Northern blot

5. Purpose

To measure the size and amount of RNA transcribe from a specific gene of interest.

6. Theory

Northern blot first uses denaturing gel to separate RNA according to the size. The RNA is then transferred to a nylon membrane while keeping the same distribution in the gel. After fixing the RNA to the membrane, labeled probe complementary to the gene of interest is then added to hybridize to the immobilized RNA. The nonspecifically bound probes are then washed away. The solid membrane with probe specifically bound to RNA of interest is then dried, exposed and analyzed. Since northern blot uses size-dependent separation, this technique can not only determine the abundance but also the sizes of transcript of interest. It can be a very effective way to detect transcript variants of genes. However, if the amount of total RNA for the experiment is limited and expression level of transcript of interest is low, other techniques more sensitive than northern blot, such as quantitative RT-PCR, can be used.

7. Equipment

• Agarose gel rig

• Power supply

• Microwave

• Centrifuge

• PCR machine

• Heating block

• Vacuum gel transfer system

• Nylon membrane

• UV crosslinker

• Hybridization oven

• Hybridization bottles

• G-50 sephadex spincolumn

• Scintillation vial

• Scintillation counter

• Forceps

• Pipetor tips

• 1.5 ml polypropylene tubes

• Phosphor screen

• Phosphor screen scanning equipment

• ImageQuant software (Molecular Dynamics)

8. Materials

‘Editor’s note’: The Materials section comprises two parts. The first part is a comprehensive list of chemicals and reagents needed for the experiment.

Example:

• Agarose

• MOPS

• Sodium acetate

• Ethylenediaminetetraacetic acid disodium salt dihydrate

• NaOH

• HCl

• Formaldehyde

• Glycerol

• Ethidium bromide

• Bromophenol blue

• Xylene cyanol

• Orange G

• Formamide

• Millennium RNA ladder (Ambion)

• MgCl₂

• NTPs: ATP, CTP, GTP, UTP

• [α-P³²]-UTP

• Salmon sperm DNA

• NaCl

• Sodium Citrate

• Ficoll 400

• Polyvinylpyrrolidone

• Bovine Serum Albumin

• SDS

• Sodium heparin

• NaH₂PO₄

• Na₂HPO₄

• Tris-HCl (pH 8.0)

• DTT

• Triton X-100

• Spermidine, pH7.0

• Taq buffer

• Enzymes: T7 polymerase, Taq polymerase

Solutions & buffers

Step 1

• 10 ×MOPS buffer (Store at RT, protected from light)

  Component	Final concentration	Stock	Amount/liter
  MOPS	0.2 M	-	41.852 g
  Sodium acetate •3H2O	80 mM	-	10.89 g
  EDTA	10 mM	-	0.372 g

  Adjust pH to 7.0 with NaOH. Add water to 1 liter

• Denaturing RNA gel

  Component	Final concentration	Stock	Amount/150 ml
  MOPS buffer	1 ×	10 ×	15 ml
  Agarose	1.2% (w/v)	-	1.8 g
  H2O			132ml

  Microwave 3~4 min to dissolve agarose; cool to be able to hold; add formaldehyde 2.8 ml.

• Running buffer

  Component	Final concentration	Stock	Amount/liter
  MOPS buffer	1×	10 ×	100 ml
  formaldehyde	7%	37%	19

  Add water to 1 liter

• 2× RNA loading buffer

  Component	Final concentration	Stock	Amount/10ml
  MOPS buffer	1×	10 ×	1 ml
  glycerol	20%	100%	2 ml
  formaldehyde	6.5%	37%	1.76 ml
  Formamide	50%	100%	5 ml
  Ethidium Bromide	10 μg/ml	-	100 μg
  Bromophenol blue	0.05% (w/v)	-	5 mg
  Xylene cyanol	0.05% (w/v)	-	5 mg

  Add water to 10 ml

Step 2

• 20× SSC buffer

  Component	Final concentration	Stock	Amount/liter
  NaCl	3 M	-	175.3 g
  Sodium Citrate	300 mM	-	88.2 g

  Adjust pH to 7.0 with HCl, Add water to 1 L.

• 10× SSC buffer

• 500 ml 20× SSC buffer, add H₂O to 1 L.

