Abstract
The California National Primate Research Center (CNPRC) maintains a small colony of titi monkeys (Callicebuscupreus) for behavioral studies. While short tandem repeat (STR) markers are critical for the genetic management of the center’s rhesus macaque (Macacamulatta) breeding colony, STRs are not used for this purpose in the maintenance of the center’s titi monkey colony. Consequently, the genetic structure of this titi monkey population has not been characterized. A lack of highly informative genetic markers in titi monkeys has also resulted in scant knowledge of the species’ genetic variation in the wild.
The purpose of this study was to develop a panel of highly polymorphic titi monkey STRs using a cross-species PCR amplification protocol that could be used for the genetic management of the titi monkey colony. We screened 16 STR primer pairs and selected those that generated robust and reproducible polymorphic amplicons. Loci that were found to be highly polymorphic, very likely to be useful for parentage verification, pedigree assessment, and for studying titi monkey population genetics, were validated using Hardy-Weinberg equilibrium and linkage disequilibrium analyses.
The genetic data generated in this study were also used to directly assess the impact of a recent adenovirus outbreak on the colony’s genetic diversity. While the adenovirus epizootic disease caused significant mortality (19 deaths among the 65 colony animals), our results suggest that the disease exhibited little or no influence on the overall genetic diversity of the colony.
Keywords: Genetic management, Population genetic structure, Captive populations, Closed colony, Paternity, Cross-species amplification, Red or coppery titi monkey
Introduction
Titi monkeys (Callicebus spp.) are small New World Monkeys (NWMs) that belong to a large, diverse genus of platyrrhines that are widely distributed in tropical regions in South America. They are long haired, brown colored and lack prehensile tails with adults of the species weighing about one kilogram (Hershkovitz 1988). Field studies of titi monkeys have focused on various aspects of their social organization and behavioral ecology. They are socially monogamous and live in groups typically consisting of an adult pair and one or two young (Valeggia et al. 1999). Laboratory studies have also broadened our knowledge of them by providing some insights into their mating and parenting behavior. Experimental findings with mating pairs of titis have shown that both sexes strongly prefer each other over strangers in choice tests even after the mates have been separated for days (Fernandez-Duque et al. 2000). Adult males exhibit parental behavior, which includes marked interaction with infants starting from the first few days of the infants’ lives (Valeggia et al. 1999; Mendoza and Mason 1986). Although much has been discovered about the social structure and behavior of titi monkeys, no study of their genetic relationships, including the confirmation of parentage via genetic tests, has been conducted in wild or captive titi monkeys.
Approximately 30 species of Callicebus are currently recognized, constituting a considerable proportion of total platyrrhine species richness (Gualda-Barros et al. 2012; Becker et al. 2013). The genus is one of the best examples of karyological diversity in NWMs because the diploid numbers among the 30 species range from 2n=16 to 2n=50 (Stanyon et al. 2003). Despite this karyological diversity, the genetic variability at the population level in titi monkeys is still poorly described relative to that of other species of NWMs. In addition to the importance of understanding evolutionary processes, knowledge of the genetic variability of any species is important for the analysis of population dynamics, including long-term viability in the context of factors such as inbreeding and genetic drift (Menescal et al. 2009).
In the wild, the coppery or red titi monkey (C. cupreus) is found in Brazil, Colombia, Ecuador, and Peru (Kinzey 1981; Hershkovitz 1990; van Roosmalen et al. 2002). According to van Roosmalen et al. (2002), C. cupreus and C. moloch groups are not only allopatric, but sympatric with C.torquatus groups. The Delta Regional Primate Center began the first significant breeding program for the C. cupreus in 1965 (Lorenz and Mason 1971). In 1971 the California National Primate Research Center (CNPRC) established a closed colony of 84C. cupreus individuals descended from founders of the Delta Regional Primate Center (Covington, Louisiana, USA) colony that was augmented by other introductions in 1990 (Lorenz and Mason 1971; Becker et al. 2013). The CNPRC titi monkeys are housed in small social groups (Mason 1966) and used in research primarily involving behavioral and neurobiological studies. Because differences in the genetic structure and composition of captive bred colonies influence their suitability in research, understanding these population genetic characteristics will support the development of appropriate animal models for research. Moreover, colony management employing sound genetic management approaches enhances the production of non-human primates (NHPs) for research within the National Primate Research Center system (Kanthaswamy et al. 2012).
This study was initiated to assess the genetic structure and diversity among the titi monkeys housed in the CNPRC using a panel of short tandem repeats (STRs) for cross-species PCR amplification. STR loci are suitable for population studies because of their abundance in eukaryotes and their highly polymorphic nature (Hughes and Queller 1993). STRs have been used to perform parentage analyses and to assess population genetic variability in many NHP populations (Moore et al. 1998; Rogers et al. 2005; Kanthaswamy et al. 2006) and are extremely useful in genetic management of captive primate colonies (Kanthaswamy et al. 2010; Kanthaswamy et al. 2012).
