Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2014 Dec 1;171(24):5708–5727. doi: 10.1111/bph.12871

Autocrine secretion of 15d-PGJ2 mediates simvastatin-induced apoptotic burst in human metastatic melanoma cells

Christine Wasinger 1, Martin Künzl 1, Christoph Minichsdorfer 3, Christoph Höller 4, Maria Zellner 2, Martin Hohenegger 1,✉
PMCID: PMC4290712  PMID: 25091578

Abstract

Background and Purpose

Despite new therapeutic approaches, metastatic melanomas still have a poor prognosis. Statins reduce low-density lipoprotein cholesterol and exert anti-inflammatory and anti-proliferative actions. We have recently shown that simvastatin triggers an apoptotic burst in human metastatic melanoma cells by the synthesis of an autocrine factor.

Experimental Approach

The current in vitro study was performed in human metastatic melanoma cell lines (A375, 518a2) and primary human melanocytes and melanoma cells. The secretome of simvastatin-stressed cells was analysed with two-dimensional difference gel electrophoresis and MS. The signalling pathways involved were analysed at the protein and mRNA level using pharmacological approaches and siRNA technology.

Key Results

Simvastatin was shown to activate a stress cascade, leading to the synthesis of 15-deoxy-12,14-PGJ2 (15d-PGJ2), in a p38- and COX-2-dependent manner. Significant concentrations of 15d-PGJ2 were reached in the medium of melanoma cells, which were sufficient to activate caspase 8 and the mitochondrial pathway of apoptosis. Inhibition of lipocalin-type PGD synthase, a key enzyme for 15d-PGJ2 synthesis, abolished the apoptotic effect of simvastatin. Moreover, 15d-PGJ2 was shown to bind to the fatty acid-binding protein 5 (FABP5), which was up-regulated and predominantly detected in the secretome of simvastatin-stressed cells. Knockdown of FABP5 abolished simvastatin-induced activation of PPAR-γ and amplified the apoptotic response.

Conclusions and Implications

We characterized simvastatin-induced activation of the 15d-PGJ2/FABP5 signalling cascades, which triggered an apoptotic burst in melanoma cells but did not affect primary human melanocytes. These data support the rationale for the pharmacological targeting of 15d-PGJ2 in metastatic melanoma.

Introduction

The 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase inhibitors (statins) are successfully used to treat hypercholesterolaemia and thereby prevent cardiovascular events (Gazzerro et al., 2012). Over the last decades, the safety profile of statins has shown excellent tolerability in long-term use, with only minor concerns related to drug–drug interactions and genetic polymorphisms involved in alterations of statin pharmacokinetics, leading to liver and skeletal muscle injury (Bellosta and Corsini, 2012; Gazzerro et al., 2012). Other effects than lowering low-density lipoprotein cholesterol have also been reported and are now termed pleiotropic effects (Mihos and Santana, 2011; Gazzerro et al., 2012). On the molecular level, these effects involve cell cycle arrest (Glynn et al., 2008; Saito et al., 2008), induction of apoptosis (Feleszko et al., 2002; Minichsdorfer and Hohenegger, 2009), a reduction in cell migration and inflammation and immunomodulatory effects (Mihos and Santana, 2011). Some of these pleiotropic effects are linked to the depletion of isoprenoids, such as farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP) (Collisson et al., 2002; Kidera et al., 2010), which is due to HMG-CoA reductase inhibition. FPP and GGPP are prerequisites for post-translational modification of small G-proteins such as Ras, RhoA and Cdc42. These covalent lipid anchors determine protein localization and hence proper signalling. Statin-induced apoptosis was prevented by co-administration of GGPP in many tumour cell lines, including melanoma cells (Shellman et al., 2005; Saito et al., 2008).

Our laboratory has previously shown that statins induce the mitochondrial pathway of apoptosis in primary human skeletal muscle cells, as well as in human tumour cells, such as rhabdomyosarcoma cells, neuroblastoma cells and metastatic melanoma cell lines A375 and 518a2 (Werner et al., 2004; Sacher et al., 2005; Minichsdorfer and Hohenegger, 2009; Sieczkowski et al., 2010). In metastatic melanoma cells, simvastatin induced an apoptotic burst upon incubation times exceeding 24 h (Minichsdorfer and Hohenegger, 2009). A simple protocol of medium renewal was sufficient to prevent the simvastatin-induced burst of apoptosis. Consequently, an autocrine factor was postulated to be responsible for enhanced activation of caspase 3 via an accessory activation of caspase 8. Fas-ligand is released in murine melanoma cells when treated with a statin (Sarrabayrouse et al., 2007). Nevertheless, the apoptotic burst observed in human metastatic melanoma cells could not be prevented by a neutralizing Fas-ligand antibody (Minichsdorfer and Hohenegger, 2009).

In the light of these findings, such an autocrine factor is of major therapeutic interest. Hence, the objective of our current study was to identify this novel factor that is secreted upon stimulation of human A375 and 518a2 metastatic melanoma cells, which could explain the activation of the extrinsic pathway and the subsequent boost of apoptotic cell death. The specificity of these simvastatin-induced effects was validated by comparing the response of primary human melanocytes with that of primary melanoma cells.

Methods

Cell culture

Primary human melanocytes NHEM (PromoCell, Heidelberg, Germany) and ulli cells (courtesy of Dr Christoph Höller, Department for Dermatology, Medical University Vienna, Austria) were isolated from juvenile foreskin. Primary melanoma cells (6F) were isolated from a melanoma metastasis (courtesy of Dr Christoph Höller) (Schicher et al., 2009). Isolation procedures were approved by the local Ethics Committee of Medical University of Vienna. Primary melanocytes were kept in DermaLife® basal medium supplemented with LifeFactors® (Lifeline, Troisdorf, Germany). The 6F cells (8% fetal calf serum) and human metastatic melanoma cell lines 518a2 and A375 (10% fetal calf serum) were kept in DMEM-high glucose (Invitrogen, Paisley, Scotland, UK) supplemented with 1% penicillin/streptomycin and maintained at 37°C in a 5% CO2 humidified atmosphere.

Western blot analyses

Following treatments with different agents, cells were lysed in 50 mM Tris–HCl (pH 8.0), 150 mM NaCl, 0.1% SDS, 1% NP-40, 10 mM glycerolphosphate, 1 mM aprotinin, 1 mM leupeptin, 1 mM Pefabloc® (Sigma Chemical Co., St. Louis, MO, USA), 1 mM NaVO3, 5 mM NaF, sonicated and centrifuged (30 000× g, 4°C, 40 min). Aliquots of the supernatant (15–30 μg) were separated on SDS polyacrylamide gels and transferred to nitrocellulose membranes for exposure to primary antibodies against COX-2 and lipocalin-type PGD synthase (L-PGDS) (Cayman Chemical, Hamburg, Germany); p38, phospho-p38, RhoA, Cdc42, cleaved caspases 8, 9 and 3 (Cell Signaling, Frankfurt am Main, Germany); PPAR-γ (Santa Cruz Biotechnology, Heidelberg, Germany); β-actin and α-tubulin (Sigma Chemical Co.); and fatty acid-binding protein 5 (FABP5) (R&D System, Minneapolis, MN, USA). Use of the appropriate HRP-conjugated secondary antibodies enabled specific detection by ECL Plus detection system (GE Healthcare, Bucks, UK). The intensities of the protein bands were measured with Image J software using the gel analysis protocol (http://rsbweb.nih.gov/ij). After background subtraction, the intensities were normalized to the loading control (β-actin or α-tubulin). Alternatively, the ImageQuantTL software (GE Healthcare, Pittsburgh, PA, USA) was used and gave comparable results.

