Skip to main content
NCBI home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2014 Nov 28;593(Pt 1):197–215. doi: 10.1113/jphysiol.2014.277814

Activation of muscarinic receptors by ACh release in hippocampal CA1 depolarizes VIP but has varying effects on parvalbumin-expressing basket cells

L Andrew Bell 1, Karen A Bell 1, A Rory McQuiston 1,✉
PMCID: PMC4293063  PMID: 25556796

Abstract

We investigated the effect of acetylcholine release on mouse hippocampal CA1 perisomatically projecting interneurons. Acetylcholine was optogenetically released in hippocampal slices by expressing the excitatory optogenetic protein oChIEF-tdTomato in medial septum/diagonal band of Broca cholinergic neurons using Cre recombinase-dependent adeno-associated virally mediated transfection. The effect of optogenetically released acetylcholine was assessed on interneurons expressing Cre recombinase in vasoactive intestinal peptide (VIP) or parvalbumin (PV) interneurons using whole cell patch clamp methods. Acetylcholine released onto VIP interneurons that innervate pyramidal neuron perisomatic regions (basket cells, BCs) were depolarized by muscarinic receptors. Although PV BCs were also excited by muscarinic receptor activation, they more frequently responded with hyperpolarizing or biphasic responses. Muscarinic receptor activation resulting from ACh release increased the frequency of spontaneous inhibitory postsynaptic currents (sIPSCs) in downstream hippocampal CA1 pyramidal neurons with peak instantaneous frequencies occurring in both the gamma and theta bandwidths. Both PV and VIP BCs contributed to the increased sIPSC frequency in pyramidal neurons and optogenetic suppression of PV or VIP BCs inhibited sIPSCs occurring in the gamma range. Therefore, we propose acetylcholine release in CA1 has a complex effect on CA1 pyramidal neuron output through varying effects on perisomatically projecting interneurons.

Key points.

  1. Optogenetically released acetylcholine (ACh) from medial septal afferents activates muscarinic receptors on both vasoactive intestinal peptide-expressing (VIP) and parvalbumin-expressing (PV) basket cells (BCs) in mouse hippocampal CA1.

  2. ACh release depolarized VIP BCs whereas PV BCs depolarized, hyperpolarized or produced biphasic responses.

  3. Depolarizing responses in VIP or PV BCs resulted in increased amplitudes and frequencies of spontaneous inhibitory postsynaptic currents (sIPSCs) in CA1 pyramidal neurons.

  4. The instantaneous frequency of sIPSCs that result from excitation of VIP or PV BCs primarily occurred within the low gamma frequency band (25–50 Hz).

Introduction

Cholinergic projections from the medial septum/diagonal band of Broca complex (MS/DBB) play an important role in network functioning, theta oscillations and memory formation in the hippocampus (Blokland et al. 1992; Lee et al. 1994; Monmaur et al. 1997; Keita et al. 2000; Levin, 2002; Atri et al. 2004; Hasselmo & Giocomo, 2006). Furthermore, dysfunction of the septohippocampal cholinergic system is a hallmark of Alzheimer’s disease (Bierer et al. 1995). Thus, based on the physiological and pathophysiological importance of the septohippocampal cholinergic system, it is essential to gain a complete understanding of how acetylcholine (ACh) affects hippocampal network function.