Cross-species amplification uses loci characterized in one species to genotype representatives of another, usually closely related, species. Because the identification of novel species-specific STR markers is time and labor intensive, cross-species amplification has been widely used in NHPs (Chambers et al. 2004). To minimize ascertainment bias that can lead to underestimates of some genetic parameters, such as genetic diversity, these polymorphic markers are typically selected amongst those identified in as closely a related species as possible. The titi monkey colony at the CNPRC is ideal for validating a panel of STRs developed using cross-species amplification, because their pedigrees have been categorized based on multigenerational colony records, and blood and DNA samples from members of these pedigrees which have been banked.
Using samples from the CNPRC’s titi monkey biomaterial repository, this study evaluated 16 candidate STR primer pairs (12 of which were originally identified in NWMs) that have been developed for PCR amplification and fragment analysis. Markers that exhibited Mendelian properties were used to compute allele frequencies as well as observed and expected heterozygosity. These data were then used to characterize the genetic structure of the colony.
Since the titi monkeys studied experienced a deadly outbreak of fulminant pneumonia and hepatitis that struck the CNPRC in May 2009 (Chen et al. 2011), we investigated the levels of genetic diversity, genetic structure, and inbreeding both prior to and after the viral epizootic disease. The outbreak, which lasted three months, was attributed to a novel adenovirus that infected 23 of 65 titi monkeys in the colony. Most of the animals that developed symptoms that progressed to fulminant pneumonia and hepatitis were random individuals that were housed in cages that were located close to those few that developed the acute respiratory illness earlier during the outbreak. Subsequently, 19 of the 23 affected animals died or were euthanized due to complications from infection (Chen et al. 2011). Because infectious diseases and their demographic consequences influence the genetic composition of populations, we used the genetic information from this study to determine the impact of the outbreak on the colony’s genetic diversity. While the loss of only between one-quarter and one-third of a population does not constitute a dramatic genetic bottleneck, the random sampling effects associated with such loss yields unpredictable effects on genetic diversity that require empirical documentation.
Methods
The 16 STRs described in Table 1 were screened and PCR amplification conditions were optimized using 50DNA samples from the CNPRC’s titi monkey biomaterial repository. These samples were obtained from animals that were housed at the CNPRC before (N = 49) and after (N = 39) the adenovirus outbreak in the colony. The STR loci were previously amplified in closely related species of NWMs including Alouattabelzebul (Goncalves et al. 2004; Menescal et al. 2009), Lagothrixlagotricha (Di Fiore and Fleischer 2004), Cebuscapucinus (Muniz and Vigilant 2008) and Aotusazarai (Babb et al. 2011), minimizing the effect of ascertainment bias. Screening and subsequent genotype analysis was performed at the Molecular Anthropology Laboratory, in the Department of Anthropology, at the University of California at Davis. Primers for potential STR markers underwent gradient tests to optimize annealing temperatures and MgSO4 concentrations and to assess success of amplification in titi monkeys.
Table 1.
The 16 STR loci that were screened in the present study.
| Reported Use in NHP Species | Type of repeat | Locus | Result | Annealing Temperature (°C) | Mg2+ Concentration (Mm) | Reference |
|---|---|---|---|---|---|---|
| Lagothrixlagotricha | Dinucleotide | 1110 | No amplification | N/A | N/A | Di Fiore et al. (2004) |
| Lagothrixlagotricha | Dinucleotide | 1115 | Polymorphic | 56.7 | 1.5 | Di Fiore et al. (2004) |
| Lagothrixlagotricha | Dinucleotide | 157 | Polymorphic | 56.7 | 2 | Di Fiore et al. (2004) |
| Lagothrixlagotricha | Trinucleotide | 311 | Dimorphic | 56.7 | 2.5 | Di Fiore et al. (2004) |
| Aotusazarai | Dinucleotide | D13s160 | Poor amplification | 57.8 | 2.5 | Babb et al. (2011) |
| Aotusazarai | Dinucleotide | D15s108 | No amplification | N/A | N/A | Babb et al. (2011) |
| Aotusazarai | Dinucleotide | D4s411 | Polymorphic | 56.7 | 2 | Babb et al. (2011) |
| Aotusazarai | Dinucleotide | D8s275 | Polymorphic | 56.7 | 2.5 | Babb et al. (2011) |
| Aotusazarai | Dinucleotide | PEPC3 | Poor amplification | 56.7 | 2 | Babb et al. (2011) |
| Aotusazarai | Dinucleotide | PEPC40 | No amplification | N/A | N/A | Babb et al. (2011) |
| Aotusazarai | Dinucleotide | PEPC59 | No amplification | N/A | N/A | Babb et al. (2011) |
| Aotusazarai | Dinucleotide | PEPC8 | Polymorphic | 56.7 | 2 | Babb et al. (2011) |
| Alouattabelzebul | Tetranucleotide | Ab13 | Poor amplification | 55.8 | 2.5 | Goncalves et al. (2004) |
| Cebuscapucinus | Tetranucleotide | Ceb19 | No amplification | N/A | N/A | Muniz et al. (2008) |
| Cebuscapucinus | Tetranucleotide | Ceb10 | Polymorphic | 60.4 | 2 | Muniz et al. (2008) |
| Cebuscapucinus | Tetranucleotide | Ceb130 | Polymorphic | 59.1 | 1.5 | Muniz et al. (2008) |
Primer pairs were prepared and tested at three different MgSO4 concentrations varying from 1.5mM to 2.5mM. Each reaction contained 1.25μl of 3ng/μltiti DNA and 11.25 μl of PCR primer cocktail containing the following: 0.25μldNTP (10mM), 1.25μl10x NH4PCR buffer (Bioline USA, Taunton, MA), 0.2mM of each forward and reverse primer (Integrated DNA Technologies, Inc., San Diego, CA), 0.024U Taqpolymerase (Invitrogen™ Platinum® Taq DNA Polymerase, Life Technologies, Grand Island, NY), MgSO4 (amount varied with desired salt concentration) and ddH2O. The PCR conditions for the gradient were as follows: 1 cycle at 94°C for 2 min, 40 cycles at 94°C for 30 seconds, annealing temperature gradient range of 55.0°C to 64.9°C for 30 seconds,72°C for 60 seconds, and a final extension at 72°C for 5 minutes. Two μl of PCR product was electrophoresed in a 2% agarose gel (40 mM Tris-acetate, 1.0 mM EDTA, pH 8.0) and visualized with ethidium bromide to evaluate the success of amplification.