Immunohistochemistry and confocal laser scanning microscopy

Immunohistochemistry was performed as previously described (Werner et al., 2004). Fixed, permeabilized and blocked cells were incubated with primary antibodies against COX-2, FABP5 or PPAR-γ (diluted 1:1000 or 1:500) overnight at 4°C. Thereafter, cells were stained with the corresponding secondary antibodies, anti-mouse-Alexa 488 (1:1000; Invitrogen, Heidelberg, Germany) or anti-rat-Alexa 594 (1:1000; Abcam, Cambridge, UK) for 1 h at room temperature (RT). Nuclei were stained with Hoechst 33342 (1:1000) for 10 min at RT. The mounted slides were analysed on an LSM 510 confocal microscope (Zeiss, Jena, Germany) for fluorescence detection at the appropriate wavelengths using a 63× oil-corrected immersion lens.

15-Deoxy-12,14-PGJ2 (15d-PGJ2) elisa

The concentration of 15d-PGJ2 was measured with a commercially available elisa kit (Enzo Life Sciences, Lausen, Switzerland). Briefly, 2 × 105 cells were homogenized in hypotonic buffer (10 mM Tris, 1 mM EDTA, 1 mM aprotinin, 1 mM leupeptin, 1 mM Pefabloc, 1 mM NaVO3; 5 mM NaF), and the cytosolic 15d-PGJ2 concentrations were determined in the supernatant (30 000× g at 4°C, 10 min). The corresponding secretion of 15d-PGJ2 was collected from the medium of 2 × 105 cells, acidified (pH 3.5) and applied to a C18 reversed-phase extraction column (200 mg 3 mL−1; ChromabondC18®, Macherey-Nagel, Düren, Germany). All other steps were performed according to the instruction manual. The cytosolic 15d-PGJ2 was normalized to the protein concentration; secreted 15d-PGJ2 is expressed as pg·mL−1.

Secreted 15d-PGJ2 was also confirmed by reversed-phase HPLC using a C18 column (5 μm, 250 × 4.6 mm; Vydac, Grace, IL, USA), 50% acetonitrile/0.1% acetic acid as a mobile phase (2 mL·min−1) and UV detection at 306 nm (Diers et al., 2010). Commercially available 15d-PGJ2 was used as a standard.

Reactive oxygen species (ROS) measurement

The ROS-sensitive fluorescence dye, CellROX® Deep Red Reagent (Invitrogen), was used to detect ROS in aliquots of 1 × 105 melanoma cells incubated for 48 h with the compounds indicated in the figure legend. The resuspended cells were incubated with 5 μM dye for 20 min at 37°C and fixed with 3.7% formaldehyde in 0.9% NaCl. Fluorescence intensity (excitation: 640 nm; emission: 665 nm) was analysed from 10 000 cells on a Becton-Dickinson FACS Calibur (Franklin Lakes, NY, USA) using the Cyflogic software Version 1.2.1 (http://www.cyflogic.com).

JC-1 staining

The mitochondrial membrane potential was monitored by JC-1 (Enzo Life Sciences) accumulation in mitochondria. Melanoma cells (1 × 105) were treated with drugs, as indicated in the figure legends, stained with JC-1 (5 μg·mL−1) for 10 min at 37°C, washed and analysed in the Becton-Dickinson FACScan for aggregates (excitation: 560 nm, emission: 590 nm), monomers (excitation: 488 nm, emission: 529 nm) and the ratio thereof.

Caspase activity measurements

Caspase activity was measured with specific fluorescent caspase 3, 8 and 9 substrates, as previously described (Werner et al., 2004; Minichsdorfer and Hohenegger, 2009; Sieczkowski et al., 2010).

Quantitative real-time PCR and siRNA experiments

The mRNA from 2 × 105 melanoma cells incubated in the absence and presence of 3 μM simvastatin, for 24 or 48 h, was isolated with TriReagent according to manufacturer's instruction. After DNase I treatment, RNA was reverse transcribed using RevertAidH Minus First-Strand cDNA synthesis Kit (Thermo Scientific, Vienna, Austria). Quantitative real-time PCR was performed with SensiMix Plus SYBR & Fluorescein Kit (Bioline, Berlin, Germany) adding cDNA and the specific primer pairs given in Table 1. Four expression controls (GAPDH, B2M, RPLP0, RPS14) were used (Dydensborg et al., 2006). The PCR was run for 40 cycles with 20 s steps for denaturation (95°C), annealing (57°C) and a 25 s elongation step at 72°C followed by a melting curve. CT values were normalized to the four control genes, and quantification was performed using the comparative CT method.

Tables of Links

TARGETS LIGANDS
Caspase 3 FABP5 15-deoxy-12,14 PGJ2 Simvastatin
Caspase 8 H-PGD synthase Pioglitazone TNF-α
Caspase 9 L-PGD synthase Rosiglitazone TRAIL
COX-2 p38-MAPK IL-1β Vincristine
DR5 (TNFRSF10B) PPAR-γ SB-203580
Open in a new tab

These Tables list key protein targets and ligands in this document, which are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Pawson et al., 2014) and are permanently archived in the Concise Guide to PHARMACOLOGY 2013/14 (Alexander et al., 2013a,b,c,,).

Table 1.

Specific primer pairs for quantitative PCR experiments

Primer forward (5′–3′) Primer reverse (5′–3′) bp
L-PGDS CTACTCCGTGTCAGTGGTGG CACTTATCGGTTTGGGGCAG 213
H-PGDS AACAAGCTGACTGGCCTGAA AGTCTGCCCAAGTTACAGAGTT 348
COX-2 ACAGGCTTCCATTGACCAGAG ATCTGGCCGAGGCTTTTCTAC 208
PPAR-γ GGGGTTCTCATATCCGAGGG GGGCGGTCTCCACTGAGAATAA 182
FABP5 ATGAAGGAGCTAGGAGTGGGA AGCTGTGGTTTCTTCAAACTTCTC 163
Cyclin D1 GCTGCGAAGTGGAAACCATC GCTCTTTTTCACGGGCTCCA 272
p21 ACTCTCAGGGTCGAAAACGG AGGAGAACACGGGATGAGGA 366
Open in a new tab

FABP5 expression was suppressed by transfection of 2 × 105 melanoma cells with 5 nM siRNA (flexi tube gene solution GS2171) using the HiPerFect® transfection reagent according to the manufacturer's instructions (Qiagen, Hilden, Germany). After 24 h, cells were exposed to 3 μM simvastatin for 48 h and compared with controls.

Two-dimensional difference gel electrophoresis (2D-DIGE) analysis of labelled proteins

The medium (24 mL) of simvastatin- or vincristine-treated 518a2 melanoma cells (48 h) was collected, cleared from cells (1200× g for 5 min) and again centrifuged (100 000× g, 60 min, 4°C). Proteins in the supernatant were precipitated (ice-cold 6.1 M trichloroacetic acid with 80 mM DTT) and collected by centrifugation (10 000× g, 10 min, 4°C) (Zellner et al., 2005; Veitinger et al., 2012). The precipitated proteins were washed with 1.5 mL of ice-cold acetone, including 20 mM DTT, and dry pellets were resuspended in denaturing sample buffer {7 M urea, 2 M thiourea, 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate and 15 mM Tris–HCl, pH 8.5}. Proteins were labelled with a ratio of 1 μg protein to 5 pmol fluorescent cyanine dyes (CyDyes®, GE Healthcare, Uppsala, Sweden). The secretomes extracted from simvastatin (Cy3)- and vincristine (Cy5)-treated melanoma cells were compared with the negative controls, a secretome of non-stimulated melanoma cells (Cy2). Subsequent isoelectric focusing (30 kVh) and SDS-PAGE were performed as previously described (Veitinger et al., 2012). Spot detection was performed on the gel images using the DeCyder software module Differential In-gel Analysis (version 6.00.28; GE Healthcare) setting the target spot number to 2500. Spots of interest from the separated proteomes were excised from silver-stained gels and digested with trypsin for identification by MS according to the protocol previously provided (Veitinger et al., 2012).