ACh released from MS/DBB terminals may affect hippocampal CA1 network function in multiple ways through effects on pyramidal neurons, interneurons, astrocytes and presynaptic terminals (Cobb & Davies, 2005; Teles-Grilo Ruivo & Mellor, 2013). The effect that MS/DBB cholinergic inputs may have on inhibitory interneuron function through the activation of muscarinic receptors is particularly complex. Presynaptically, cholinergic muscarinic receptor activation can inhibit the release of GABA onto pyramidal neurons (Pitler & Alger, 1992; Behrends & ten Bruggencate, 1993). Postsynaptically, interneurons can respond to muscarinic receptor activation by depolarizing, hyperpolarizing, producing biphasic (hyperpolarization followed by depolarization) membrane responses, or by producing afterdepolarizations (Parra et al. 1998; McQuiston & Madison, 1999a,b1999b; Lawrence et al. 2006; Widmer et al. 2006). Moreover, cholinergic inputs have been shown to induce rhythmic firing in subsets of interneurons (Nagode et al. 2011, 2014). Nonetheless, how specific interneuron subtypes are affected by ACh release remains unclear as evidenced by recent optogenetic studies that revealed unanticipated effects of ACh released from MS/DBB terminals in hippocampal CA1 (Bell et al. 2011; Gu & Yakel, 2011; Nagode et al. 2011; Bell et al. 2013). As an example, previous studies using electrical stimulation in hippocampal CA1 had suggested that nicotinic responses in interneurons were primarily mediated by α7 nicotinic receptors (Alkondon et al. 1998; Frazier et al. 1998; Stone, 2007). However, subsequent optogenetic studies suggested that ACh released from MS/DBB terminals infrequently activate α7 receptors and preferentially activate α4β2-containing nicotinic receptors (α4β2*) (Bell et al. 2011). Therefore, CA1 interneurons may be differentially affected by ACh release depending on their subtype, location and receptor response types, and this requires further study.

Recent optogenetic studies in our lab have investigated the impact of ACh released from MS/DBB terminals on hippocampal CA1 inhibitory interneurons (Bell et al. 2011, 2013). These studies examined the muscarinic receptors that mediated interneuron responses without clearly identifying the interneuron subtypes that produced particular response types. In this report, we used Cre-driver and fluorescent protein reporter mice to examine the impact that ACh released from MS/DBB terminals has on perisomatically projecting (basket cells, BCs) interneurons that express parvalbumin (PV) and vasoactive intestinal peptide (VIP). Our data shows that both PV and VIP BCs can be excited by the activation of muscarinic receptors by ACh release. However, PV BCs were more frequently hyperpolarized or produced a biphasic response. Furthermore, muscarinic activation of both PV and VIP BCs contributed to an increase in gamma but not theta IPSC frequencies in pyramidal cells (PCs) following ACh release. Therefore, activation of muscarinic receptors by ACh release has complex effects on perisomatic inhibition of hippocampal CA1 PCs.

Methods

Animals

Viptm1(cre)Zjh/J (VIP-Cre, JAX Stock No. 010908), B6;129P2-Pvalbtm1(cre)Arbr/J (PV-Cre, JAX Stock No. 008069), B6;129S6-Chattm1(cre)Lowl/J (Chat-Cre, JAX Stock No. 006410), B6.Cg-Gt(ROSA)26Sortm3(CAG-EYFP)Hze/J (ROSA26-YFP, JAX Stock No. 007903), and B6;129S-Gt(ROSA)26Sortm35.1(CAG-aop3/GFP)Hze/J (ROSA26-Arch-GFP, JAX Stock No. 012735) mice (Hippenmeyer et al. 2005; Madisen et al. 2010; Rossi et al. 2011; Taniguchi et al. 2011; Madisen et al. 2012) used in these studies were housed in an animal care facility approved by the American Association for the Accreditation of Laboratory Animal Care. Animal experimental procedures followed a protocol approved by the Institutional Animal Care and Use Committee of Virginia Commonwealth University (AD20205). This protocol adhered to the ethical guidelines described in the Guide for the Care and Use of Laboratory Animals (8th edition). All efforts were made to minimize animal suffering and to reduce the number of animals used.