STR alleles were genotyped using a genetic analyzer (model Applied Biosystems® 3130xL; Life Technologies) and the sizes determined through comparison with an internal size standard (Applied Biosystems® GeneScan™ 500 LIZ™; Life Technologies). All reactions were run with negative controls to monitor contamination. Only markers that generated robust, reliable, and reproducible amplicons were used in subsequent analyses.
The genotypes were examined for probable scoring errors due to stutter or large allele dropout and incidences of null alleles were examined using Micro-Checker version 2.2 (van Oosterhout et al. 2004). GENEPOP 4.2 was used to test for adherence to Hardy-Weinberg equilibrium (HWE) and to detect linkage disequilibrium (LD) among pairs of markers at the 0.05 level of probability using Fisher’s exact tests (Raymond and Rousset 1995). Unbiased P-values were generated by the Markov Chain Monte Carlo (MCMC) approach (Guo and Thompson 1992) with 5,000 iterations per batch. Banked DNA samples from seventeen known family trios (sire, dam and offspring) that were housed in the colony prior to the adenovirus outbreak were used to confirm Mendelian segregation of alleles across all STR loci.
Arlequin version 3.5.1.3 (Excoffier et al. 2005) was used to calculate genetic diversity among the study animals by calculating allele numbers (Na), and observed heterozygozity (OH) and estimating gene diversity (expected heterozygosity, EH). The same software was used to compute Wright’s (Wright 1978) F-statistics: FIS (inbreeding coefficient), FST (the total coancestry or population subdivision coefficient) and FIT (the total fixation coefficient). These parameters estimate the combined loss of heterozygosity due to non-random mating. In addition, an analysis of molecular variance (AMOVA) was conducted to estimate population differentiation.
A Fisher’s exact probability test using the Markov chain analysis (10,000 dememorizations; 10,000 iterations per batch, 1,000 batches) was carried out to establish if there were differences in genetic diversity between the titi monkeys that survived the Adenovirus outbreak of 2009 (Chen et al. 2011) and those that succumbed to it. Under a null hypothesis postulating significant allelic differentiation between the survivors (N = 36) and the dead (N =10), the homogeneity test was performed using GENEPOP 4.2 (Raymond and Rousset 1995). Because of the small samples compared to the level of genotypic variability (all individuals were genotypically unique), comparisons of allelic differentiation across loci used genic RXC tables rather than genotypic tables as recommended by Goudet et al. 1996 for a more robust analysis. Differences in genetic diversity between the surviving and deceased titi monkeys was also assessed using a one-sided Mann-Whitney U test.
Although it has been claimed that different species of titi monkeys can be distinguished based on differences in pelage, body color and pattern (Hershkovitz 1988), body length and weight C. cupreus and C. moloch exhibit significant phenotypic overlap making it difficult to differentiate the two species (Hershkovitz 1990). While earlier studies on the CNPRC titi colony reported that these individuals represent the species C. moloch (Valeggia et al. 1999), it is not known whether or not the founding stock of the titi colony at the CNPRC represents a diversity of species or subspecies. To determine if the allele frequencies and distributions are representative of two or more species or subspecies of titi monkeys, we used STRUCTURE 2.3.4 (Pritchard et al. 2000) to calculate the assignment index and determine the relative probabilities of assignment of an animal to K or more genetically discrete clusters based on that animal’s genotypes. The analysis was run at sweeps of 5 × 105 iterations after a burn-in period of 105 with and without a priori population information for K values from 1 to 5.K values were graphed with their respective posterior probability Ln P (D) and the K value with the highest Ln P (D) and smallest variance between runs was selected as the true K value.