Statistical analysis

The experiments were performed at least three times, carried out in duplicate, and data were presented as mean ± SD, if not otherwise stated. Statistical analysis for multiple comparisons was carried out by one-way anova, followed by post hoc Tukey's (Figures 5A, 6, 7, 9, 1 and 3A–C) or Dunnett's test (Figures 3, 5B, 8, 0 and 2) (GraphPad Prism Software, La Jolla, CA, USA). Student's t-test was used for statistical analysis of quantitative PCR (Figure 3D). A value of P < 0.05 was considered to be statistically significant.

Figure 5.

Figure 5

Open in a new tab

Simvastatin-induced caspase 9 activation is prevented by inhibition of p38 or COX-2, but not COX-1. (A) Metastatic melanoma cells (518a2 and A375) were incubated for 48 h in the absence and presence of simvastatin (Sim) or the specific COX-1 inhibitor SC-560 to measure caspase 9 activation. (B) The specific inhibitors of p38 (SB-203580) and COX-2 (NS-398) inhibited simvastatin (Sim)-triggered caspase 9 activity. Data represent means ± SEM (n = 3–6). (C) Cells were stained with JC-1 and analysed by FACS for the ratio of the red/green signal after treatment with simvastatin for 48 h. Data represent the means ± SEM (n = 8–12). Asterisks indicate significance versus control (**P < 0.005; ***P < 0.0005). Hashes indicate significance versus corresponding simvastatin treatment ###P < 0.0005; n.s., not significant).

Figure 6.

Figure 6

Open in a new tab

Simvastatin-induced ROS production is associated with caspase 9 activation. (A) The 518a2 and A375 melanoma cells were exposed to simvastatin (Sim) in the absence and presence of 5 μM N-acetylcysteine (NAC; 5) or 5 μM NAC every 24 h (2 × 5). After 48 h, ROS formation was detected by FACS. (B) Caspase 9 activity was measured after 48 h in cells treated as given in (A). Bars indicate means ± SEM (n = 3–10). Asterisks indicate significance versus control (***P < 0.0005). Hashes indicate significance versus corresponding simvastatin treatment (#P < 0.05; ##P < 0.005; ###P < 0.0005; n.s., not significant).

Figure 7.

Figure 7

Open in a new tab

COX-2 and p38 control simvastatin-induced ROS production. The 518a2 (A, B) and A375 (C, D) melanoma cells were exposed to simvastatin (Sim) in the absence and presence of 10 μM SB-203580 or 50 μM NS-398 for 24 (A, C) or 48 h (B, D). Cells were stained for ROS detection by FACS. Data represent the means ± SEM (n = 8–12). Asterisks indicate significance versus control (*P < 0.05; **P < 0.005; ***P < 0.0005). Hashes indicate significance versus corresponding simvastatin treatment (#P < 0.05; ##P < 0.005; ###P < 0.0005).

Figure 9.

Figure 9

Open in a new tab

Simvastatin-induced 15d-PGJ2 secretion is dependent on p38 and COX-2. Human 518a2 (A) and A375 (B) melanoma cells were exposed to simvastatin (Sim), alone or in combination with SB-203580 or NS-398. After 48 h, the extracellular 15d-PGJ2 concentration was measured. Data represent means ± SEM (n = 3–8). Asterisk indicates significance versus control (**P < 0.005). Hash indicates significance versus corresponding simvastatin treatment (#P < 0.05).

Figure 1.

Figure 1

Open in a new tab

FABP5 expression in metastatic melanoma cells. (A) Analysis of the secretome of 518a2 melanoma cells (by 2D-DIGE) exposed to 10 μM simvastatin (green) or 10 ng·mL−1 vincristine (red) for 48 h. A merged picture revealed three proteins of interest, identified by MS (protein identification number). Fold up-regulation is given as mean ± SD (n = 3). Quantification of the proteins of interest (arrows) was confirmed by three-dimensional illustrations (B). Human metastatic melanoma cells, 518a2 and A375, were treated with simvastatin (Sim) for 48 h in the absence and presence of siRNA targeting FABP5 and were analysed for FABP5 protein (C), FABP5 mRNA (D), or cleaved caspase 3, 8 and 9 (E). Quantitative PCR of FABP5 depicts wild-type cells (grey bars) with FABP5 knockdowns (white bars) (n = 3–23). Asterisks indicate significance versus control (*P < 0.05; **P < 0.005; ***P < 0.0005).

Figure 3.

Figure 3

Open in a new tab

Simvastatin stimulates stress activation via p38. RhoA, Cdc42 and α-tubulin are depicted from cells treated with simvastatin (Sim) for 4 (A) and 24 h (B). The unprocessed forms of the G-proteins are indicated by a red arrow. (C, D) The activation of p38 kinase was monitored by a phospho-specific antibody (p-p38) and compared with total p38 and α-tubulin. (E) Quantification of the p38 phosphorylation is illustrated (n = 3–7). Asterisks indicate significance versus control (*P <0.05; **P < 0.005; ***P < 0.0005).

Figure 8.

Figure 8

Open in a new tab

Simvastatin mediates 15d-PGJ2 production. (A) elisa of 15d-PGJ2 kinetics in the cytosol of simvastatin (Sim)-treated 518a2 or A375 melanoma cells. (B) The extracellular concentration of 15d-PGJ2 in the medium of simvastatin-treated cells is depicted. Data points represent means ± SEM (n = 3–8). (C) HPLC analysis using a 15d-PGJ2 standard (0.3 μg), or 50 μL of the concentrated medium of untreated (control) and simvastatin (10 μM)-treated A375 cells (48 h). Asterisks indicate significance versus control (*P < 0.05; **P < 0.005).

Figure 2.

Figure 2

Open in a new tab

PPAR-γ in simvastatin-treated human melanoma cells. (A) Protein and (B) mRNA levels of PPAR-γ were detected in simvastatin (Sim)-treated metastatic melanoma cells. Analogous to Figure 1D, quantitative PCR for PPAR-γ is illustrated in the absence (grey bars) and presence (white bars) of FABP5 siRNA from simvastatin-treated cells. Similarly, the PPAR-γ targets cyclin D1 and p21 were compared (n = 3–23) (D). (C) PPAR-γ (green) and FABP5 (red) were also visualized in simvastatin-treated cells by confocal microscopy. Nuclei were stained with Hoechst 33342 (grey). Asterisks indicate significance versus control (*P < 0.05; **P < 0.005; ***P < 0.0005; n.s., not significant).

Materials

NS-398 was purchased from Enzo Life Sciences, AT-56 and SC-560 from Tocris Bioscience (Bristol, UK) and 15d-PGJ2 from Santa Cruz Biotechnology. SB-203580, TriReagent, protease inhibitors and all other chemicals were obtained from Sigma Chemical Co. Simvastatin and Mowiol® were purchased from Merck (Rahway, NJ, USA), and the fluorescent substrates for caspases 3, 8 and 9 were from Alexis Biochemicals (San Diego, CA, USA).

Results

Simvastatin induces secretion of a chaperone for lipophilic molecules

Simvastatin (1–10 μM) treatment of human metastatic melanoma cells A375 and 518a2 results in secretion of a suicide factor, which amplified apoptosis by activation of the extrinsic pathway (Minichsdorfer and Hohenegger, 2009). Thus, the proteins in the conditional media were separated by 2D-DIGE to allow identification by MS. In order to control for unspecific protein release due to cytotoxicity, medium from simvastatin (10 μM)-treated 518a2 melanoma cells were compared to vincristine (10 ng·mL−1) exposure. The identified proteins were assigned as cytoskeleton and associated proteins. Introduction of a threshold (regulation greater than fivefold vs. the vincristine positive control and a volume larger than 75 000) scored for three proteins (Figure 1A). Interestingly, two geranylgeranylated Rho GTPases, RhoA and Cdc42, emerged and are clearly related to cytoskeleton interaction and stress fibre formation (Nakata et al., 2006). However, most abundantly up-regulated was the lipid chaperone, FABP5 (Figure 1A and B). FABPs bind hydrophobic ligands with high affinity such as saturated and unsaturated long-chain fatty acids (>C14), eicosanoids and other lipids (Furuhashi and Hotamisligil, 2008).