Step 3

• 10× Transcription buffer

  Component	Final concentration	Stock	Amount/10ml
  Tris-HCl, pH8.0	400 mM	1 M	4 ml
  DTT	50 mM	1 M	0.5 ml
  Triton X-100	1% (v/v)	10%	1 ml
  Spermidine, pH 7.0	20 mM	500 mM	0.4 ml
  MgCl2	200 mM	1 M	2 ml

  Add water to 10 ml

• Sodium phosphate buffer, pH 8.0 (100 mM)

  Component	Stock	Amount/liter
  NaH2PO4	0.2 M	473.5 ml
  Na2HPO4	0.2 M	26.5 ml

  Add water to 1 liter

• Denhardt’s Solution 100×

  Component	Final concentration	Stock	Amount/500ml
  Ficoll 400	0.02 g/ml	-	10 g
  Polyvinylpyrrolidone	0.02 g/ml	-	10 g
  Bovine serum albumin	0.02 g/ml	-	10 g

  Add water to 500 ml

• Hybridization buffer

  Component	Final concentration	Stock	Amount/250ml
  Formamide	50%	100%	125 ml
  SSC	3×	20×	37.5 ml
  Denhardt’s Solution	10×	100×	25 ml
  Sodium phosphate buffer, pH 8.0	10 mM	100 mM	25 ml
  EDTA	2 mM	500 mM	1 ml
  SDS	0.1%	10%	2.5 ml
  Salmon sperm DNA	200 μg/ml	5 mg/ml	10 ml
  Sodium heparin	400 U/ml	5,000 U/ml	20 ml

  Add water to 500ml.

• Low stringency wash buffer

  Component	Final concentration	Stock	Amount/liter
  SSC	2×	20×	100 ml
  SDS	0.1%	10%	10 ml

  Add water to 1 L.

• High stringency wash buffer

  Component	Final concentration	Stock	Amount/liter
  SSC	0.1×	20×	50 ml
  SDS	0.1%	10%	10 ml

  Add water to 1 L.

9. Protocol

Duration

Preparation	about 1 day
Protocol	about 2 days

Preparation

Make all the buffers and autoclave or filter sterilize them.

Generate template by PCR for making probes complementary to sequence of interest. If RNA probe is needed, template used should have a T7 promoter sequence (TAATACGACTCACTATAGGG)

Caution

RNase-free conditions are important to maintaining the integrity of RNA. Disposable gloves should be worn at all times and changed frequently. All reagents should be autoclaved or filter-sterilized. Consult your institute Radiation Safety Officer for proper ordering, handling, and disposal of radioactive materials.

Step 1 Separate RNA by a denaturing gel

Overview	Use denaturing agarose gel with formaldehyde to separate RNA based on the size.
Duration	5 hrs
1.1	Assemble agarose gel rigs and make denaturing RNA gel solution.
1.2	Pour the RNA gel in hood
1.3	After gel solidify, equilibrate gel with running buffer for at least 30 min before running.
1.4	Mix 15 μg RNA sample with equal volume of 2× RNA loading buffer. Dilute 3 μg Millennium RNA Markers in same volume of 2× RNA loading buffer. Incubate @ 65 °C in the heating blocking for 12~15 min and put samples on ice immediately afterwards.
1.5	Load all the samples to equilibrated gel and leave space between first sample and RNA marker.
1.6	Run gel at 125 V for about 3 hrs
Tip	All the sample volume should not exceed the well volume of the gel comb. If RNA sample is too diluted, salt precipitate the RNA and resuspend with less H2O.

Step 2 Transfer RNA from gel to nylon membrane

Overview	RNA is transferred from gel to nylon membrane using vacuum gel transfer system.
Duration	2 hrs
2.1	Cut a nylon membrane about (or bigger than) the size of the denaturing RNA gel. Cut a filter paper with the same size as the nylon membrane.
2.2	Rinse the RNA gel with H2O.
2.3	Fill the wells of the RNA gel with melted agarose.
2.4	Wet the nylon membrane and filter paper first in H2O and then 10× SSC buffer
2.5	Put wet filter paper on the vacuum porous stage and make sure the filter paper is in the area where the cut window of the green plastic gasket is going to be. Place the wetted nylon membrane on top of the filter paper. Make sure there is no air bubble between membrane and filter.
2.6	Wet the seal o-ring on the base unit with H2O. Place the plastic gasket on top of the membrane/filter paper. Make sure the gasket covers the seal o-ring while the membrane/filter paper overlaps with the window of the gasket.
2.7	Gently place the gel on top of the gasket with the well-side up. Also make sure the gel overlaps with the gasket by at least 5 mm. Remove all the air bubbles between gel and the nylon membrane.
2.8	Place the sealing frame on top of the vacuum stage and lock it.
2.9	Start the vacuum source and adjust the pressure to 5 inches of Hg. Press the gel and along the window gently to apply extra pressure to help the vacuum sealing.
2.10	Gently pour 1 L of 10× SSC buffer into the reservoir. Place the lid on and transfer for 90 mins at 5 inches of Hg. Occasionally check the buffer level to make sure it is above the gel.
2.11	When the transfer is over, remove the sealing frame and drain the buffer. Remove the gel and take out the nylon membrane. Dry the nylon membrane between two sheets of filter paper.
2.12	UV crosslink the membrane twice to fix the RNA on the membrane and use a fine marker to mark the edge of the side with RNA.
2.13	Clean the gel transfer system thoroughly by rinsing with plenty of H2O.
Tip	After the gel transfer, the gel area inside the window of green gasket should be half as thick as the gel outside the window.
Tip	Gel can be illuminated with UV to check whether there is any remaining RNA.