In addition to determining parentage visually by match comparison, CERVUS 3.0 (Marshall et al. 1998; Kalinowski et al. 2007) was used to confirm assignments of parentage based on categorical allocation (Jones et al. 2010) to verify the parentage for the titi monkeys probabilistically. The natural logarithm of the likelihood-odds ratio (LOD) was calculated for parentage assignments involving every adult in the colony. An individual was assigned paternity or maternity if his or her likelihood was sufficiently higher than the second most likely adult male or female, respectively (Walling et al. 2010).
Results
Eight of the 16 loci screened amplified robustly and provided complete and reproducible genotype profiles for 49 of the 50 samples and yielded multiple alleles per locus. Of the 49 samples, 39 were from survivors of the outbreak. The eight STR loci were statistically unlinked and in HWE. Micro-Checker confirmed that these markers did not exhibit any null alleles. The primer sequences, repeat motif, and allele size ranges of each these eight STR markers are provided in Table 2.
Table 2.
Primer sequences, repeat motifs, allele size ranges, and estimates of observed (OH) and expected (EH) heteozygosity and allele numbers (Na) per locus.
| Name/Strand | Primer Sequence | Repeat Motif | Allele Range | OH | EH | Na |
|---|---|---|---|---|---|---|
| 1115F | GCTCATATTCATACATCCCTTGG | (GT)3(GA)1(GT)5 | 206–220 | 0.61 | 0.5 | 5 |
| 1115R | TTTGCTTGCTCATTCATTGC | |||||
| 157F | TGGCAAGTCTGGTTTCAAGC | (GA)4(GT)4(CT)1 | 204–230 | 0.98 | 0.83 | 8 |
| 157R | TTCCAGACTGAGCTAGGATGC | |||||
| 311F | CTTCCGAAAGCCATTTCTCC | (GAA)3(GAG)9 | 183–186 | 0.20 | 0.19 | 2 |
| 311R | TTAATGCCAGATGATTTTGG | |||||
| D4S411F | AGGCTGTCTTGGCAGAAAT | (TA)20 | 121–155 | 1 | 0.88 | 11 |
| D4S411R | GATGTAATCCTGTGCTATGGC | |||||
| D8S275F | AAATCGCTAGAAAATGTCCA | (TC)20 | 129–149 | 0.91 | 0.86 | 10 |
| D8S275R | TCACACCTGGGAATTAGAAG | |||||
| PEPC8F | TTCAGGATGCATCAAATGATT | (CT)16 | 251–259 | 0.68 | 0.75 | 5 |
| PEPC8R | TAGCAGTCTATTTAGGTGTTAAT | |||||
| Ceb10F | TTGCTGATGCTTGCCTTC | (AGAT)13 | 215–227 | 0.68 | 0.61 | 4 |
| Ceb10R | TGGCAGATTGTGGACTTCTC | |||||
| Ceb130F | CAAAGTCCACTCACTTAACCAC | (ATCT)9 | 225–253 | 0.82 | 0.78 | 6 |
| Ceb130R | AGAAGACCCTGCCTCAAG |
The allelic richness (Na), observed heterozygosity (OH), and gene diversity or expected heterozygosity (EH) for each of the eight loci are presented in Table 2. The alleles observed at each locus fell within variable size ranges. The eight markers exhibited an average of approximately six alleles per locus, an average observed heterozgosity (OH) of 0.735, with a range of 0.15 to 1.00, and an average estimate of expected heterozygosity (EH) of 0.67, ranging from 0.14 to 0.87. The OH estimates exceeded EH estimates for seven of the eight loci (Table 2).
The Fisher’s exact test using the Markov chain algorithm did not reveal any significant differences in allelic composition between the 36 surviving and the 10 deceased animals (P-value> 0.05; Table 3). Furthermore, based on a one-tailed Mann–Whitney U test where the critical value of U was computed to be 15 at P-value ≤ 0.05 and n1 and n2 = 8, respectively, there were no significant differences between measurements of Na (U-value = 29.0), OH (U-value = 31.0) or EH (U-value = 31.0) between the animals that survived the viral outbreak (N = 39) and those that died (N = 10) (Table 3). A match comparison of genotypes between 17 known family trios (offspring, dam and sire) revealed no deviations from Mendelian inheritance. Parentage based on colony breeding records was confirmed for 16 (94.12%) of the 17 offspring in this study. The highest trioLOD scores for these 16 cases ranged from0.584 to 12.443. All parentage assignments were additionally supported at the 95% confidence level by the maximum likelihood method calculated by CERVUS. The single exception that resulted in unresolved parentage was due to failed amplification of STRs in the sample of the offspring of one trio.
Table 3.