We confirmed FABP5 up-regulation in A375 and 518a2 melanoma cells by Western blot, immunohistochemistry and on mRNA level (Figures 1C,D and 2C). In order to demonstrate participation of FABP5 in simvastatin-induced apoptosis, the lipid chaperone was down-regulated with siRNA (Figure 1C), but could not prevent simvastatin-induced caspase activation (Figure 1D).

FABP5 recruits eicosanoids to the PPAR-γ, which is known for anti-tumour effects (Michalik et al., 2004; Nunez et al., 2006). On the protein level, PPAR-γ decreased when exposed to simvastatin, which is more pronounced at incubation times of 48 h (Figure 2A). Confocal images also reveal reduced accumulation of PPAR-γ in the nucleus compared with controls (Figure 2C), whereas mRNA levels of PPAR-γ are inconclusive in the presence of simvastatin (Figure 2B). However, quantification of the mRNA of specific PPAR-γ target genes clearly show up-regulation of p21 and down-regulation of cyclin D1 in the presence of simvastatin, which was prevented in FABP5 knockdown cells (Figure 2D). Thus, simvastatin-induced FABP5 is needed to execute PPAR-γ activation, but not to attenuate simvastatin-induced apoptosis (Figure 1E).

Simvastatin-induced apoptosis is dependent upon COX-2 induction and ROS production

The induction of apoptosis by simvastatin is strictly dependent upon HMG-CoA reductase inhibition and is prevented by co-administration of mevalonic acid (Minichsdorfer and Hohenegger, 2009). Thus, isoprenylation may be important for RhoA and Cdc42, identified in the secretome of simvastatin-treated melanoma cells (Figure 1). Both GTPases were up-regulated by simvastatin in a concentration- and time-dependent manner (Figure 3). Notably, simvastatin exposure shifted the GTPases to the unprocessed isoform, accompanied by a clear reduction of the processed species (Figure 3A and B). Such an effect on RhoA and Cdc42 may provide sufficient stress signal to activate p38 MAPK. A significant concentration- and time-dependent increase in phosphorylated p38 confirmed this assumption (Figure 3C–E).

The kinase p38 represents a key regulator of inflammation via mediators, including TNF-α, IL-1β and COX-2 (Yano et al., 2007). As we excluded simvastatin-mediated elevation of TNF-α and IL-1β (data not shown), COX-2 expression was further investigated. Simvastatin induced a concentration- and time-dependent induction of COX-2 (Figure 4A). Under resting conditions, COX-2 can be readily detected in 518a2 cells, whereas it is virtually absent in A375 cells, as is evident in confocal microscope images (Figure 4C). COX-2 is strongly induced in A375 cells, as validated by qPCR. In 518a2 cells, such a transcriptional activation of COX-2 was hardly detectable after 24 h (Figure 4B). Importantly, simvastatin-induced COX-2 up-regulation was completely abrogated with the specific p38 inhibitor, SB-203580 (Figure 4D). The specific inhibitors for p38 and COX-2, SB-203580 and NS-398, were also used to obtain functional evidence for upstream involvement in simvastatin-induced apoptotic burst. Prototypical concentrations of the inhibitors completely abrogated simvastatin-induced caspase 9 activation (Figure 5A) (Denkert et al., 2001; Yano et al., 2007; Ivanov and Hei, 2011). A concentration of 10 μM NS-398, which is 2.5-fold above the IC50 for COX-2 inhibition of the purified enzyme, was not able to significantly reduce simvastatin effects, whereas 50 μM NS-398 did so (Figure 5A) (Futaki et al., 1994). The specific COX-1 inhibitor, SC-560, was not able to abrogate simvastatin-induced caspase 9 activation (Figure 5A), indicating that this isoform is not involved. As caspase 9 activation is preceded by an opening of the mitochondrial transition permeability pore, a breakdown of the mitochondrial membrane potential has to be postulated (Bolisetty and Jaimes, 2013). Indeed, we observed a significant concentration-dependent decline in red JC-1 aggregates (Figure 5B). Mitochondria are the main resource for ROS, under physiological and pathological conditions (Bolisetty and Jaimes, 2013). Simvastatin-induced ROS formation was significantly reduced with N-acetylcysteine, which also prevented simvastatin-triggered caspase 9 activation (Figure 6). Most importantly, simvastatin-induced oxidative stress was prevented by co-application of SB-203580 or NS-398, indicating that p38 and COX-2 act upstream of the mitochondrial damage (Figure 7).

Figure 4.

Figure 4

Open in a new tab

Simvastatin up-regulates COX-2. (A) Simvastatin (Sim)-exposed melanoma cells were probed for protein and (B) mRNA levels of COX-2 (n = 5–10). (C) Confocal fluorescence microscopy images of simvastatin (10 μM)-treated cells revealing enhanced cytosolic COX-2 (green) staining, compared with controls (CTL); nuclei stained with Hoechst 33342 (blue). Representative images are shown. (D) Melanoma cells were exposed to combinations of simvastatin and the p38 inhibitor SB-203580 (10 μM) and analysed for COX-2. Asterisks indicate significance versus control (*P < 0.05; **P < 0.005; ***P < 0.0005).

Figure 12.

Figure 12

Open in a new tab

Exogenous 15d-PGJ2 triggers ROS formation and apoptosis. The 518a2 and A375 cells were treated with simvastatin (Sim) or 15d-PGJ2 and ROS formation was analysed after 4 (A, B) and 48 h (C, D). Caspase 8 (E) and caspase 9 (F) are activated by 160 nM 15d-PGJ2, comparable to the effects of simvastatin. Data represent means ± SEM (n = 3–4). Asterisks indicate significance versus control (*P < 0.05; **P < 0.005; ***P < 0.0005).

Figure 13.

Figure 13

Open in a new tab

Simvastatin is a trigger for 15d-PGJ2-induced apoptosis in primary human metastatic melanoma cells but not in melanocytes. Primary human melanocytes, ulli (A) and NHEM (B) and primary human metastatic melanoma cells 6F (C) were incubated with simvastatin for 24 or 48 h in order to measure caspase 3 activity and 15d-PGJ2 formation (n = 3). The 6F cells were also treated in the absence (CTL) and presence of 160 nM 15d-PGJ2 for 24 h (D) to measure caspase 8 (n = 4) and 9 (n = 3) activity. Asterisks indicate significance versus control (*P < 0.05; ***P < 0.0005).

15d-PGJ2 is a mediator of simvastatin-induced apoptosis

Thus far, the strong up-regulation of COX-2 (Figure 4) and the considerable protection from simvastatin-induced ROS production by the specific COX-2 inhibitor NS-398 guided us to further consider the role of prostaglandins in this signalling cascade. The prostaglandin 15d-PGJ2 is an endogenous PPAR-γ agonist, recruited and bound to FABP5. Both proteins are regulated by simvastatin. Moreover, 15d-PGJ2 contains a highly reactive cyclopentanone ring, capable of inducing ROS (Kim et al., 2010) in simvastatin-treated metastatic melanoma cells. Simvastatin significantly elevated not only the endogenous synthesis of 15d-PGJ2 but also the secretion of 15d-PGJ2 into the medium up to 95–160 nM (Figure 8). Importantly, secretion of 15d-PGJ2 was inhibited by the specific inhibitors of p38 or COX-2 (Figure 9).