Step 3 Hybridization

Overview	use in vitro T7 transcription to make radioactively labeled RNA probes complementary to RNA transcript of interest. The probes are then hybridized to the membrane. Nonspecifically bound probes are washed away after hybridization.
Duration	18hrs
3.1	Put cross-linked nylon membrane in the hybridization bottle with the RNA-side up.
3.2	Add 10 ml hybridization buffer (for small hybridization bottle) to the membrane. Incubate at 68 °C for 1hr to pre-hybridize.
3.3	During pre-hybridization, start the probe transcription reaction. For a 20 μl gene probe transcription reaction, combine 10–50 pmoles DNA template, 2 μl 10× transcription buffer, 1 μl 10mM ATP, 1 μl 10 mM GTP, 1 μl 10 mM CTP, 5 μl 12.5 mM [α-P32]-UTP and T7 polymerase (20 U/μl final) in a PCR tube.
3.4	For a 20 μl transcription reaction for Millennium Marker probe, combine 1 μg DNA template, 2 μl 10× transcription buffer, 1 μl 10mM ATP, 1 μl 10 mM GTP, 1 μl 10 mM CTP, 1 μl 10 mM UTP, 2 μl 12.5 mM [α-P32]-UTP and T7 polymerase (20 U/μl final) in a PCR tube.
3.5	Incubate at 37 °C for 2 hours.
3.6	Add 1 μl DNase I and incubate at 37 °C for 15 min to digest the template.
3.7	Snap off the bottom of micro G-50 sephadex spin column; open the cap by ¼ circle and put the column in a 1.75 ml tube. Spin at 700g for 1min. Put the column in a new 1.75 ml tube.
3.8	Load transcription reaction carefully on top of the G-50 column. Spin at 700g for 2 min.
3.9	Add 1 μl of G-50 column purified probe to 5 ml scintillation liquid and check the counts of the probes.
3.10	For gene probe, add 106 cpm/ml to fresh hybridization buffer; for marker probe, add 0.2 × 106 cpm/ml.
3.11	Dump the pre-hybridization solution and add hybridization buffer with probes to the hybridization bottle. Hybridize overnight at 68 °C over night.
3.12	Pre-warm both the low stringency and high stringency buffer at 68 °C.
3.13	Wash with low stringency for 5min twice.
3.14	Wash with high stringency for 15min twice.
3.15	Take out the membrane and brief dry it on kimwipe. Wrap the membrane with saran wrap and expose to a phosphor screen overnight.
Tip	If the gene probe is longer than 400 nt, increase the limiting nucleotide (UTP in this case) concentration to 5–25 μM by adding more non-labeled UTP in the transcription reaction.

11. TOPICS

‘Editor’s note’: Provide as many keywords as possible to this protocol using the table below as a guideline. Order the keywords based on importance. Not all protocols will necessarily have a keyword in each topic class.

Topic Class	Keyword
Methods List the methods used to carry out this protocol (i.e., for each step).	1 Denaturing agarose gel
	2 in vitro transcription
	3
	4
	5
Process List the biological process(es) addressed in this protocol.	1 RNA-RNA interaction
	2
	3
	4
	5
Organisms List the primary organism used in this protocol. List any other applicable organisms.	1
	2
	3
	4
	5
Pathways List any signaling, regulatory, or metabolic pathways addressed in this protocol.	1
	2
	3
	4
	5
Molecule role/function List any cellular or molecular functions or activities addressed in this protocol.	1
	2
	3
	4
	5
Phenotype List any developmental or functional phenotypes addressed in this protocol (organismal or cellular level).	1
	2
	3
	4
	5
Anatomy List any gross anatomical structures, cellular structures, organelles, or macromolecular complexes pertinent to this protocol.	1
	2
	3
	4
	5
Diseases List any diseases or disease processes addressed in this protocol.	1
	2
	3
	4
	5
Other List any other miscellaneous keywords that describe this protocol.	1
	2
	3
	4
	5

12. VIDEO

‘Editor’s note’: Indicate whether any protocol steps or sub-steps would be better illustrated by video (please also provide step or sub-step number e.g. Step 2 or sub-step 2.5).

13. IMAGES

It is ok to supply a copy of the figures as a reference within the manuscript in MS Word along with the list of legends. BUT LOW-RES IMAGES INSIDE A WORD DOC ARE NOT REPRO-QUALITY. All text and image files must be submitted via the website, http://emss.elsevier.com. Use the website to post individual files of good-quality images. Login credentials to the website and author guidelines will be provided by Elsevier.