Genetic diversity estimates (Na, OH, and EH)of the titi monkey colony before (N = 49), and after (i.e., survivors) (N=39) the Adenovirus outbreak of 2009, and those succumbed to the disease (N= 10). *Genic differentiation (Fisher’s exact Probability test: Chi2= 2.7003, (df = 16) and unbiased P-value across all loci = 0.999917.
| Na | OH | EH | *Per locus P-value | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Locus | Before | Survivors | Dead | Mean | Before | Survivors | Dead | Mean | Before | Survivors | Dead | Mean | |
| 311 | 2 | 2 | 2 | 2 | 0.20 | 0.10 | 0.20 | 0.17 | 0.19 | 0.09 | 0.19 | 0.14 | 0.50 |
| 157 | 8 | 8 | 6 | 7.33 | 0.98 | 1.00 | 0.90 | 0.96 | 0.83 | 0.83 | 0.86 | 0.85 | 0.94 |
| 1115 | 5 | 4 | 5 | 4.67 | 0.61 | 0.62 | 0.70 | 0.64 | 0.54 | 0.53 | 0.57 | 0.55 | 0.90 |
| D4s411 | 10 | 10 | 8 | 9.33 | 1.00 | 1.00 | 1.00 | 1 | 0.88 | 0.89 | 0.91 | 0.90 | 0.10 |
| D8s275 | 10 | 9 | 8 | 9 | 0.91 | 0.86 | 1.00 | 0.92 | 0.86 | 0.87 | 0.88 | 0.88 | 0.10 |
| PEPC8 | 5 | 5 | 5 | 5 | 0.68 | 0.71 | 0.50 | 0.63 | 0.75 | 0.72 | 0.79 | 0.76 | 0.87 |
| CEB10 | 4 | 3 | 3 | 3.33 | 0.68 | 0.67 | 0.60 | 0.65 | 0.61 | 0.54 | 0.61 | 0.58 | 0.72 |
| CEB130 | 6 | 6 | 6 | 6 | 0.82 | 0.90 | 0.90 | 0.87 | 0.78 | 0.79 | 0.82 | 0.81 | 0.99 |
| Mean | 6.25 | 5.88 | 5.4 | 0.74 | 0.73 | 0.73 | 0.68 | 0.66 | 0.70 | ||||
| Std. dev. | 2.87 | 2.90 | 2.13 | 0.26 | 0.30 | 0.28 | 0.23 | 0.27 | 0.24 | ||||
Estimates of both FIS and FST were negative whether the sample set was divided into 1) titi monkey colony (N = 49) before and after (N = 39), or 2) animals living after the viral outbreak (N = 39) and those that perished (N = 10). Negative FIS estimates result when the number of observed heterozygotes (OH) exceeds expectation (Wright 1978), suggesting that the CNPRC titi colony is not highly inbred. As estimates of FST were also negative, the two pairs of groups that were compared are genetically homogeneous or undifferentiated.
AMOVA showed that the estimate of within group diversity is much larger than the estimate obtained from variance between groups (Table 4). In fact, the additional variance component due to variance among groups (i.e., the FST) is zero and all of the genetic variation (~100%) stemmed from differences between individual samples within each of the two data sets (Table 4). This is consistent with estimates of FST, confirming the absence of any influence of the viral outbreak on the genetic structure of the titi monkey population.
Table 4.
AMOVA analysis for the titi monkey colony before and after the Adenovirus outbreak of 2009. Results of the AMOVA analysis among those that survived and those that died are in parentheses.
| Source of Variation | Sum of squares | Variance component | Variance Percentage |
|---|---|---|---|
| Between populations | 0.70 (0.91) | −0.03 (−0.06) | −1.15 (−2.15) |
| Among individuals within populations | 153.14 (70.69) | −0.25 (−0.24) | −9.56 (−9.19) |
| Within individuals | 191.00 (90.50) | 2.94 (2.92) | 110.71 (111.34) |
| Total | 344.84 (162.08) | 2.65 (2.62) |
Results of the STRUCTURE analysis for K = 1 with no prior population information exhibited the highest posterior probability as well as the least variance compared to those for K = 2 (or greater). All individuals included in the analysis were assigned to a single cohesive and discrete genetic cluster (data not shown).
Discussion
The genetic structure of captive colonies of NHPs must be characterized and monitored to preserve genetic variability and minimize genetic subdivision (Kanthaswamy et al. 2006). The identification of parentage, which allows the construction of a pedigree and the estimation of levels of consanguinity within the small captive titi monkey colony, will facilitate maintenance of its genetic variation. The panel of eight STRs allowed us to accurately determine the sires and dams of all but three offspring born during each year since 1971 at the 95% confidence level. As such, the panel meets the standards for parentage testing for the genetic management of the titi monkey colony at the CNPRC. Mean heterozygosity estimates (OH and EH) for all but two markers, 311 and 1115, were at least comparable to those in other NWMs in which they were identified (Di Fiore and Fleischer 2004; Goncalves et al. 2004; Muniz and Vigilant 2008;Menescal et al. 2009; Babb et al. 2011), reflecting the absence of significant ascertainment bias. The mean estimates of OH and EH of the captive titi monkey population (0.74 and 0.70, respectively) were greater than those estimated for a sample set of 23 animals from a wild population of red-bellied titis (Callicebusmoloch) in eastern Amazonia (0.33 and 0.63, respectively) (Menescal et al. 2009). While the low level of genetic variability in the wild population could have been due to sampling error from the use of only four STR loci or the small size of the wild population, it is also plausible that breeding colony management has resulted in producing more heterozygotes by minimizing mating between relatives or the avoidance of inbreeding by the monkeys themselves that would be consistent with their negative FIS estimate. Greater variability among study animals, based on Na, OH, and EH estimates, has been observed in other species of captive NHPs such as rhesus and pigtail macaques compared to their wild counterparts (Kanthaswamy et al. 2010; Kanthaswamy et al. 2012). This difference is probably due, in part, to the acquisition of founders of captive colonies from multiple geographic sources.