Two prostaglandin D synthases (PGDS) are capable of catalysing the conversion of PGH2 into PGD2 and further to different prostaglandins of the J-series, the lipocalin-type PGDS (L-PGDS) and the hematopoietic PGDS (H-PGDS) (Urade and Eguchi, 2002). On the mRNA level, in A375 melanoma cells, both isoforms were detectable and stimulated by simvastatin (Figure 10). Conversely, in 518a2 cells, we could only detect L-PGDS. On the protein level, the induction of L-PGDS was confirmed in both cell lines.

graphic file with name bph0171-5708-f10.jpg

Open in a new tab

Simvastatin induces PGDS. (A) The mRNA levels of L-PGDS and H-PGDS were determined by quantitative PCR in 518a2 or A375 cells and compared with simvastatin (3 μM, 48 h) treatment (n = 3–12). (B) L-PGDS protein was detected. (C) The kinetics of L-PGDS up-regulation are depicted. Data represent means ± SEM (n = 6). Asterisks indicate significance versus control (*P < 0.05; ***P < 0.0005).

One may now postulate that inhibition of L-PGDS prevents simvastatin-induced apoptosis, particularly the extrinsic pathway via caspase 8. Indeed, the L-PGDS isoform-specific inhibitor AT-56 prevented the full activation of caspase 9, 8 and, to some extent, caspase 3 (Figure 11).

Figure 11.

Figure 11

Open in a new tab

Simvastatin-induced apoptosis is dependent on 15d-PGJ2. Cells were incubated in the absence and presence of simvastatin (Sim) or the L-PGDS inhibitor AT-56 as indicated. Cell lysates were analysed for caspase 9 (n = 3–8) (A), caspase 3 (n = 3–8) (B) and caspase 8 (n = 4–9) (C) activity. Asterisk indicates significance versus control (***P < 0.0005). Hash indicates significance versus corresponding simvastatin treatment (###P < 0.0005).

As an acid test, exogenous 15d-PGJ2 application was sufficient to enhance ROS production and to induce apoptosis via caspase 8 and 9 in metastatic melanoma cells (Figure 2). Similar to the previous observations, ROS formation in 518a2 cells preceded A375 cells (cf. Figure 7). The 15d-PGJ2 was detected in the medium of simvastatin-stressed metastatic melanoma cells lines, but the question remains open whether this holds true also in primary cells. We have therefore investigated primary melanocytes and melanoma 6F cells (Figure 3). Adverse drug events of the skin are very rare in statin-treated humans (Gazzerro et al., 2012). Expectedly, in primary melanocytes, simvastatin was not able to trigger caspase 3 or 15d-PGJ2 formation (Figure 3A and B), in contrast to primary human metastatic melanoma cells (Figure 3C). Moreover, exogenous application of 15d-PGJ2 to 6F cells significantly activated caspase 8 and 9 (Figure 3D) and thereby corroborated our previous finding in metastatic melanoma cell lines.

Taken together, these results corroborate the finding that 15d-PGJ2 acts as a suicide factor in metastatic melanoma cells and simvastatin is the pharmacological trigger for 15d-PGJ2 formation (Figure 4). Thus, one may consider 15d-PGJ2 as a novel lead compound for anti-cancer cyclopentenones.

Figure 14.

Figure 14

Open in a new tab

Schematic illustration of 15d-PGJ2 signalling in simvastatin-treated metastatic melanoma cells.

Discussion

We here report that the HMG-CoA reductase inhibitor simvastatin is able to elevate intracellular and extracellular prostaglandin 15d-PGJ2 levels in metastatic melanoma cells (Figure 8) and thereby identify 15d-PGJ2 as the autocrine suicide factor postulated in our previous work (Minichsdorfer and Hohenegger, 2009). The importance of 15d-PGJ2 signalling is further corroborated by augmented FABP5 expression in the presence of simvastatin. The lipid chaperone FABP5 binds the lipophilic prostaglandin 15d-PGJ2 (Coe and Bernlohr, 1998; Furuhashi and Hotamisligil, 2008). FABP5 is abundantly expressed in epidermal cells of the skin and shuttles hydrophobic molecules to different compartments within the cell (Furuhashi and Hotamisligil, 2008). Most importantly, FABP5 transports 15d-PGJ2 to PPAR-γ (Tan et al., 2002; Ward et al., 2004).

Activation of PPAR-γ leads to anti-cancer effects, cell cycle arrest and pro-apoptotic signalling (Michalik et al., 2004; Nunez et al., 2006). On the protein level, simvastatin reduced PPAR-γ, whereas nuclear translocation of PPAR-γ was not enhanced (Figure 2). However, PPAR-γ ligands 15d-PGJ2 and FABP5 are strongly up-regulated, which may explain why the two prototypical target genes of PPAR-γ, cyclin D1 and p21, are regulated by simvastatin. Cyclin D1 down-regulation and p21 up-regulation (Figure 2D) translate into cell cycle arrest, which has been observed in many statin-treated cancer cell lines, including melanoma cells (Jakobisiak et al., 1991; Glynn et al., 2008; Saito et al., 2008). Importantly, the knockdown of FABP5 abolished the transcriptional activity of PPAR-γ, but not simvastatin-induced activation of caspase 9 and 3 (Figure 1E).

A possible explanation for the detection of FABP5 in the extracellular space is as yet unavailable. However, urinary excretion of FABP5 is described in patients with cutaneous melanoma stage II and III, but not in stage IV melanomas (Brouard et al., 2002). FABP4, a closely related family member, is secreted by adipocytes and circulates in human serum (Xu et al., 2006). Elevated FABP4 serum levels are found in obese individuals and possibly represent a biomarker for metabolic syndrome and obesity (Xu et al., 2006).

Simvastatin-induced apoptosis is clearly controlled by 15d-PGJ2. This assumption is supported by the following observations. (i) Inhibition of the upstream signal, p38 and COX-2, completely inhibited simvastatin-induced caspase 9 activation, but also the formation of 15d-PGJ2 (Figures 5 and 9). Basal 15d-PGJ2 synthesis was not altered by the COX-2 inhibitor NS-398, indicating no cross-reactivity via COX-1. (ii) Simvastatin destroyed already at 1 μM significantly the mitochondrial potential, which is thought to be mediated by ROS formation. However, the inhibitors of p38, COX-2 and the radical scavenger N-acetylcysteine protected from this ROS formation (Figures 7). (iii) The specific inhibitor of L-PGDS, AT-56, significantly reduced the simvastatin-induced caspase 3 and 9 activity (Figure 11). (iv) Specific activation of caspase 8 is only observed at longer exposure time with simvastatin (Minichsdorfer and Hohenegger, 2009). This apoptotic burst via the extrinsic pathway of apoptosis was also prevented by co-administration with AT-56 (Figure 11). (v) The simvastatin-induced apoptosis and 15d-PGJ2 formation was not detected in primary human melanocytes, which clearly demonstrates the specificity of these effects. Indirectly, these results are predictable cases of adverse drug reactions are only rarely observed under simvastatin treatment. (vi) Most importantly, even nanomolar concentrations of exogenous 15d-PGJ2 were sufficient to activate the extrinsic and intrinsic pathways of apoptosis in metastatic melanoma cells.