Breeding strategies and choline acetyltransferase (Chat) immunofluorescence

Two different breeding strategies were developed for these studies. Studies examining muscarinic responses in interneuron subtypes utilized a triple cross consisting of Chat-Cre × PV-Cre× yellow fluorescent protein (YFP)-reporter (Chat-Cre;PV-Cre;ROSA26-YFP) or alternatively, Chat-Cre × VIP-Cre × YFP-reporter (Chat-Cre;VIP-Cre;ROSA26-YFP). Studies that utilized archaerhodopsin (Arch)-green fluorescent protein (GFP) mice (ROSA26-Arch-GFP) to silence specific interneuron subtypes in CA1 used a triple cross consisting of Chat-Cre × PV-Cre × Arch-GFP (Chat-Cre;PV-Cre;ROSA26-Arch-GFP) or Chat-Cre × VIP-Cre × Arch-GFP (Chat-Cre;VIP-Cre;ROSA26-Arch-GFP). Homozygous mice containing Cre transgenes were crossed together, eg. Chat-Cre × VIP-Cre, and the F1 progeny that were heterozygous for both alleles were crossed with either homozygous YFP reporter or homozygous Arch-GFP strains. This breeding strategy, along with specific primers (Table 1) for mutant alleles of Chat-Cre, PV-Cre and VIP-Cre, allowed us to genotype for the specific Cre-targeted insertions. Control genotyping using specific Cre primers on each cross showed no cross-reaction in the PCR products (data not shown).

Table 1.

PCR primers used to genotype mouse triple crosses

Mouse strain Forward primer Reverse primer Source
Chat-Cre 006410 5′ CCAACAGCAAAGGAAAGAGC 3′ 5′ TTCAAGAAGCTTCCAGAGGAAC 3′ Custom
Parv-Cre 008069 5′ CAGCCTCTGTTCCACATACACT 3′ 5′ AGTACCAAGCAGGCAGGAGA 3′ Custom
VIP-Cre 010908 5′ TGGTGCGCCTGCTGGAAG 3′ 5′ CGGCCGCTCTAGAACTAGTGGA 3′ Custom
ARCH-GFP 012735 5′ CTTCTCGCTAAGGTGGATCG 3′ 5′ CACCAAGACCAGAGCTGTCA 3′ Jax.org
YFP reporter 007903 5′ ACATGGTCCTGCTGGAGT TC 3′ 5′ GGCATTAAAGCAGCGTATCC 3′ Jax.org
Open in a new tab

Immunopositive choline acetyltransferase (Chat) neurons in CA1 were very sparse (mean number per section = 1.13, n = 9 slices across 3 animals). The few Chat immunopositive neurons that were present in the hippocampus were found at or near the border of stratum lacunosum-moleculare (SLM) and stratum radiatum (SR) and co-localized with YFP labelling in VIP-Cre interneurons (n = 3, see Fig. 1D–F).

Figure 1. Activation of muscarinic receptors by ACh release excites CA1 VIP BCs but produces varying responses in PV interneurons.

Figure 1

Open in a new tab

A and B, left, optogenetically released ACh (120 × 20 Hz) depolarized VIP BCs (black trace). Depolarizations were blocked by 10 μm of the muscarinic antagonist atropine (green trace). VIP BCs (middle) had varying electrophysiological phenotypes with some having prominent hyperpolarizing sags (bottom) whereas others did not (top). A and B, right, optogenetically responsive VIP BC axon terminals (red) were localized to the stratum pyramidale (SP). SLM, stratum lacunosum-moleculare; SR, stratum radiatum; SO, stratum oriens. C, fluorescent image of oChIEF-tdTomato infection in MS/DBB after stereotaxic injection of AAV (scale bar = 200 μm). D, anti-Chat immunopositive interneurons (F, red, white arrows) coexpressed with VIP-Cre-driven YFP fluorescence (E, YFP cells amplified with anti-GFP488, scale bar = 100 μm) and were found to be near the border of SR and SLM.