Since emerging infectious agents remain a threat to laboratory-reared NHPs, it is important to study the effect that a specific zoonotic disease has on both genetic heterogeneity and colony health (Bailey and Mansfield 2010). A comparison of genetic diversity and genetic subdivision before and after the viral outbreak and between survivors and non-survivors of the viral outbreak revealed no significant differences, implying that no loss of variability occurred among the colony animals that could be directly attributed to the viral epizootic disease.
The estimates of F-statistics (FIS, FST, and FIT) for the captive titi monkey colony suggest that there are no significant deviations from panmixia (random mating). As colony breeding and pedigree records confirm, three incidences of mating between parents and offspring have occurred over a decade ago, not withstanding the negative FIS values. Given the small size of the colony and panmixia, more instances of consanguineous matings would be expected than were observed, suggesting that colony managers have become more effective in minimizing mating between relatives. Moreover, these animals represent a small closed colony in which mating between close relatives is generally avoided. The excess of heterozygosity responsible for the negative estimate of FIS is probably a result of the prevention of consanguineous matings by the colony managers and the avoidance of inbreeding by the colony animals themselves.
STRUCTURE failed to distinguish more than one genetic cluster among the animals that were tested, implying that there is a marked genetic homogeneity of C. cupreus monkeys without any evidence of inter species admixture or population structure (genetic subdivision). Therefore, based on the current data, no gene flow from C. moloch or C.torquatus is evident. However, without reference DNA samples from these three species, it is not possible to verify this observation. Lacking data to indicate otherwise, it must be assumed that all founders of the titi monkey colony represent the species C. cupreus.
It is worth noting that the present study is limited in scope, and it is necessary to increase both sample size and the number of loci to illustrate the advantages of such comparisons as those made in this study. Other studies have shown that cross-species amplification using common STR markers may pose a greater challenge than was previously appreciated (Smith et al. 2000; Chambers et al. 2004). In these other studies, cross-species amplification has proven to be successful for a majority of the markers tested, although the allele numbers and frequencies of some loci in the new population of interest are likely to be lower and contribute less statistical power to the analysis of the new species than to analyses of populations in which the loci were originally identified (Chambers et al. 2004). With the increasing efficiency of microsatellite discovery (Zane et al. 2002) and the lower success rate of cross-species amplification in New World primates (Ellsworth and Hoelzer 1998), it may be worthwhile to consider establishing species-specific primers for titi monkeys. However, the results of this study provide both a baseline to continue the investigation of this species and rationale for further exploring these and additional cross-species STRs for studying mating systems and population genetic structure in titi monkeys.
Acknowledgments
This study was supported by the California National Primate Research Center (CNPRC) base grant (OD000169-48), as well as grants from the Good Nature Institute to KB (HD053555 and HD071998). This research adhered to the American Society of Primatologists’ principles for the ethical treatment of primates. Animals used in this research were managed in compliance with Institutional Animal Care and Use Committee (IACUC) regulations or in accordance with the National Institutes of Health guidelines or the US Department of Agriculture regulations prescribing the humane care and use of laboratory animals. The University of California, Davis and the California National Primate Research Center are AAALAC-accredited. The authors are very grateful to the reviewers for their thorough and insightful comments which have considerably improved the manuscript.