The multifaceted biological properties of 15d-PGJ2 include anti-neoplastic, anti-inflammatory and antiviral activities (Surh et al., 2011). Further effects of 15d-PGJ2, for example, its anti-tumour activity, inhibition of cell cycle progression, induction of heat shock proteins and stimulation of osteogenesis, are observed with statins too (Fukushima, 1992; Surh et al., 2011; Gazzerro et al., 2012). It is worth mentioning that 15d-PGJ2 has been found to inhibit melanoma progression and tumour stroma interaction (Paulitschke et al., 2012). These effects were independent of PPAR-γ and were not mimicked by other PPAR-γ agonists such as pioglitazone or rosiglitazone. Accordingly, PPAR-γ agonists were not superior to the endogenous ligand 15d-PGJ2 to prevent tumour proliferation and cell migration in melanoma cells, tumour-associated fibroblasts or tube formation of endothelial cells (Paulitschke et al., 2012). Further evidence for paracrine signalling of 15d-PGJ2 and anti-tumour activity has been shown in Jurkat T-lymphocytes and prostate cancer cells by induction of death receptor 5 (DR5; also known as TNFRSF10B) and enhanced TRAIL-mediated caspase 8 activity (Nakata et al., 2006). These data indirectly hint towards PPAR-γ-independent signalling of 15d-PGJ2, which is most likely due to ROS formation and direct interaction with proteins via α,β-unsaturated carbonyl groups located in the cyclopentone ring (Surh et al., 2011). This covalent interaction with proteins then results in cellular stress and ROS formation. Such an assumption is supported by FABP5 knockdown, which amplified apoptosis possibly due to less buffering of 15d-PGJ2 by the lipid chaperone (Figure 1).

Physiological concentrations of 15d-PGJ2 are in the pico- to nanomolar concentration range and reach micromolar concentrations at sites of acute inflammation (Fukushima, 1990). In our experiments, 15d-PGJ2 was confirmed by two independent methods and reached concentrations of 95–160 nM after simvastatin application, which are sixfold higher compared with the media of control cells. Probably higher concentrations can be expected in the microenvironment of melanomas. However, exogenous application of 160 nM 15d-PGJ2 was sufficient to trigger apoptosis via caspase 8, and ROS formation induced caspase 9 activation (Figures 2 and 3D) in metastatic cell lines and primary melanoma cells.

Statin-induced apoptotic and anti-proliferative effects have been shown in various studies with melanoma cells and are affirmed by our study, comparing human A375 and 518a2 metastatic melanoma cells with primary melanocytes and melanoma cells (Dimitroulakos et al., 2001; Shellman et al., 2005; Glynn et al., 2008; Saito et al., 2008). These data are further supported by animal models and xenograft experiments with human and murine melanoma cells. Tumour growth and the metastatic potential was significantly reduced in the statin-treated group (Collisson et al., 2003; Coimbra et al., 2010; Favero et al., 2010; Kidera et al., 2010; Pich et al., 2013). Taken together, there is a large body of evidence suggesting that statins shown to have anti-tumour activity in vitro also retain this activity in vivo, which is partially supported in humans. Clinical studies and meta-analyses are available, which confirm a positive outcome and reduced melanoma incidence in statin takers (Koomen et al., 2007; Jacobs et al., 2011; Nielsen et al., 2012). Long-term use of statins revealed an estimated relative risk of the incidence of melanoma of 0.79 (95% CI = 0.66–0.96), similar to endometrial cancer and non-Hodgkin lymphoma (Jacobs et al., 2011). However, some meta-analyses reported no significant evidence for a protective effect on melanoma development, even after subgroup analysis with respect to age, gender, statin type or duration of drug application (Freeman et al., 2006; Bonovas et al., 2010; Jagtap et al., 2012). Nevertheless, a tumour-promoting effect of statins is not observed.

Although the effects observed with simvastatin were obtained in the concentration range of 1–10 μM, this concentration is over 10–100-fold higher than that used for pharmacological suppression of endogenous cholesterol synthesis (Bellosta and Corsini, 2012). There are reports of clinical trials with higher statin doses, that is, 25 mg lovastatin·kg−1day−1, which resulted in plasma concentrations of 4 μM (Thibault et al., 1996; van der Spek et al., 2006). Similarly, a dose of 15 mg simvastatin·kg−1day−1 given for 1 week was well-tolerated and has been investigated in combination with chemotherapeutics in refractory myeloma and lymphoma patients (van der Spek et al., 2006).

In conclusion, simvastatin triggers the synthesis of 15d-PGJ2, a prostaglandin with anti-tumour activity, which explains the apoptotic burst in human metastatic melanoma cells previously observed. These data provide new evidence to support the use of statins in oncological settings and confirm that it is feasible to induce 15d-PGJ2 pharmacologically.

Acknowledgments

This work was supported by Herzfelder'sche Familienstiftung and the Austrian Science Fund (P-22385 to M. H.).

Glossary

15d-PGJ2

15-deoxy-12,14-PGJ2

FABP5

fatty acid-binding protein 5

FPP

farnesyl pyrophosphate

GGPP

geranylgeranyl pyrophosphate

HMG-CoA

3-hydroxy-3-methylglutaryl CoA

H-PGDS

haematopoietic PGD synthase

L-PGDS

lipocalin-type PGD synthase

ROS

reactive oxygen species

SDS

sodium dodecyl sulfate

Author contributions

C. W., M. K., C. M., C. H. and M. Z. performed the experiments; C. W., C.H., M. Z. and M. H. contributed to data analyses and art work. Design, conception and writing were performed by C. W. and M. H. All authors approved the final version of the manuscript.

Conflict of interest

All authors report no conflict of interest.