Generation and stereotaxic injection of rAAV-Flex-rev-oChIEF-tdTomato into the MS/DBB of Chat-Cre mice

A recombinant adeno-associated virus (rAAV, serotype 1, 1.05 or 1.8 × 1013 voltage clamp ml–1 titre) expressing FLEXed oChIEF-tdTomato was generated using a previously described method (Bell et al. 2011) in order to selectively express oChIEF-tdTomato in infected cells that also expressed Cre recombinase. Mice were initially anaesthetized via intraperitoneal injection of ketamine (100 mg kg−1 i.p.) and xylazine (2.5 mg kg−1 i.p.). Anaesthesia was maintained with O2 supplemented with isoflurane.

For injections into the MS/DBB, an incision was made in the skin along the midsagittal suture, and a small hole was drilled in the skull overlying the septum. An aluminosilicate glass pipette containing rAAV-Flex-rev-oChIEF-tdTomato was lowered to the level of the MS/DBB, 1.0 mm rostral to Bregma and infused at a rate of 100 nl min−1 using a software-driven injectomate (Neurostar, Sindelfingen, Germany). In total, 7 × 100 nl injections were made between 3.75 and 5.0 mm in depth. Ten to 15 days post viral injection, 42- to 70-day-old mice were killed for experimentation.

Preparation of hippocampal slices

Brain slices were obtained by methods previously described (Bell et al. 2011). In brief, horizontal slices containing the mid-temporal hippocampus were cut at 350–450 μm on a Leica VT1200 (Leica Microsystems, Buffalo Grove, IL, USA). Sections were incubated in a holding chamber kept at 36°C for 30 min and then allowed to return to room temperature. The holding and recording chamber solution consisted of normal saline (in mm): NaCl 125, KCl 3.0, CaCl2 1.2, MgSO4 1.2, NaHPO4 1.2, NaHCO3 25, glucose 25, bubbled with 95% O2–5% CO2. Recordings were performed at 32–35°C.

Light-evoked release of acetylcholine from MS/DBB cholinergic axon terminals and light-evoked silencing of CA1 interneuron subtype populations

Cholinergic terminals expressing oChIEF-tdTomato were stimulated by blue light and interneurons expressing Arch-GFP were hyperpolarized by yellow light. Both light paths were transmitted through the epi-illumination light path of an Olympus BX51WI microscope and a ×10 water immersion objective (0.3 NA). Blue light flashes (1 ms in duration) and yellow light pulses (4 s in duration) were generated from light-emitting diodes (LEDs) (UHP-microscope-LED-460 or UHP-T-LED-White filtered by an HQ 575/50x excitation filter, respectively, Prizmatix Modiin-Ilite, Givat Shmuel, Israel). Blue flashes were given 120 times at 20 Hz. This frequency is consistent with single unit recordings from putative cholinergic neurons in awake behaving rats (Brazhnik & Fox, 1999), although others have reported lower frequencies (Simon et al. 2006). We used 120 stimuli because a larger number of stimuli were required to consistently generate muscarinic depolarizations in CA1 interneurons (Bell et al. 2013) and consequently elicited optimal IPSCs in pyramidal neurons. Blue or yellow light exiting the LEDs was reflected or passed through a dichroic mirror (515dcxru, Chroma Technology, Bellows Falls, VT, USA) and was focused into the epi-illumination light path of the Olympus BX51WI microscope and back aperture of the ×10 water immersion objective (0.3 NA) using an optiblock beam combiner (Prizmatix) and a dichroic mirror (700dcxxr, Chroma Technology) in the filter turret.

