. doi: 10.1095/biolreprod.113.115071. [DOI] [PubMed] [Google Scholar]
  23. Lee KB, Zhang K, Folger JK, Knott JG, Smith GW. Evidence Supporting a Functional Requirement of SMAD4 for Bovine Preimplantation Embryonic Development: A Potential Link to Embryotropic Actions of Follistatin. Biol Reprod. 2014c doi: 10.1095/biolreprod.114.120105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lequarre AS, Traverso JM, Marchandise J, Donnay I. Poly(A) RNA is reduced by half during bovine oocyte maturation but increases when meiotic arrest is maintained with CDK inhibitors. Biol Reprod. 2004;71:425–431. doi: 10.1095/biolreprod.103.026724. [DOI] [PubMed] [Google Scholar]
  25. Liang L, Soyal SM, Dean J. FIGalpha, a germ cell specific transcription factor involved in the coordinate expression of the zona pellucida genes. Development. 1997;124:4939–4947. doi: 10.1242/dev.124.24.4939. [DOI] [PubMed] [Google Scholar]
  26. Littlewood TD, Evan GI. Helix-loop-helix transcription factors. Oxford: Oxford University Press; 1998. [Google Scholar]
  27. McMurray HR, McCance DJ. Human papillomavirus type 16 E6 activates TERT gene transcription through induction of c-Myc and release of USF-mediated repression. J Virol. 2003;77:9852–9861. doi: 10.1128/JVI.77.18.9852-9861.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Memili E, Dominko T, First NL. Onset of transcription in bovine oocytes and preimplantation embryos. Mol Reprod Dev. 1998;51:36–41. doi: 10.1002/(SICI)1098-2795(199809)51:1<36::AID-MRD4>3.0.CO;2-X. [DOI] [PubMed] [Google Scholar]
  29. Mottershead DG, Harrison CA, Mueller TD, Stanton PG, Gilchrist RB, McNatty KP. Growth differentiation factor 9:bone morphogenetic protein 15 (GDF9:BMP15) synergism and protein heterodimerization. Proc Natl Acad Sci U S A. 2013;110:E2257. doi: 10.1073/pnas.1303459110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mottershead DG, Ritter LJ, Gilchrist RB. Signalling pathways mediating specific synergistic interactions between GDF9 and BMP15. Mol Hum Reprod. 2012;18:121–128. doi: 10.1093/molehr/gar056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Peng H, Chang B, Lu C, Su J, Wu Y, Lv P, Wang Y, Liu J, Zhang B, Quan F, Guo Z, Zhang Y. Nlrp2, a maternal effect gene required for early embryonic development in the mouse. PLoS One. 2012;7:e30344. doi: 10.1371/journal.pone.0030344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Peng J, Li Q, Wigglesworth K, Rangarajan A, Kattamuri C, Peterson RT, Eppig JJ, Thompson TB, Matzuk MM. Growth differentiation factor 9:bone morphogenetic protein 15 heterodimers are potent regulators of ovarian functions. Proc Natl Acad Sci U S A. 2013;110:E776–785. doi: 10.1073/pnas.1218020110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Rajkovic A, Pangas SA, Ballow D, Suzumori N, Matzuk MM. NOBOX deficiency disrupts early folliculogenesis and oocyte-specific gene expression. Science. 2004;305:1157–1159. doi: 10.1126/science.1099755. [DOI] [PubMed] [Google Scholar]
  34. Rajput SK, Lee K, Zhenhua G, Di L, Folger JK, Smith GW. Embryotropic actions of follistatin: paracrine and autocrine mediators of oocyte competence and embryo developmental progression. Reprod Fertil Dev. 2013;26:37–47. doi: 10.1071/RD13282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Roy B, Rajput S, Raghav S, Kumar P, Verma A, Jain A, Jain T, Singh D, De S, Goswami SL, Datta TK. Characterization of oocyte-expressed GDF9 gene in buffalo and mapping of its TSS and putative regulatory elements. Zygote. 2013;21:115–124. doi: 10.1017/S0967199411000712. [DOI] [PubMed] [Google Scholar]
  36. Saeki H, Ohsumi K, Aihara H, Ito T, Hirose S, Ura K, Kaneda Y. Linker histone variants control chromatin dynamics during early embryogenesis. Proc Natl Acad Sci U S A. 2005;102:5697–5702. doi: 10.1073/pnas.0409824102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Soyal SM, Amleh A, Dean J. FIGalpha, a germ cell-specific transcription factor required for ovarian follicle formation. Development. 2000;127:4645–4654. doi: 10.1242/dev.127.21.4645. [DOI] [PubMed] [Google Scholar]
  38. Sylvestre EL, Robert C, Pennetier S, Labrecque R, Gilbert I, Dufort I, Leveille MC, Sirard MA. Evolutionary conservation of the oocyte transcriptome among vertebrates and its implications for understanding human reproductive function. Mol Hum Reprod. 2013;19:369–379. doi: 10.1093/molehr/gat006. [DOI] [PubMed] [Google Scholar]