References

  1. Alexander SPH, Benson HE, Faccenda E, Pawson AJ, Sharman JL, Spedding M, et al. The Concise Guide to PHARMACOLOGY 2013/14: Nuclear hormone receptors. Br J Pharmacol. 2013a;170:1652–1675. doi: 10.1111/bph.12448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alexander SPH, Benson HE, Faccenda E, Pawson AJ, Sharman JL, Spedding M, et al. The Concise Guide to PHARMACOLOGY 2013/14: Catalytic receptors. Br J Pharmacol. 2013b;170:1676–1705. doi: 10.1111/bph.12449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alexander SPH, Benson HE, Faccenda E, Pawson AJ, Sharman JL, Spedding M, et al. The Concise Guide to PHARMACOLOGY 2013/14: Enzymes. Br J Pharmacol. 2013c;170:1797–1867. doi: 10.1111/bph.12451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bellosta S, Corsini A. Statin drug interactions and related adverse reactions. Expert Opin Drug Saf. 2012;11:933–946. doi: 10.1517/14740338.2012.712959. [DOI] [PubMed] [Google Scholar]
  5. Bolisetty S, Jaimes EA. Mitochondria and reactive oxygen species: physiology and pathophysiology. Int J Mol Sci. 2013;14:6306–6344. doi: 10.3390/ijms14036306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bonovas S, Nikolopoulos G, Filioussi K, Peponi E, Bagos P, Sitaras NM. Can statin therapy reduce the risk of melanoma? A meta-analysis of randomized controlled trials. Eur J Epidemiol. 2010;25:29–35. doi: 10.1007/s10654-009-9396-x. [DOI] [PubMed] [Google Scholar]
  7. Brouard MC, Saurat JH, Ghanem G, Siegenthaler G. Urinary excretion of epidermal-type fatty acid-binding protein and S100A7 protein in patients with cutaneous melanoma. Melanoma Res. 2002;12:627–631. doi: 10.1097/00008390-200212000-00013. [DOI] [PubMed] [Google Scholar]
  8. Coe NR, Bernlohr DA. Physiological properties and functions of intracellular fatty acid-binding proteins. Biochim Biophys Acta. 1998;1391:287–306. doi: 10.1016/s0005-2760(97)00205-1. [DOI] [PubMed] [Google Scholar]
  9. Coimbra M, Banciu M, Fens MH, de Smet L, Cabaj M, Metselaar JM, et al. Liposomal pravastatin inhibits tumor growth by targeting cancer-related inflammation. J Control Release. 2010;148:303–310. doi: 10.1016/j.jconrel.2010.09.011. [DOI] [PubMed] [Google Scholar]
  10. Collisson EA, Carranza DC, Chen IY, Kolodney MS. Isoprenylation is necessary for the full invasive potential of RhoA overexpression in human melanoma cells. J Invest Dermatol. 2002;119:1172–1176. doi: 10.1046/j.1523-1747.2002.19519.x. [DOI] [PubMed] [Google Scholar]
  11. Collisson EA, Kleer C, Wu M, De A, Gambhir SS, Merajver SD, et al. Atorvastatin prevents RhoC isoprenylation, invasion, and metastasis in human melanoma cells. Mol Cancer Ther. 2003;2:941–948. [PMC free article] [PubMed] [Google Scholar]
  12. Denkert C, Kobel M, Berger S, Siegert A, Leclere A, Trefzer U, et al. Expression of cyclooxygenase 2 in human malignant melanoma. Cancer Res. 2001;61:303–308. [PubMed] [Google Scholar]
  13. Diers AR, Higdon AN, Ricart KC, Johnson MS, Agarwal A, Kalyanaraman B, et al. Mitochondrial targeting of the electrophilic lipid 15-deoxy-Delta12,14-prostaglandin J2 increases apoptotic efficacy via redox cell signalling mechanisms. Biochem J. 2010;426:31–41. doi: 10.1042/BJ20091293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dimitroulakos J, Ye LY, Benzaquen M, Moore MJ, Kamel-Reid S, Freedman MH, et al. Differential sensitivity of various pediatric cancers and squamous cell carcinomas to lovastatin-induced apoptosis: therapeutic implications. Clin Cancer Res. 2001;7:158–167. [PubMed] [Google Scholar]
  15. Dydensborg AB, Herring E, Auclair J, Tremblay E, Beaulieu JF. Normalizing genes for quantitative RT-PCR in differentiating human intestinal epithelial cells and adenocarcinomas of the colon. Am J Physiol Gastrointest Liver Physiol. 2006;290:G1067–G1074. doi: 10.1152/ajpgi.00234.2005. [DOI] [PubMed] [Google Scholar]
  16. Favero GM, F Otuki M, Oliveira KA, Bohatch MS, Jr, Borelli P, Barros FE, et al. Simvastatin impairs murine melanoma growth. Lipids Health Dis. 2010;9:142. doi: 10.1186/1476-511X-9-142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Feleszko W, Mlynarczuk I, Olszewska D, Jalili A, Grzela T, Lasek W, et al. Lovastatin potentiates antitumor activity of doxorubicin in murine melanoma via an apoptosis-dependent mechanism. Int J Cancer. 2002;100:111–118. doi: 10.1002/ijc.10440. [DOI] [PubMed] [Google Scholar]
  18. Freeman SR, Drake AL, Heilig LF, Graber M, McNealy K, Schilling LM, et al. Statins, fibrates, and melanoma risk: a systematic review and meta-analysis. J Natl Cancer Inst. 2006;98:1538–1546. doi: 10.1093/jnci/djj412. [DOI] [PubMed] [Google Scholar]
  19. Fukushima M. Prostaglandin J2 – anti-tumour and anti-viral activities and the mechanisms involved. Eicosanoids. 1990;3:189–199. [PubMed] [Google Scholar]
  20. Fukushima M. Biological activities and mechanisms of action of PGJ2 and related compounds: an update. Prostaglandins Leukot Essent Fatty Acids. 1992;47:1–12. doi: 10.1016/0952-3278(92)90178-l. [DOI] [PubMed] [Google Scholar]
  21. Furuhashi M, Hotamisligil GS. Fatty acid-binding proteins: role in metabolic diseases and potential as drug targets. Nat Rev Drug Discov. 2008;7:489–503. doi: 10.1038/nrd2589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Futaki N, Takahashi S, Yokoyama M, Arai I, Higuchi S, Otomo S. NS-398, a new anti-inflammatory agent, selectively inhibits prostaglandin G/H synthase/cyclooxygenase (COX-2) activity in vitro. Prostaglandins. 1994;47:55–59. doi: 10.1016/0090-6980(94)90074-4. [DOI] [PubMed] [Google Scholar]
  23. Gazzerro P, Proto MC, Gangemi G, Malfitano AM, Ciaglia E, Pisanti S, et al. Pharmacological actions of statins: a critical appraisal in the management of cancer. Pharmacol Rev. 2012;64:102–146. doi: 10.1124/pr.111.004994. [DOI] [PubMed] [Google Scholar]
  24. Glynn SA, O'Sullivan D, Eustace AJ, Clynes M, O'Donovan N. The 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitors, simvastatin, lovastatin and mevastatin inhibit proliferation and invasion of melanoma cells. BMC Cancer. 2008;8:9. doi: 10.1186/1471-2407-8-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Ivanov VN, Hei TK. Regulation of apoptosis in human melanoma and neuroblastoma cells by statins, sodium arsenite and TRAIL: a role of combined treatment versus monotherapy. Apoptosis. 2011;16:1268–1284. doi: 10.1007/s10495-011-0649-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Jacobs EJ, Newton CC, Thun MJ, Gapstur SM. Long-term use of cholesterol-lowering drugs and cancer incidence in a large United States cohort. Cancer Res. 2011;71:1763–1771. doi: 10.1158/0008-5472.CAN-10-2953. [DOI] [PubMed] [Google Scholar]
  27. Jagtap D, Rosenberg CA, Martin LW, Pettinger M, Khandekar J, Lane D, et al. Prospective analysis of association between use of statins and melanoma risk in the Women's Health Initiative. Cancer. 2012;118:5124–5131. doi: 10.1002/cncr.27497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jakobisiak M, Bruno S, Skierski JS, Darzynkiewicz Z. Cell cycle-specific effects of lovastatin. Proc Natl Acad Sci U S A. 1991;88:3628–3632. doi: 10.1073/pnas.88.9.3628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kidera Y, Tsubaki M, Yamazoe Y, Shoji K, Nakamura H, Ogaki M, et al. Reduction of lung metastasis, cell invasion, and adhesion in mouse melanoma by statin-induced blockade of the Rho/Rho-associated coiled-coil-containing protein kinase pathway. J Exp Clin Cancer Res. 2010;29:127. doi: 10.1186/1756-9966-29-127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kim DH, Kim EH, Na HK, Sun Y, Surh YJ. 15-Deoxy-Delta(12,14)-prostaglandin J(2) stabilizes, but functionally inactivates p53 by binding to the cysteine 277 residue. Oncogene. 2010;29:2560–2576. doi: 10.1038/onc.2010.8. [DOI] [PubMed] [Google Scholar]