Electrophysiological measurements

Whole cell patch clamp recordings from hippocampal CA1 interneurons were performed using patch pipettes (2–5 MΩ) pulled from borosilicate glass (no. 8250 1.65 mm/1.0 mm) on a Narishige PC-10 pipette puller filled with (in mm): KCl 55, potassium gluconate 70, NaCl 8, MgATP 2, NaGTP 0.1, Hepes 10, K4-BAPTA 2, QX314 chloride 10, biocytin 0.1% or potassium gluconate 130, NaCl 8, MgATP 2, NaGTP 0.1, Hepes 10, K4-BAPTA 0.1, biocytin 0.1%. Elevated chloride internal solution was only used for recordings of spontaneous inhibitory postsynaptic currents (sIPSCs) in pyramidal neurons. Membrane potentials and/or currents were measured with a Model 2400 patch clamp amplifier (A-M Systems, Port Angeles, WA, USA) and converted into a digital signal by a PCI-6040E A/D board (National instruments, Austin, TX, USA). WCP Strathclyde Software was used to store and analyse membrane potential and current responses on a PC computer (courtesy of Dr J. Dempster, Strathclyde University, Glasgow, UK). sIPSCs were detected using Mini Analysis (Synaptosoft, Fort Lee, NJ, USA). The detection and exclusion of spontaneous events by Mini Analysis was determined by a variety of criteria. First, events were detected by finding local maxima within a specified time epoch. Events were then accepted or rejected by a variety of measures including a greater than 10 pA amplitude and an event area threshold that was determined empirically per experiment. All detection parameters were adjusted per experiment by visually examining spontaneous events to ensure that all events were detected by the software, including events that summated on top of one another. The time period to search for the local maximum, the time period to find a baseline value, the number of values averaged for the peak amplitude and the threshold for event area acceptance were all modified to ensure reliable detection and measurement. Further analysis was performed with Originpro 8.1 (OriginLab Corp., Northampton, MA, USA), Excel (Microsoft, Redmond, WA, USA) and SPSS 20.0 (IBM, Armonk, NY, USA).

Immunofluorescence: morphological reconstruction of interneurons displaying muscarinic responses and amplification of fluorescent markers

Slices with biocytin-labelled cells were fixed in 4% paraformaldehyde (Boston BioProducts, Ashland, MA, USA) and incubated with streptavidin Alexa Fluor 633 (Life Technologies, Grand Island, NY, USA) in phosphate buffered saline (PBS) with Triton-X 100 as previously described (Bell et al. 2011). Processed slices were then reconstructed using a Zeiss LSM 710 confocal microscope (Carl Zeiss, Jena, Germany). Alexa Fluor 633 was excited with the 633 nm line of a HeNe 5 mW laser and cells were visualized using a ×20 dry lens (0.8 NA, voxel dimensions 0.2 μm × 0.2 μm × 1.1 μm). The imaged interneurons were traced using the Autoneuron module within the Neurolucida program (MBP, Burlington, VT, USA). For amplification of YFP-labelled interneurons, 1:200 dilution of rabbit anti-GFP Alexa Fluor 488 (Life Technologies) in goat blocking buffer (10% normal serum, 2% bovine serum albumin, 0.4% Triton-X 100 in 0.1 m phosphate buffer) was added to fixed and washed slices for overnight incubation. For identification of Chat-immunopositive neurons, slices were incubated for 3 days in 1:200 dilution of the primary antibody, goat anti-Chat (AB144P, EMD Millipore, Billerica, MA, USA), and overnight in 1:1000 rabbit anti-goat Alexa Fluor 633 secondary antibody (Life Technologies) in rabbit blocking buffer. Before and after primary and secondary antibody incubations, slices were washed in PBS (3 × 60 min). Slices were mounted in either Prolong Gold (Life Technologies) or VECTASHIELD hard mount (Vector Laboratories, Burlingame, CA, USA). To count the number of Chat immunopositive neurons, three 350 μm coronal slices containing dorsal and ventral regions of the hippocampus were taken with a ×4 objective (72 pixels per inch) from three animals, and the total number of Chat-immunopositive cells per section included both hemispheres.

Statistics and data analysis

Data were analysed using WCP software and Mini Analysis for electrophysiological measurements. Statistics were performed using SPSS 20.0 (IBM). Statistical significances for groups of three or more were determined using a one-way ANOVA with Bonferroni post hoc tests or a Fisher’s exact test. The averaged statistical significances for groups of two were determined with two-tailed t tests. For averaged time-dependent sIPSC frequency data, a one-way ANOVA was done to test whether the averaged sIPSC frequency changed over the course of each experiment. For assessing differences between cumulative probability distributions, a Kolmogorov–Smirnov (K-S) test was done to test whether atropine significantly shifted the distribution of interevent intervals (IEIs). Differences were determined to be statistically significant for P values less than 0.05. All data were reported as the mean, standard error of the mean (SEM). Asterisks were as follows unless otherwise noted, ***P < 0.001, **P < 0.01, *P < 0.05.

Chemicals

All chemicals were purchased from VWR (Radnor, PA, USA) unless otherwise indicated. SR 95531 hydrobromide (gabazine), QX314 chloride and AF-DX 116 (selective M2-muscarinic receptor antagonist) were obtained from Tocris Bioscience (Ellisville, MO, USA). 6,7-Dinitroquinoxaline-2,3-dione (DNQX) and dl-2-amino-5-phosphonopentanoic acid (APV) were from Ascent Scientific (Bristol, UK). Biocytin (B-1592) was purchased from Life Technologies.

Results

Interneurons that innervate the perisomatic region of CA1 pyramidal cells (basket cells, BCs) can be categorized into different cell types based on their morphology, calcium-binding protein and neuropeptide content (Klausberger & Somogyi, 2008). There are two broad classes of basket cells, those that that fire high frequency action potentials and express the calcium binding protein parvalbumin (PV), and those that that express the neuropeptide cholecystokinin (CCK). The CCK basket cells can be further subdivided into those that express vasoactive intestinal peptide (VIP), calbindin, or vesicular glutamate transporter 3 (Somogyi et al. 2004). Using Cre-driver lines available at the time of this study, we investigated the effects of ACh on basket cells that expressed PV (Hippenmeyer et al. 2005) and VIP (Taniguchi et al. 2011) using whole cell patch clamp recordings and optogenetics in acute hippocampal brain slices. To target whole cell patch clamp recordings from VIP or PV interneurons, we utilized Chat-Cre;VIP-Cre;ROSA26-YFP and Chat-Cre;PV-Cre;ROSA26-YFP animals (see Methods) that expressed YFP in VIP or PV interneurons. To optogenetically release ACh from MS/DBB cholinergic terminals in hippocampal brain slices, we expressed the excitatory optogenetic protein oChIEF-tdTomato in MS/DBB cholinergic neurons through Cre-dependent rAAV-mediated transfection. Following whole cell patch clamp measurements, interneurons were morphologically reconstructed to ensure that the interneuron from which we recorded was a perisomatically projecting basket cell (Figs 1A and B, and 2A–C).

Figure 2. Activation of muscarinic receptors by ACh produces varying muscarinic responses in CA1 PV interneurons.

Figure 2

Open in a new tab

Optogenetically released ACh from MS/DBB terminals evoked slow depolarizations (A), hyperpolarizations (B), or biphasic responses in different subsets of PV interneurons (C) (grey traces). All response types were inhibited by the muscarinic receptor antagonist atropine (10 μm, green trace). A–C, middle, all PV interneurons, irrespective of muscarinic response type, displayed high frequency non-accommodating action potential firing patterns and a lack of a hyperpolarizing sag in response to depolarizing and hyperpolarizing current injections, respectively. A–C, right, all PV interneurons had axonal arborization confined to SP regardless of the muscarinic response type (scale bars = 100 μm). D, histogram illustrating the distribution of response types across PV and VIP BCs. PV interneurons (n = 27) exhibited either muscarinic-dependent depolarizations (n = 5, 19%, light grey), hyperpolarizations (n = 9, 33%, dark grey), or biphasic responses (n = 13, 48%, black). All VIP BCs (10 of 10) exhibited muscarinic-dependent depolarizations (light grey). E, depolarizations in VIP BCs (black) and PV BCs (grey) were blocked by bath application of atropine (green bars). The muscarinic response amplitudes in parvalbumin interneurons (black bars) were significantly smaller than the muscarinic responses in VIP BCs (grey bars). Muscarinic hyperpolarizing responses (including biphasic component) in PV interneurons were blocked by bath application of atropine (F, hyperpolarization; G, biphasic).

ACh released from MS/DBB terminals exclusively produced muscarinic slow depolarizations in VIP basket cells

We first examined the effect of ACh release on VIP BCs. We found that all (10 of 10) VIP BCs had slow depolarizations (Fig. 1A and B, black trace, Fig. 2D) in response to ACh release (120 × 20 Hz pulses). These responses were blocked by atropine (10 μm) indicating they were due to muscarinic receptor activation (Fig. 1A and B, green trace, Fig. 2E, green bar). In 4 of 10 cells, the muscarinic slow depolarization was large enough to generate action potentials during and following blue light flashes (no significant difference in resting membrane potentials was found between interneurons that generated action potentials (APs) and those that did not (AP generating: 60.1 ± 2.3 mV, vs. non-AP generating: 62.5 ± 3.2 mV, t test, n.s. (P = 0.678)). In order to characterize the physiological properties of each VIP BC, we measured membrane potential responses to a series of hyperpolarizing and depolarizing current steps. The electrophysiological properties of VIP BCs were not uniform (Table 2). Some cells produced regular action potential firing patterns and a hyperpolarizing sag (Fig. 1B) whereas others produced irregular action potential firing patterns and either the presence or absence of a hyperpolarizing sag (Fig. 1A). Figure 1A and B (right panel) shows morphological reconstructions of two VIP/BC interneurons that had cell bodies near stratum pyramidale (SP) and dense axonal projections in SP. One VIP/BC had very short dendritic processes in SP and SR (Fig. 1A) whereas the other had longer more extensive dendritic processes spanning all layers of CA1 (Fig. 1B).

Table 2.

Electrophysiological properties of VIP- and PV-containing interneurons

Vm (mV) Rm (MΩ) Sag ratio Accommodation AP half-width (ms) Frequency max (Hz)
PV interneurons −59.2 ± 1.1 114.8 ± 11.5* 1.01 ± 0.01* 0.07 ± 0.13* 0.4 ± 0.05* 108.8 ± 13.3*
VIP interneurons −61.9 ± 0.9 286.6 ± 24.9 1.12 ± 0.03 0.17 ± 0.36 1.0 ± 0.1 59.4 ± 4.7
Open in a new tab

In order to be able to selectively express oChIEF-tdTomato in cholinergic neurons of the MS/DBB and to fluorescently identify VIP interneurons in CA1, we crossed three lines of mice: Chat-Cre, VIP-Cre and YFP Cre-reporter lines. All lines used in this study have been extensively characterized by the Allen Institute for Brain Science (http://connectivity.brain-map.org/transgenic/search/basic) (Harris et al. 2014). In VIP-Cre mice, neither Cre recombinase nor Cre-driven fluorescent reporter expression has been detected in the MS/DBB. Furthermore, injection of FLEXed oChIEF-tdTomato into the MS/DBB of Chat-Cre;VIP-Cre;ROSA26-YFP animals never resulted in oChIEF-tdTomato expression outside the MS/DBB (Fig. 1C). However, Chat-expressing neurons have been described in the hippocampus (Frotscher et al. 2000). In the neocortex, Chat-expressing interneurons were found exclusively in VIP interneurons forming a subset of VIP-expressing cells (Porter et al. 1998; Gonchar et al. 2007). To examine whether this is also the case in the hippocampus, we used immunofluorescence to determine the presence of Chat in hippocampal tissue of VIP-Cre;ROSA26-YFP animals (Fig. 1D–F). We discovered that immunopositive Chat cells were very sparse in the hippocampus (mean number per section = 1.13, n = 9 sections, 3 animals) and were located near the SLM/SR border (Fig. 1F). Furthermore, all Chat-immunopositive cells displayed VIP-YFP fluorescence indicating that Chat interneurons in the hippocampus were exclusively found in VIP cells and probably make up a subset of VIP interneurons (Fig. 1D–F).