References
- Babb PL, McIntosh AM, Fernandez-Duque E, Di Fiore A, Schurr TG. An optimized microsatellite genotyping strategy for assessing genetic identity and kinship in Azara’s owl monkeys (Aotus azarai) Folia Primatol. 2011;82:107–117. doi: 10.1159/000330564. [DOI] [PubMed] [Google Scholar]
- Bailey C, Mansfield K. Emerging and reemerging infectious diseases of nonhuman primates in the laboratory setting. Vet Pathol. 2010;47:462–481. doi: 10.1177/0300985810363719. [DOI] [PubMed] [Google Scholar]
- Becker J, Baker AJ, Frampton T, Pullen PK, Bales KL, Mendoza SP, Mason WA. Pitheciines in Captivity: Challenges and Opportunities, Past, Present and Future. In: Veiga LM, Barnett AA, Ferrari SF, Norconk MA, editors. Evolutionary Biology and Conservation of Titis, Sakis and Uacaris. Cambridge University Press; New York: 2013. pp. 344–349. [Google Scholar]
- Chambers KE, Reichard UH, Moller A, Nowak K, Vigilant L. Cross-species amplification of human microsatellite markers using noninvasive samples from white-handed gibbons (Hylobates lar) Am J Primatol. 2004;64:19–27. doi: 10.1002/ajp.20058. [DOI] [PubMed] [Google Scholar]
- Chen EC, Yagi S, Kelly KR, Mendoza SP, Tarara RP, Canfield DR, Maninger N, Rosenthal A, Spinner A, Bales KL, Schnurr DP, Lerche NW, Chiu CY. Cross-species transmission of a novel adenovirus associated with a fulminant pneumonia outbreak in a new world monkey colony. PLoS Pathog. 2011;7:e1002155. doi: 10.1371/journal.ppat.1002155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Di Fiore A, Fleischer RC. Microsatellite markers for woolly monkeys (Lagothrix lagotricha) and their amplification in other New World primates (Primates: Platyrrhini) Molecular Ecology Notes. 2004;4:246–249. doi: 10.1111/j.1471-8286.2004.00631.x. [DOI] [Google Scholar]
- Ellsworth JA, Hoelzer GA. Characterization of microsatellite loci in a New World primate, the mantled howler monkey (Alouatta palliata) Mol Ecol. 1998;7:657–658. doi: 10.1046/j.1365-294X.1998.00340.x. [DOI] [PubMed] [Google Scholar]
- Excoffier L, Laval G, Schneider S. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform Online. 2005;1:47–50. doi: 10.4137/ebo.s0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fernandez-Duque E, Valeggia CR, Mason WA. Effects of pair-bond and social context on male-female interactions in captive titi monkeys (Callicebus moloch, Primates: Cebidae) Ethology. 2000;106:1067–1082. doi: 10.1046/j.1439-0310.2000.00629.x. [DOI] [Google Scholar]
- Goncalves EC, Silva A, Barbosa MSR, Schneider MPC. Isolation and characterization of microsatellite loci in Amazonian red-handed howlers Alouatta belzebul (Primates, Plathyrrini) Molecular Ecology Notes. 2004;4:406–408. doi: 10.1111/j.1471-8286.2004.00667.x. [DOI] [Google Scholar]
- Goudet J, Raymond M, de Meeus T, Rousset F. Testing differentiation in diploid populations. Genetics. 1996;144:1931–1938. doi: 10.1093/genetics/144.4.1933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gualda-Barros J, Nascimento FOd, Amaral MKd. A new species of Callicebus Thomas, 1903 (Primates, Pitheciidae) from the states of Mato Grosso and Pará, Brazil. Papéis Avulsos de Zoologia (São Paulo) 2012;52:261–279. [Google Scholar]
- Guo SW, Thompson EA. Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics. 1992;48:361–372. doi: 10.2307/2532296. [DOI] [PubMed] [Google Scholar]
- Hershkovitz P. Origin, speciation, and distribution of South American titi monkeys, genus Callicebus (Family Cebidae, Platyrrhini) Proc Acad of Natl Sci Phila. 1988;140:240–272. doi: 10.2307/4064927. [DOI] [Google Scholar]
- Hershkovitz P. Titis, New World monkeys of the genus Callicebus (Cebidae, Platyrrhini): a preliminary taxonomic review. Fieldiana Zoology n.s. 1990:1–109. doi: 10.1002/ajp.1350120102. [DOI] [PubMed] [Google Scholar]
- Hughes CR, Queller DC. Detection of highly polymorphic microsatellite loci in a species with little allozyme polymorphism. Mol Ecol. 1993;2:131–137. doi: 10.1111/j.1365-294X.1993.tb00102.x. [DOI] [PubMed] [Google Scholar]
- Jones AG, Small CM, Paczolt KA, Ratterman NL. A practical guide to methods of parentage analysis. Mol Ecol Resour. 2010;10:6–30. doi: 10.1111/j.1755-0998.2009.02778.x. [DOI] [PubMed] [Google Scholar]
- Kalinowski ST, Taper ML, Marshall TC. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol. 2007;16:1099–1106. doi: 10.1111/j.1365-294X.2007.03089.x. [DOI] [PubMed] [Google Scholar]
- Kanthaswamy S, Ng J, Penedo MC, Ward T, Smith DG, Ha JC. Population genetics of the Washington National Primate Research Center’s (WaNPRC) captive pigtailed macaque (Macaca nemestrina) population. Am J Primatol. 2012;74:1017–1027. doi: 10.1002/ajp.22055. [DOI] [PubMed] [Google Scholar]
- Kanthaswamy S, Satkoski J, Kou A, Malladi V, Smith DG. Detecting signatures of inter-regional and inter-specific hybridization among the Chinese rhesus macaque specific pathogen-free (SPF) population using single nucleotide polymorphic (SNP) markers. J Med Primatol. 2010;39:252–265. doi: 10.1111/j.1600-0684.2010.00430.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kanthaswamy S, von Dollen A, Kurushima JD, Alminas O, Rogers J, Ferguson B, Lerche NW, Allen PC, Smith DG. Microsatellite markers for standardized genetic management of captive colonies of rhesus macaques (Macaca mulatta) Am J Primatol. 2006;68:73–95. doi: 10.1002/ajp.20207. [DOI] [PubMed] [Google Scholar]
- Kinzey WG. The Titi Monkeys, Genus Callicebus. In: Coimbra-Filho AF, Mittermeier RA, editors. Ecology and Behavior of Neotropical Primates. Vol. 1. Academia Brasileira de Ciencias; Rio de Janeiro: 1981. pp. 241–276. [Google Scholar]
- Lorenz R, Mason WA. Establishment of a colony of Titi monkeys. International Zoo Yearbook. 1971;11:168–174. doi: 10.1111/j.1748-1090.1971.tb01896.x. [DOI] [Google Scholar]
- Marshall TC, Slate J, Kruuk LE, Pemberton JM. Statistical confidence for likelihood-based paternity inference in natural populations. Mol Ecol. 1998;7:639–655. doi: 10.1046/j.1365-294x.1998.00374.x. [DOI] [PubMed] [Google Scholar]
- Mason WA. Social organization of the South Ameican monkey, Callicebus moloch: a preliminary report. Tulane studies in zoology. 1966;13:23–28. [Google Scholar]
- Mendoza SP, Mason WA. Contrasting responses to intruders and to involuntary separation by monogamous and polygynous New World monkeys. Physiol Behav. 1986;38:795–801. doi: 10.1016/0031-9384(86)90045-4. [DOI] [PubMed] [Google Scholar]
- Menescal LA, Goncalves EC, Silva A, Ferrari SF, Schneider MP. Genetic diversity of red-bellied Titis (Callicebus moloch) from Eastern Amazonia based on microsatellite markers. Biochem Genet. 2009;47:235–240. doi: 10.1007/s10528-008-9220-4. [DOI] [PubMed] [Google Scholar]
- Moore CM, Leland MM, Brzyski RG, McKeand J, Witte SM, Rogers J. A baboon (Papio hamadryas) with an isochromosome for the long arm of the X. Cytogenet Cell Genet. 1998;82:80–82. doi: 10.1159/000015069. [DOI] [PubMed] [Google Scholar]
- Muniz L, Vigilant L. Permanent genetic resources: Isolation and characterization of microsatellite markers in the white-faced capuchin monkey (Cebus capucinus) and cross-species amplification in other New World monkeys. Mol Ecol Resour. 2008;8:402–405. doi: 10.1111/j.1471-8286.2007.01971.x. [DOI] [PubMed] [Google Scholar]
- Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155:945–959. doi: 10.1093/genetics/155.2.945. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Raymond M, Rousset F. GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. J Hered. 1995;86:248–249. [Google Scholar]
- Rogers J, Bergstrom M, Garcia Rt, Kaplan J, Arya A, Novakowski L, Johnson Z, Vinson A, Shelledy W. A panel of 20 highly variable microsatellite polymorphisms in rhesus macaques (Macaca mulatta) selected for pedigree or population genetic analysis. Am J Primatol. 2005;67:377–383. doi: 10.1002/ajp.20192. [DOI] [PubMed] [Google Scholar]
- Smith KL, Alberts SC, Bayes MK, Bruford MW, Altmann J, Ober C. Cross-species amplification, non-invasive genotyping, and non-Mendelian inheritance of human STRPs in Savannah baboons. Am J Primatol. 2000;51:219–227. doi: 10.1002/1098-2345(200008)51:4<219::AID-AJP1>3.0.CO;2-G. [DOI] [PubMed] [Google Scholar]
- Stanyon R, Bonvicino CR, Svartman M, Seuanez HN. Chromosome painting in Callicebus lugens, the species with the lowest diploid number (2n=16) known in primates. Chromosoma. 2003;112:201–206. doi: 10.1007/s00412-003-0261-5. [DOI] [PubMed] [Google Scholar]
- Valeggia CR, Mendoza SP, Fernandez-Duque E, Mason WA, Lasley B. Reproductive biology of female titi monkeys (Callicebus moloch) in captivity. Am J Primatol. 1999;47:183–195. doi: 10.1002/(SICI)1098-2345(1999)47:3<183::AID-AJP1>3.0.CO;2-J. [DOI] [PubMed] [Google Scholar]
- van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes. 2004;4:535–538. doi: 10.1111/j.1471-8286.2004.00684.x. [DOI] [Google Scholar]
- van Roosmalen MGM, van Roosmalen T, Mittermeier RA. A taxonomic review of the titi monkeys, genus Callicebus Thomas, 1903, with the description of two new species, Callicebus bernhardi and Callicebus stephennashi, from Brazilian Amazonia. Neotropical Primates. 2002;10:1–52. [Google Scholar]
- Walling CA, Pemberton JM, Hadfield JD, Kruuk LE. Comparing parentage inference software: reanalysis of a red deer pedigree. Mol Ecol. 2010;19:1914–1928. doi: 10.1111/j.1365-294X.2010.04604.x. [DOI] [PubMed] [Google Scholar]
- Wright S. Evolution and the genetics of populations : a treatise in four volumes. University of Chicago Press; Chicago; London: 1978. [Google Scholar]
- Zane L, Bargelloni L, Patarnello T. Strategies for microsatellite isolation: a review. Mol Ecol. 2002;11:1–16. doi: 10.1046/j.0962-1083.2001.01418.x. [DOI] [PubMed] [Google Scholar]