  31. Koomen ER, Joosse A, Herings RM, Casparie MK, Bergman W, Nijsten T, et al. Is statin use associated with a reduced incidence, a reduced Breslow thickness or delayed metastasis of melanoma of the skin? Eur J Cancer. 2007;43:2580–2589. doi: 10.1016/j.ejca.2007.09.004. [DOI] [PubMed] [Google Scholar]
  32. Michalik L, Desvergne B, Wahli W. Peroxisome-proliferator-activated receptors and cancers: complex stories. Nat Rev Cancer. 2004;4:61–70. doi: 10.1038/nrc1254. [DOI] [PubMed] [Google Scholar]
  33. Mihos CG, Santana O. Pleiotropic effects of the HMG-CoA reductase inhibitors. Int J Gen Med. 2011;4:261–271. doi: 10.2147/IJGM.S16779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Minichsdorfer C, Hohenegger M. Autocrine amplification loop in statin-induced apoptosis of human melanoma cells. Br J Pharmacol. 2009;157:1278–1290. doi: 10.1111/j.1476-5381.2009.00298.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nakata S, Yoshida T, Shiraishi T, Horinaka M, Kouhara J, Wakada M, et al. 15-Deoxy-Delta12,14-prostaglandin J(2) induces death receptor 5 expression through mRNA stabilization independently of PPARgamma and potentiates TRAIL-induced apoptosis. Mol Cancer Ther. 2006;5:1827–1835. doi: 10.1158/1535-7163.MCT-06-0023. [DOI] [PubMed] [Google Scholar]
  36. Nielsen SF, Nordestgaard BG, Bojesen SE. Statin use and reduced cancer-related mortality. N Engl J Med. 2012;367:1792–1802. doi: 10.1056/NEJMoa1201735. [DOI] [PubMed] [Google Scholar]
  37. Nunez NP, Liu H, Meadows GG. PPAR-gamma ligands and amino acid deprivation promote apoptosis of melanoma, prostate, and breast cancer cells. Cancer Lett. 2006;236:133–141. doi: 10.1016/j.canlet.2005.05.009. [DOI] [PubMed] [Google Scholar]
  38. Paulitschke V, Gruber S, Hofstatter E, Haudek-Prinz V, Klepeisz P, Schicher N, et al. Proteome analysis identified the PPARgamma ligand 15d-PGJ2 as a novel drug inhibiting melanoma progression and interfering with tumor-stroma interaction. PLoS ONE. 2012;7:e46103. doi: 10.1371/journal.pone.0046103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pich C, Teiti I, Rochaix P, Mariame B, Couderc B, Favre G, et al. Statins reduce melanoma development and metastasis through MICA overexpression. Front Immunol. 2013;4:62. doi: 10.3389/fimmu.2013.00062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sacher J, Weigl L, Werner M, Szegedi C, Hohenegger M. Delineation of myotoxicity induced by 3-hydroxy-3-methylglutaryl CoA reductase inhibitors in human skeletal muscle cells. J Pharmacol Exp Ther. 2005;314:1032–1041. doi: 10.1124/jpet.105.086462. [DOI] [PubMed] [Google Scholar]
  41. Saito A, Saito N, Mol W, Furukawa H, Tsutsumida A, Oyama A, et al. Simvastatin inhibits growth via apoptosis and the induction of cell cycle arrest in human melanoma cells. Melanoma Res. 2008;18:85–94. doi: 10.1097/CMR.0b013e3282f60097. [DOI] [PubMed] [Google Scholar]
  42. Sarrabayrouse G, Synaeve C, Leveque K, Favre G, Tilkin-Mariame AF. Statins stimulate in vitro membrane FasL expression and lymphocyte apoptosis through RhoA/ROCK pathway in murine melanoma cells. Neoplasia. 2007;9:1078–1090. doi: 10.1593/neo.07727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Schicher N, Paulitschke V, Swoboda A, Kunstfeld R, Loewe R, Pilarski P, et al. Erlotinib and bevacizumab have synergistic activity against melanoma. Clin Cancer Res. 2009;15:3495–3502. doi: 10.1158/1078-0432.CCR-08-2407. [DOI] [PubMed] [Google Scholar]
  44. Shellman YG, Ribble D, Miller L, Gendall J, Vanbuskirk K, Kelly D, et al. Lovastatin-induced apoptosis in human melanoma cell lines. Melanoma Res. 2005;15:83–89. doi: 10.1097/00008390-200504000-00001. [DOI] [PubMed] [Google Scholar]
  45. Sieczkowski E, Lehner C, Ambros PF, Hohenegger M. Double impact on p-glycoprotein by statins enhances doxorubicin cytotoxicity in human neuroblastoma cells. Int J Cancer. 2010;126:2025–2035. doi: 10.1002/ijc.24885. [DOI] [PubMed] [Google Scholar]
  46. van der Spek E, Bloem AC, van de Donk NW, Bogers LH, van der Griend R, Kramer MH, et al. Dose-finding study of high-dose simvastatin combined with standard chemotherapy in patients with relapsed or refractory myeloma or lymphoma. Haematologica. 2006;91:542–545. [PubMed] [Google Scholar]
  47. Pawson AJ, Sharman JL, Benson HE, Faccenda E, Alexander SP, Buneman OP, et al. NC-IUPHAR. The IUPHAR/BPS Guide to PHARMACOLOGY: an expert-driven knowledgebase of drug targets and their ligands. Nucl. Acids Res. 2014;42:D1098–1106. doi: 10.1093/nar/gkt1143. (Database Issue): [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Surh YJ, Na HK, Park JM, Lee HN, Kim W, Yoon IS, et al. 15-Deoxy-Delta(1)(2),(1)(4)-prostaglandin J(2), an electrophilic lipid mediator of anti-inflammatory and pro-resolving signaling. Biochem Pharmacol. 2011;82:1335–1351. doi: 10.1016/j.bcp.2011.07.100. [DOI] [PubMed] [Google Scholar]
  49. Tan NS, Shaw NS, Vinckenbosch N, Liu P, Yasmin R, Desvergne B, et al. Selective cooperation between fatty acid binding proteins and peroxisome proliferator-activated receptors in regulating transcription. Mol Cell Biol. 2002;22:5114–5127. doi: 10.1128/MCB.22.14.5114-5127.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Thibault A, Samid D, Tompkins AC, Figg WD, Cooper MR, Hohl RJ, et al. Phase I study of lovastatin, an inhibitor of the mevalonate pathway, in patients with cancer. Clin Cancer Res. 1996;2:483–491. [PubMed] [Google Scholar]
  51. Urade Y, Eguchi N. Lipocalin-type and hematopoietic prostaglandin D synthases as a novel example of functional convergence. Prostaglandins Other Lipid Mediat. 2002;68–69:375–382. doi: 10.1016/s0090-6980(02)00042-4. [DOI] [PubMed] [Google Scholar]
  52. Veitinger M, Umlauf E, Baumgartner R, Badrnya S, Porter J, Lamont J, et al. A combined proteomic and genetic analysis of the highly variable platelet proteome: from plasmatic proteins and SNPs. J Proteomics. 2012;75:5848–5860. doi: 10.1016/j.jprot.2012.07.042. [DOI] [PubMed] [Google Scholar]
  53. Ward JE, Gould H, Harris T, Bonacci JV, Stewart AG. PPAR gamma ligands, 15-deoxy-delta12,14-prostaglandin J2 and rosiglitazone regulate human cultured airway smooth muscle proliferation through different mechanisms. Br J Pharmacol. 2004;141:517–525. doi: 10.1038/sj.bjp.0705630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Werner M, Sacher J, Hohenegger M. Mutual amplification of apoptosis by statin-induced mitochondrial stress and doxorubicin toxicity in human rhabdomyosarcoma cells. Br J Pharmacol. 2004;143:715–724. doi: 10.1038/sj.bjp.0705928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Xu A, Wang Y, Xu JY, Stejskal D, Tam S, Zhang J, et al. Adipocyte fatty acid-binding protein is a plasma biomarker closely associated with obesity and metabolic syndrome. Clin Chem. 2006;52:405–413. doi: 10.1373/clinchem.2005.062463. [DOI] [PubMed] [Google Scholar]
  56. Yano M, Matsumura T, Senokuchi T, Ishii N, Murata Y, Taketa K, et al. Statins activate peroxisome proliferator-activated receptor gamma through extracellular signal-regulated kinase 1/2 and p38 mitogen-activated protein kinase-dependent cyclooxygenase-2 expression in macrophages. Circ Res. 2007;100:1442–1451. doi: 10.1161/01.RES.0000268411.49545.9c. [DOI] [PubMed] [Google Scholar]
  57. Zellner M, Winkler W, Hayden H, Diestinger M, Eliasen M, Gesslbauer B, et al. Quantitative validation of different protein precipitation methods in proteome analysis of blood platelets. Electrophoresis. 2005;26:2481–2489. doi: 10.1002/elps.200410262. [DOI] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES