Skip to main content
NCBI home page
Meta Gene logoLink to Meta Gene
. 2014 Jun 27;2:439–449. doi: 10.1016/j.mgene.2014.05.004

Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

Sonika Ahlawat 1,⁎, Rekha Sharma 1, A Maitra 1, Manoranjan Roy 1, MS Tantia 1
PMCID: PMC4287864  PMID: 25606428

Abstract

New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes.

Keywords: Tetra-primer ARMS-PCR, BMPR1B, GDF9, BMP15

Highlights

  • •

    Tetra-primer ARMS-PCR protocols were developed for genotyping of novel mutations in caprine Fec genes.

  • •

    The protocols were optimized and tested on 158 random samples of Black Bengal goat breed.

  • •

    The results were validated by direct DNA sequencing.

  • •

    Complete concordance was observed between the tetra-primer ARMS PCR assays and sequencing results.

Introduction

Growth factors synthesized from mammalian oocytes popularly known as oocyte secreted factors play numerous roles in ovarian folliculogenesis. In particular, a growing body of evidence in recent years has indicated that members of transforming growth factor-β superfamily genes and proteins are expressed in ovarian tissues (Ergin et al., 2008, Hatzirodos et al., 2011). Most notable members of TGFβ superfamily viz. Bone Morphogenetic Protein Receptor 1B (BMPR1B), Growth differentiation factor 9 (GDF9) and Bone Morphogenetic Protein 15 (BMP15) are intra-ovarian regulators of folliculogenesis in mammals. The identification of BMPR1B, GDF9 and BMP15 gene mutations (Table 1) as the causal mechanisms underlying either the highly prolific or infertile phenotypes of several sheep breeds in a dosage-sensitive manner highlighted the crucial role these genes play in ovarian function.

Table 1.

Genetic variants associated with prolificacy phenotype in sheep.

Gene Mutation Amino acid change Founder breed Reference
BMPR1B FecB Q249R Booroola Merino, Garole and Javanese Mulsant et al. (2001)
Souza et al. (2001)
Wilson et al. (2001)
BMP15 FecXI V299D Romney Galloway et al. (2000)
FecXH Q291ter Romney Galloway et al. (2000)
FecXB S367I Belclare Hanrahan et al. (2004)
FecXG Q239ter Belclare and Cambridge Hanrahan et al. (2004)
FecXL C321Y Lacaune Bodin et al. (2007)
FecXR 17 bp deletion Rasa Aragonesa Martinez-Royo et al. (2008)
Monteagudo et al. (2009)
GDF9 FecGH S395F Belclare and Cambridge Hanrahan et al. (2004)
FecGT S427R Icelandic Nicol et al. (2009)
FecGE F345C Santa Ineˆs Silva et al. (2011)
Open in a new tab

BMPR1B has been implicated as one of the type 1 receptors downstream of BMP15 in sheep, mouse and rat granulosa cells. The Booroola sheep mutation FecB is a Q249R mutation in the kinase domain of BMPR1B, thereby increasing the fertility of females (Wilson et al., 2001). BMPR1B null mice are infertile and have cumulus expansion defects (Yi et al., 2001). GDF9 and BMP15 act synergistically to affect development of the cumulus–oocyte complexes in mice (Yan et al., 2001). GDF9 plays critical roles in granulosa and theca cell growth as well as in differentiation and maturation of the oocyte (Hreinsson et al., 2002). BMP15 has also been thought to be involved in oocyte maturation and follicular development alone or along with GDF9. Both the proteins are progressively expressed by the oocytes of growing follicles throughout folliculogenesis (Dube et al., 1998, Laitinen et al., 1998).

In an attempt to screen Indian goats for prolificacy associated mutations in sheep, we have previously reported that none of the mutations in the candidate genes associated with fecundity in sheep was detected in Indian goats. Two novel SNPs T(-242)C and G(-623)A in the promoter region of BMPR1B gene (Ahlawat et al., 2014), three non-synonymous SNPs (C818T, A959C and G1189A) in exon 2 of GDF9 gene and two novel SNPs (G735A and C808G) in exon 2 of BMP15 gene were detected (Ahlawat et al., 2013). These novel polymorphisms need to be associated with prolificacy trait for identification of molecular markers that can be used to identify high prolific animals at an early stage of life using robust and less costly genotyping techniques. A plethora of methods for genotyping of specific polymorphic loci are currently used and these include Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP), Single Strand Conformation Polymorphism (SSCP), direct DNA sequencing, and tetra-Primer Amplification Refractory Mutation System-Polymerase Chain Reaction (ARMS-PCR). In developing countries it is very difficult and costly to genotype large number of animals by methods involving PCR and post-PCR manipulations. To circumvent these problems, simple, fast and cost effective genotyping methods need to be developed.

Amplification refractory mutation system (ARMS)-PCR, also referred to as allele-specific oligonucleotide PCR is a technique that was originally designed by Newton et al. (1989) for the detection of known sequence polymorphisms. In ARMS-PCR, 2 pairs of primers in a single PCR tube, can simultaneously amplify both mutant and normal alleles as well as allow amplification of an internal DNA control. This technique has been applied to study different mutations (Old et al., 1990, Vannucchi et al., 2006, Wanga et al., 2014). Ye et al. (1992) were the first to describe tetra-primer PCR in which allele-specific amplification is achieved in a single PCR reaction using two outer primers and two allele-specific inner primers. Ye et al. (2001) combined tetra-primer PCR with ARMS to form the tetra-primer ARMS-PCR or T-ARMS technique by introducing deliberate mismatches at position − 2 from the 3′ end of inner primers to improve allele specificity. In a single step reaction, the outer primers amplify a large fragment of the target gene, irrespective of its genotype although each inner primer combines with a particular opposite outer primer to generate smaller allele-specific amplicons, which are of different sizes and can easily be discriminated on gel electrophoresis either as homozygous or heterozygous. In the present study, we developed rapid, efficient, cost effective and allele specific tetra-primer ARMS PCR for genotyping T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15) mutations so that these methods can be used to genotype large animals of animals in order to estimate association of these mutations with the prolificacy trait in goats.

Materials and methods

Sample collection

Blood samples (158) from Black Bengal goat breed from Kotulpur goat cum fodder farm, Bankura, West Bengal were collected from the jugular vein into EDTA containing vacutainer tubes. Genomic DNA was isolated and purified from the blood cells using the standard phenol–chloroform–isoamyl alcohol extraction followed by ethanol precipitation (Sambrook and Russell, 2001). The quality and quantity of isolated DNA were determined using agarose gel electrophoresis (0.8%) and NanoDrop spectrophotometer (GE Healthcare). Purified DNA ran as a single band on agarose gel and the OD 260/280 ratio for all the samples was between 1.8 and 2 indicating good quality of extracted DNA. The DNA samples were dissolved in TE buffer (pH 8.0) and stored at − 20 °C until use.

Primer designing

Tetra-primer ARMS PCR was developed for genotyping T(-242)C, G1189A and G735A mutations in BMPR1B, GDF9 and BMP15 genes respectively. Primers were designed by the original software on the website: http://cedar.genetics.soton.ac.uk. The mutation points were positioned asymmetrically with respect to the common (outer) primers so that allele specific amplicons with different product lengths could be easily separated by standard agarose gel electrophoresis. ‘BLAST’ program at http://www.ncbi.nlm.nih.gov/blast was used to check for the specificity of the primers. The primers used in this study are listed in Table 2.

Table 2.

Sequence of primers used, product size and annealing temperature for T-ARMS PCR.