  39. Tadros W, Lipshitz HD. The maternal-to-zygotic transition: a play in two acts. Development. 2009;136:3033–3042. doi: 10.1242/dev.033183. [DOI] [PubMed] [Google Scholar]
  40. Takezawa Y, Yoshida K, Miyado K, Sato M, Nakamura A, Kawano N, Sakakibara K, Kondo T, Harada Y, Ohnami N, Kanai S, Miyado M, Saito H, Takahashi Y, Akutsu H, Umezawa A. beta-catenin is a molecular switch that regulates transition of cell-cell adhesion to fusion. Sci Rep. 2011;1:68. doi: 10.1038/srep00068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tanaka M, Hennebold JD, Macfarlane J, Adashi EY. A mammalian oocyte-specific linker histone gene H1oo: homology with the genes for the oocyte-specific cleavage stage histone (cs-H1) of sea urchin and the B4/H1M histone of the frog. Development. 2001;128:655–664. doi: 10.1242/dev.128.5.655. [DOI] [PubMed] [Google Scholar]
  42. Thomsen S, Anders S, Janga SC, Huber W, Alonso CR. Genome-wide analysis of mRNA decay patterns during early Drosophila development. Genome Biol. 2010;11:R93. doi: 10.1186/gb-2010-11-9-r93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tomek W, Torner H, Kanitz W. Comparative analysis of protein synthesis, transcription and cytoplasmic polyadenylation of mRNA during maturation of bovine oocytes in vitro. Reprod Domest Anim. 2002;37:86–91. doi: 10.1046/j.1439-0531.2002.00336.x. [DOI] [PubMed] [Google Scholar]
  44. Tong ZB, Gold L, Pfeifer KE, Dorward H, Lee E, Bondy CA, Dean J, Nelson LM. Mater, a maternal effect gene required for early embryonic development in mice. Nat Genet. 2000;26:267–268. doi: 10.1038/81547. [DOI] [PubMed] [Google Scholar]
  45. Tripurani SK, Lee KB, Wang L, Wee G, Smith GW, Lee YS, Latham KE, Yao J. A novel functional role for the oocyte-specific transcription factor newborn ovary homeobox (NOBOX) during early embryonic development in cattle. Endocrinology. 2011;152:1013–1023. doi: 10.1210/en.2010-1134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tsunemoto K, Anzai M, Matsuoka T, Tokoro M, Shin SW, Amano T, Mitani T, Kato H, Hosoi Y, Saeki K, Iritani A, Matsumoto K. Cis-acting elements (E-box and NBE) in the promoter region of three maternal genes (Histone H1oo, Nucleoplasmin 2, and Zygote Arrest 1) are required for oocyte-specific gene expression in the mouse. Mol Reprod Dev. 2008;75:1104–1108. doi: 10.1002/mrd.20863. [DOI] [PubMed] [Google Scholar]
  47. van Deursen D, Jansen H, Verhoeven AJ. Glucose increases hepatic lipase expression in HepG2 liver cells through upregulation of upstream stimulatory factors 1 and 2. Diabetologia. 2008;51:2078–2087. doi: 10.1007/s00125-008-1125-6. [DOI] [PubMed] [Google Scholar]
  48. Viswanathan P, Wood MA, Walker WH. Follicle-stimulating hormone (FSH) transiently blocks FSH receptor transcription by increasing inhibitor of deoxyribonucleic acid binding/differentiation-2 and decreasing upstream stimulatory factor expression in rat Sertoli cells. Endocrinology. 2009;150:3783–3791. doi: 10.1210/en.2008-1261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wu X, Viveiros MM, Eppig JJ, Bai Y, Fitzpatrick SL, Matzuk MM. Zygote arrest 1 (Zar1) is a novel maternal-effect gene critical for the oocyte-to-embryo transition. Nat Genet. 2003;33:187–191. doi: 10.1038/ng1079. [DOI] [PubMed] [Google Scholar]
  50. Xue G, Hemmings BA. Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease. Biochem Soc Trans. 2012;40:90–93. doi: 10.1042/BST20110678. [DOI] [PubMed] [Google Scholar]
  51. Yan C, Elvin JA, Lin YN, Hadsell LA, Wang J, DeMayo FJ, Matzuk MM. Regulation of growth differentiation factor 9 expression in oocytes in vivo: a key role of the E-box. Biol Reprod. 2006;74:999–1006. doi: 10.1095/biolreprod.105.050013. [DOI] [PubMed] [Google Scholar]
  52. Zhang L, Handel MV, Schartner JM, Hagar A, Allen G, Curet M, Badie B. Regulation of IL-10 expression by upstream stimulating factor (USF-1) in glioma-associated microglia. J Neuroimmunol. 2007;184:188–197. doi: 10.1016/j.jneuroim.2006.12.006. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS641870-supplement-1.docx (14.2KB, docx)

RESOURCES