Gene Primer sequence Product size Annealing temp. °C
BMPR1B Forward inner primer: GTCAAATACAACTATTATAGCTTAAGGT
Reverse inner primer: TAAACCTTTCAGAGTAGTAGCTTATG
Forward outer primer: ATAATATTTACTCACAGTATTACATGCA
Reverse outer primer: AAATAGTAAGGATTTGTAACACTTAAAG		 Control fragment: 238 bp
T allele: 168 bp
C allele: 124 bp		 54
GDF9 Forward inner primer: TGCTTTTGTATCTGAACGACACAAGGGT
Reverse inner primer: GGAATGCCACCTGTGAAAAGCCTTAG
Forward outer primer: CCTCCCACAAGAGGAATATTCACATGTCT
Reverse outer primer: AACCAGAGGCTTCTTCAATTCAGAGCTG		 Control fragment: 323 bp
T allele: 207 bp
C allele: 170 bp		 68
BMP15 Forward inner primer: TTTCAATGACACTCAGAGTGTTCAGCAA
Reverse inner primer:TCAGGCCTTTAGGGAGAGGTTTGTTC
Forward outer primer: CTTGGACAGAGATGGATATCATGGAACA
Reverse outer primer: GTAGTTTGGGGTATAGAGATGGGGAGCA		 Control fragment: 425 bp
A allele: 257 bp
G allele: 216 bp		 67
Open in a new tab

PCR method

Gradient PCR was carried out on BIORAD iCycler to determine the best annealing temperature for each primer set. The optimal annealing temperatures for primers specific for − T242C (BMPR1B), C818T (GDF9) and G735A (BMP15) loci were 54, 68 and 67 °C respectively. For all sets of outer–inner primer pair, optimum concentration of MgCl2 producing the highest yield of specific PCR products was 2 mM. Outer–inner primer ratio for tetra-primer ARMS PCR was 1:1 for − T(242)C (BMPR1B) and 1:10 for C818T (GDF9) and G735A (BMP15) loci. Finally, optimized PCR was performed in a single tube containing 25 μl of reaction volume made up of the following components: 10 μl master mix, 50–100 ng of genomic DNA and optimized concentrations of each primer. PCR cycling was performed at 95 °C for 4 min followed by 32 cycles of denaturation at 95 °C for 30 s, annealing at specific temperature for 45 s, extension at 72 °C for 45 s and final extension at 72 °C for 8 min. The PCR products were separated by running on 3% agarose gel with DNA size marker of 50–1000 bp followed by staining with ethidium bromide and visualized and semi-automatically analyzed by the gel documentation system.

Validation of the assay

To evaluate the efficiency and accuracy of the assay, selected PCR-amplified DNA samples (n = 3, respectively, for each genotype) were examined by DNA sequencing and the results obtained by T-ARMS PCR were compared with those determined by sequencing.

Results

Three point mutations in important candidate genes for fecundity, one each in BMPR1B, GDF9 and BMP15 were genotyped by tetra-primer ARMS PCR based methodology. PCR fragments were generated as per expectations for all the loci. All the PCR products were well resolved and sized by agarose gel electrophoresis, allowing easy identification of different genotypes. Heterozygotes and homozygotes were unambiguously assigned from the gel profile. The size of DNA fragments amplified with these four primers for − T242C of BMPR1B (239 bp control fragment, 168 bp T allele, 125 bp C allele), C818T of GDF9 (323 bp control fragment, 207 bp T allele, 170 bp C allele) and G735A of BMP15 (425 bp control fragment, 222 bp G allele, 257 bp A allele) was suitable for separation on 3% agarose gels (Fig. 1, Fig. 2, Fig. 3). Several factors, including primer concentration and PCR cycling conditions, which can affect PCR specificity and efficiency were optimized. For all sets of outer–inner primer pairs we tested Mg2 + concentrations from 1.5 mM to 4 mM and best results were obtained at Mg2 + concentration of 2 mM for all the primer sets. Gradient PCR was carried out on the BIORAD iCycler to determine the best annealing temperature for each primer set (change per reaction was 1 °C) and optimum annealing temperatures were finalized to be 54, 68 and 67 °C for − T242C (BMPR1B), C818T (GDF9) and G735A (BMP15) loci.

Fig. 1.

Fig. 1

Open in a new tab

Agarose gel electrophoresis (3%) of polymerase chain reaction (PCR) product of tetra-primer ARMS-PCR for T(− 242)C locus of BMPR1B gene.

Fig. 2.

Fig. 2

Open in a new tab

Agarose gel electrophoresis (3%) of polymerase chain reaction (PCR) product of tetra-primer ARMS PCR for C818T locus of GDF9 gene.

Fig. 3.

Fig. 3

Open in a new tab

Agarose gel electrophoresis (3%) of polymerase chain reaction (PCR) product of tetra-primer ARMS PCR for G735A locus of BMP15 gene.

To improve the amplification efficiency of the shorter and allele-specific products, titration of primer concentrations is of paramount importance in tetra-primer ARMS PCR (Etlik et al., 2008, Okayama et al., 2004, Ye et al., 2001). In our study also, optimization of primer concentrations was the trickiest one, since the usually suggested outer–inner ratio (1:10) for tetra-primer ARMS PCR was not useful for one of the primer sets (− T242C, BMPR1B). Thus, we performed PCR with three more ratios (1:5, 1:2, 1:1) of outer–inner primers and 1:1 was found to give best results for − T(242)C (BMPR1B) and 1:10 for the other two loci. Validation of the developed methodology was done by direct sequencing of representative samples from each set using the outer primers for each SNP. We observed complete concordance between the methods. The genotypes scored from the assay were in 100% accordance with direct sequencing (Fig. 4, Fig. 5, Fig. 6).

Fig. 4.

Fig. 4

Open in a new tab

Genotypes for T(− 242)C mutation of BMPR1B gene.

Fig. 5.

Fig. 5

Open in a new tab

Genotypes for C818T mutation of GDF9 gene.

Fig. 6.

Fig. 6

Open in a new tab

Genotypes for G735A mutation of BMP15 gene.

Allele and genotype frequencies for the three SNPs in 158 animals of Black Bengal goats are given in Table 3. All the three possible genotypes were expressed for the three investigated loci. The predominant alleles were T, C and G for − T242C (BMPR1B), C818T (GDF9) and G735A (BMP15) mutations, respectively. Black Bengal goat population deviated from Hardy–Weinberg equilibrium (P < 0.05) with respect to all the three loci.

Table 3.

Allele and genotype frequencies for the SNPs in three Fec genes in Black Bengal goats (158).

Gene Mutation Genotypes Genotype frequency Allele frequency H-W test
BMPR1B T(− 242)C TT-139
TC-8
CC-11		 TT — 0.88
TC — 0.05
CC — 0.06		 T — 0.905
C — 0.095		 χ2 = 78.61⁎
P value = 0.0000
GDF9 C818T CC-94
CT-46
TT-18		 CC — 0.60
CT — 0.30
TT — 0.10		 C — 0.75
T — 0.25		 χ2 = 9.29⁎
P value = 0.0023
BMP15 G735A GG-70
GA-60
AA-28		 GG — 0.44
GA — 0.38
AA — 0.18		 G — 0.63
A — 0.37		 χ2 = 5.28⁎
P value = 0.0216
Open in a new tab
⁎

Allele frequency differs significantly at P < 0.05.

Discussion

Single nucleotide polymorphism (SNP), a novel molecular marker technology, refers to a sequence polymorphism caused by a single nucleotide mutation at a specific locus in the DNA sequence. This sort of polymorphism includes single base transitions, transversions, insertions and deletions (Lander, 1996), and the minor allele frequency should be 1% or greater (Vignal et al., 2002). Of all the SNP mutation types, transitions are the most common (approx. 66.6%) (Zhao and Boerwinkle, 2002). Currently, SNP markers are one of the preferred genotyping approaches, because they are abundant in the genome, genetically stable and amenable to high throughput automated analysis.

Variation in candidate genes for traits of economic importance in livestock species may be useful in guiding genetic selection for desirable traits and thus designing a genotyping protocol for the differentiation of polymorphic nucleotides is required for investigation of an animal population for which phenotypic data is available. The workers in the past have used techniques like Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP), Single Strand Conformation Polymorphism (SSCP), direct DNA sequencing, and tetra-primer Amplification Refractory Mutation System-Polymerase Chain Reaction (ARMS-PCR) for genotyping of specific polymorphic nucleotide loci. Among these the tetra-primer ARMS-PCR could be a useful tool for genotyping, since SSCP may not be repeatable some times, direct DNA sequencing is a cumbersome, time consuming, technically demanding and costly procedure and the possibility of getting a restriction site for an enzyme could be rare for genotyping by RFLP. In our study also PCR-RFLP protocol could be developed and standardized for SNP G(− 623)A in the promoter region of BMPR1B gene, two SNPs (A959C and G1189A) in exon 2 of GDF9 gene and one SNP (C808G) in exon 2 of BMP15 gene but no restriction enzyme site was identified for the three loci dealt with in the present study viz. T(− 242)C of BMPR1B, C818T of GDF9 and G735A of BMP15. For genetic analysis, fast and economical assays that can be performed with standard PCR instruments are highly desirable. Compared to other genotyping techniques, tetra-primer ARMS-PCR has been reported to be a rapid, reliable, simple and economical assay for SNP genotyping (Little, 2001, Okayama et al., 2004, Ye et al., 2001). Etlik et al., 2011 compared tetra-primer ARMS assay with routinely used methods such as typical PCR-RFLP analysis, real time PCR assay and DNA sequencing. They concluded that although real time PCR and DNA sequencing are sensitive and accurate techniques, tetra-primer ARMS PCR assay could be beneficial in terms of total time, cost and applicability in a typical laboratory.

Hence tetra-primer ARMS-PCR based methodology was developed for genotyping three mutations in Black Bengal goats in the present study. The assay described here is more convenient than the traditional PCR-RFLP since it eliminates the need for incubation with restriction enzymes. This not only avoids any consequent errors and artifacts from such procedures but also reduces the amount of DNA required for the digestion step in PCR-RFLP. No special equipment and only a small amount of standard PCR reagents are needed in tetra-primer ARMS-PCR.

Black Bengal goat is a prolific and major meat producing animal in eastern states of India (Zeshmarani et al., 2007). They kid twice a year or more commonly thrice in two years and the number of kids at one time varies from single to quadruplet (Zeshmarani et al., 2007). Twinning is more frequent (56.32%) and quadruplet is least frequent (2.11%) litter size (Hassan et al., 2007). The allele and genotype frequencies for the three SNPs showed significant differences among the population studied. If phenotypic data (litter size) is available for the investigated animals, an association between genotype and prolificacy can be conveniently established. SNPs are the most widely tested markers in association studies. These SNPs were tested for Hardy–Weinberg equilibrium (HWE) by comparing the observed genotype counts in Black Bengal goats with those expected under HWE. Since all the three loci deviated significantly from HWE it may indicate non-random mating and possibly population stratification, non-random genotyping error or missing genotype data so that one allele or genotype is more often misclassified or missing than the other. However, this may be due to the small sample size taken for the standardization of the technique. Thus there is a need to increase the population size in actual association studies to fulfill the assumptions for HWE, that there is random mating (with respect to that locus), no selection, no mutation, no gene flow and a population large enough to avoid the random effects of genetic drift.

The tetra-primer ARMS-PCR methods described above are the first reported methods allowing one to genotype three novel SNPs in goat Fec genes with no post-PCR treatment other than electrophoresis. These methods are rapid, simple, reliable, easy to perform, economical and require minimum level of expertise that can be used for both large- and small-scale genotyping studies.

Conclusion

With the rapid advances in molecular techniques, various methods for genotyping single-nucleotide polymorphisms (SNPs) are available. Still, the search for easy, robust, and less costly techniques continues. We wished to develop a tetra-primer Amplification Refractory Mutation System-Polymerase Chain Reaction based technique for genotyping the SNPs in Fec genes so that these methodologies could be used to establish association between the studied mutations and prolificacy trait, provided that the phenotypic data is available. Any such associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life.

Acknowledgment

We acknowledge the financial support provided by Network Project on Animal Genetic Resources (ICAR) for carrying out the work.

References

  1. Ahlawat S., Sharma R., Maitra A. Screening of indigenous goats for prolificacy associated DNA markers of sheep. Gene. 2013;517:128–131. doi: 10.1016/j.gene.2012.12.015. [DOI] [PubMed] [Google Scholar]
  2. Ahlawat S., Sharma R., Maitra A., Tantia M.S., Roy M., Mandakmale S. New genetic polymorphisms in Indian goat BMPR1B gene. Indian J. Anim. Sci. 2014;84(1):37–42. [Google Scholar]
  3. Bodin L., Di Pasquale E., Fabre S., Bontoux M., Monget P., Persani L., Mulsant P. A novel mutation in the bone morphogenetic protein 15 gene causing defective protein secretion is associated with both increased ovulation rate and sterility in Lacaune sheep. Endocrinology. 2007;148:393–400. doi: 10.1210/en.2006-0764. [DOI] [PubMed] [Google Scholar]
  4. Dube J.L., Wang P., Elvin J., Lyons K.M., Celeste A.J., Matzuk M.M. The bone morphogenetic protein-15 gene is X-linked and expressed in oocytes. Mol. Endocrinol. 1998;12:1809–1817. doi: 10.1210/mend.12.12.0206. [DOI] [PubMed] [Google Scholar]
  5. Ergin K., Gursoy E., Basimoglu K.Y., Basaloglu H., Seyrek K. Immunohistochemical detection of insulin-like growth factor-I, transforming growth factor-beta2, basic fibroblast growth factor and epidermal growth factor-receptor expression in developing rat ovary. Cytokine. 2008;43:209–214. doi: 10.1016/j.cyto.2008.05.013. [DOI] [PubMed] [Google Scholar]
  6. Etlik O., Koksal V., Arican-Baris S.T., Baris I. An improved tetra-primer PCR approach for the detection of the FGFR3 G380R mutation responsible for achondroplasia. Mol. Cell. Probes. 2008;22(2):71–75. doi: 10.1016/j.mcp.2007.06.002. [DOI] [PubMed] [Google Scholar]
  7. Etlik O., Koksal V., Arican-Baris S.T., Baris I. Development and validation of a cost-effective in-house method, tetra-primer ARMS PCR assay, in genotyping of seven clinically important point mutations. Mol. Cell. Probes. 2011;25:177–181. doi: 10.1016/j.mcp.2011.04.005. [DOI] [PubMed] [Google Scholar]
  8. Galloway S.M., McNatty K.P., Cambridge L.M., Laitinen M.P., Juengel J.L., Jokiranta T.S., McLaren R.J., Luiro K., Dodds K.G., Montgomery G.W., Beattie A.E., Davis G.H., Ritvos O. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat. Genet. 2000;25:279–283. doi: 10.1038/77033. [DOI] [PubMed] [Google Scholar]
  9. Hanrahan J.P., Gregan S.M., Mulsant P., Mullen M., Davis G.H., Powell R., Galloway S.M. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries) Biol. Reprod. 2004;70:900–909. doi: 10.1095/biolreprod.103.023093. [DOI] [PubMed] [Google Scholar]
  10. Hassan M.M., Niaz Mahmud S.M., Azizul Islam S.K.M., Faruk Miazi O. A comparative study on reproductive performance and productivity of the Black Bengal and crossbred goat at Atrai, Bangladesh. Univ. J. Zool. Rajshahi Univ. 2007;26:55–57. [Google Scholar]
  11. Hatzirodos N., Bayne R.A., Irving-Rodgers H.F., Hummitzsch K., Sabatier L., Lee S., Bonner W., Gibson M.A., Rainey W.E., Carr B.R., Mason H.D., Reinhardt D.P., Anderson R.A., Rodgers R.J. Linkage of regulators of TGF-beta activity in the fetal ovary to polycystic ovary syndrome. FASEB J. 2011;25:2256–2265. doi: 10.1096/fj.11-181099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hreinsson J., Scott J., Rasmussen C., Swahn M., Hsueh A., Hovatta O. Growth differentiation factor-9 promotes the growth, development, and survival of human ovarian follicles in organ culture. J. Clin. Endocrinol. Metab. 2002;87(1):316–321. doi: 10.1210/jcem.87.1.8185. [DOI] [PubMed] [Google Scholar]
  13. Laitinen M., Vuojolainen K., Jaatinen R., Ketola I., Aaltonen J., Lehtonen E., Heikinheimo M., Ritvos O. A novel growth differentiation factor-9 (GDF-9) related factor is co-expressed with GDF-9 in mouse oocytes during folliculogenesis. Mech. Dev. 1998;78:135–140. doi: 10.1016/s0925-4773(98)00161-0. [DOI] [PubMed] [Google Scholar]
  14. Lander E.S. The new genomics: global views of biology. Science. 1996;274:536–539. doi: 10.1126/science.274.5287.536. [DOI] [PubMed] [Google Scholar]
  15. Little S. Amplification-refractory mutation system (ARMS) analysis of point mutations. Curr. Protoc. Hum. Genet. 2001 doi: 10.1002/0471142905.hg0908s07. (Chapter 9: Unit 9.8) [DOI] [PubMed] [Google Scholar]
  16. Martinez-Royo A., Jurado J.J., Smulders J.P., Marti J.I., Alabart J.L., Roche A., Fantova E., Bodin L., Mulsant P., Serrano M., Folch J., Calvo J.H. A deletion in the bone morphogenetic protein 15 gene causes sterility and increased prolificacy in Rasa Aragonesa sheep. Anim. Genet. 2008;39:294–297. doi: 10.1111/j.1365-2052.2008.01707.x. [DOI] [PubMed] [Google Scholar]
  17. Monteagudo L.V., Ponz R., Tejedor M.T., Lavina A., Sierra I. A 17 bp deletion in the bone morphogenetic protein 15 (BMP15) gene is associated to increased prolificacy in the Rasa Aragonesa sheep breed. Anim. Reprod. Sci. 2009;110:139–146. doi: 10.1016/j.anireprosci.2008.01.005. [DOI] [PubMed] [Google Scholar]
  18. Mulsant P., Lecerf F., Fabre S., Schibler L., Monget P., Lanneluc I., Pisselet C., Riquet J., Monniaux D., Callebaut I., Cribiu E., Thimonier J., Teyssier J., Bodin L., Cognie Y., Chitour N., Elsen J.E. Mutation in bone morphogenetic protein receptor-IB is associated with increased ovulation rate in Booroola Merino ewes. Proc. Natl. Acad. Sci. U. S. A. 2001;98:5104–5109. doi: 10.1073/pnas.091577598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Newton C.R., Graham A., Heptinstall L.E., Powell S.J., Summers C., Kalsheker N., Smith J.C., Markham A.F. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS) Nucleic Acids Res. 1989;17:2503–2516. doi: 10.1093/nar/17.7.2503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Nicol L., Bishop S.C., Pong-Wong R., Bendixen C., Holm L.E., Rhind S.M., McNeilly A.S. Homozygosity for a single base-pair mutation in the oocyte-specific GDF9 gene results in sterility in Thoka sheep. Reproduction. 2009;138:921–933. doi: 10.1530/REP-09-0193. [DOI] [PubMed] [Google Scholar]
  21. Okayama N., Fujimura K., Nakamura J., Suehiro Y., Hamanaka Y., Hinoda Y. Evaluation of a new efficient procedure for single-nucleotide polymorphism genotyping: tetra-primer amplification refractory mutation system-polymerase chain reaction. Clin. Chem. Lab. Med. 2004;42:13–16. doi: 10.1515/CCLM.2004.004. [DOI] [PubMed] [Google Scholar]
  22. Old J.M., Varawalla N.Y., Weatherall D.J. Rapid detection and prenatal diagnosis of beta-thalassaemia: studies in Indian and Cypriot populations in the UK. Lancet. 1990;336(8719):834–837. doi: 10.1016/0140-6736(90)92338-i. [DOI] [PubMed] [Google Scholar]
  23. Sambrook J., Russell D.W. Cold Spring Laboratory Press; NY, Cold Spring Harbour: 2001. Molecular Cloning: A Laboratory Manuel III. [Google Scholar]
  24. Silva B.D., Castro E.A., Souza C.J., Paiva S.R., Sartori R., Franco M.M., Azevedo H.C., Silva T.A., Vieira A.M., Neves J.P., Melo E.O. A new polymorphism in the growth and differentiation factor 9 (GDF9) gene is associated with increased ovulation rate and prolificacy in homozygous sheep. Anim. Genet. 2011;42:89–92. doi: 10.1111/j.1365-2052.2010.02078.x. [DOI] [PubMed] [Google Scholar]
  25. Souza C.J., MacDougall C., Campbell B.K., McNeilly A.S., Baird D.T. The Booroola (FecB) phenotype is associated with a mutation in the bone morphogenetic receptor type 1 B (BMPR1B) gene. J. Endocrinol. 2001;169:R1–R6. doi: 10.1677/joe.0.169r001. [DOI] [PubMed] [Google Scholar]
  26. Vannucchi A.M., Pancrazzi A., Bogani C., Antonioli E., Guglielmelli P. A quantitative assay for JAK2 (V617F) mutation in myeloproliferative disorders by ARMS-PCR and capillary electrophoresis. Leukemia. 2006;20:1055–1060. doi: 10.1038/sj.leu.2404209. [DOI] [PubMed] [Google Scholar]
  27. Vignal A., Milan D., SanCristobal M. A review on SNP and other types of molecular markers and their use in animal genetics. Genet. Sel. Evol. 2002;34:275–305. doi: 10.1186/1297-9686-34-3-275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Wanga Y.Z., Zhua Z., Zhang H.Y., Zhu M.Z., Xu X., Chen C.H., Liu L.G. Detection of hepatitis B virus A1762T/G1764A mutant by amplification refractory mutation system. Braz. J. Infect. Dis. 2014;18(3):261–265. doi: 10.1016/j.bjid.2013.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wilson T., Wu X.Y., Juengel J.L., Ross I.K., Lumsden J.M., Lord E.A., Dodds K.G., Walling G.A., McEwan J.C., O'Connell A.R., McNatty K.P., Montgomery G.W. Highly prolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphogenetic protein IB receptor (ALK-6) that is expressed in both oocytes and granulosa cells. Biol. Reprod. 2001;64:1225–1235. doi: 10.1095/biolreprod64.4.1225. [DOI] [PubMed] [Google Scholar]
  30. Yan C., Wang P., DeMayo J., Elvin J.A., Carino C., Prasad S.V., Skinner S.S., Dunbar B.S., Dube J.L., Celeste A.J., Matzuk M.M. Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Mol. Endocrinol. 2001;15:854–866. doi: 10.1210/mend.15.6.0662. [DOI] [PubMed] [Google Scholar]
  31. Ye S., Humphries S., Green F. Allele specific amplification by tetra-primer PCR. Nucleic Acids Res. 1992;(20):1152. doi: 10.1093/nar/20.5.1152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ye S., Sahar D., Xiayi K., Andrew R.C., Day I.N.M. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 2001;29:88–94. doi: 10.1093/nar/29.17.e88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yi S.E., LaPolt P.S., Yoon B.S., Chen J.Y., Lu J.K., Lyons K.M. The type I BMP receptor BMPRIB is essential for female reproductive function. Proc. Natl. Acad. Sci. U. S. A. 2001;98:7994–7999. doi: 10.1073/pnas.141002798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zeshmarani S., Dhara K.C., Samanta A.K., Samanta R., Majumder S.C. Reproductive performance of goats in Eastern and North-eastern India. Livest. Res. Rural. Dev. 2007;19(8) [Google Scholar]
  35. Zhao Z.M., Boerwinkle E. Neighboring-nucleotide effects on single nucleotide polymorphisms: a study of 2.6 million polymorphisms across the human genome. Genome Res. 2002;12:1679–1686. doi: 10.1101/gr.287302. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Meta Gene are provided here courtesy of Elsevier

RESOURCES