ACh released from MS/DBB terminals produced varying muscarinic effects on the membrane potential of PV basket cells

We next examined the effect of ACh release on the membrane potential of YFP-expressing PV interneurons in hippocampal CA1. To do this we used a similar strategy described for experiments involving VIP-expressing interneurons. We crossed three lines of mice, Chat-Cre, PV-Cre and YFP reporter mouse lines. This permitted us to visualize PV interneurons via YFP fluorescence. The PV cells were easily distinguished from the very few Chat-YFP cells in hippocampal CA1 by their location; PV cells were located in SP or stratum oriens (SO) where Chat cells were mostly located at the SR/SLM border. Also, they were distinguishable by their firing properties; PV cells were fast spiking and Chat cells were irregularly spiking. Furthermore, all interneuron recordings were confirmed by post hoc anatomical reconstructions. One potential caveat of this experimental design was that following rAAV injection, oChIEF-tdTomato was expressed in both cholinergic neurons and a subset of GABAergic projection neurons of the MS/DBB. The GABAergic projection from the MS/DBB has been shown to be mediated entirely by GABAA receptors with no contribution from GABAB receptors (Toth et al. 1997). Therefore, to eliminate confounding effects of the GABAergic projection, we performed all experiments in the presence of 10 μm gabazine. We also included 30 μm DNQX and 50 μm APV in all experiments to block ionotropic glutamatergic transmission and eliminate possible hyperexcitability following GABAA receptor inhibition. Furthermore, ionotropic glutamatergic blockers could serve to inhibit the possible co-release of glutamate from MS/DBB terminals (Sotty et al. 2003; Huh et al. 2010), although no effects of DNQX and APV have been observed in CA1 interneurons following the optogenetic activation of cholinergic terminals (Bell et al. 2013).

We found that, in CA1 PV interneurons (n = 26), optogenetically released ACh (120 × 20 Hz pulses) generated slow depolarizations (19%, Fig. 2A, grey trace), hyperpolarizations (33%, Fig. 2B, grey trace), or biphasic responses (48%, Fig. 2C, grey trace). These responses were all inhibited by atropine (10 μm) (depolarization: t test, P = 0.043, n = 5; hyperpolarization: t test, P = 0.0008, n = 9; biphasic: t test, P = 0.0006 and 0.0009, depolarization and hyperpolarization phases, respectively, n = 13) suggesting that they were mediated by muscarinic receptor activation (Fig. 2A–C, E–G, green traces and bars). Similar to our previous findings (Bell et al. 2013), the GABAB receptor antagonist CGP 35348 (10 μm) had no effect on the hyperpolarizing response in CA1 PV interneurons, suggesting that the hyperpolarizations resulted from the direct activation of muscarinic receptors on PV interneurons (n = 2, data not shown). The average amplitude of muscarinic depolarizations in PV interneurons was smaller than depolarizing muscarinic responses in VIP BCs in CA1 (Fig. 2E) (slow depolarization: 1.52 ± 0.19 mV, t test, P = 0.008, n = 5 PV and 8 VIP BCs). Therefore, in contrast to the single depolarizing muscarinic response type observed in VIP BC interneurons, PV interneurons were more diverse in their responses to the optogenetic release of ACh.

Each PV interneuron that responded to ACh was given a series of depolarizing and hyperpolarizing current steps in order to characterize its physiological properties (Table 2). PV interneurons (n = 27) had significantly lower input resistance (P = 0.031), larger sag ratio (P = 0.012), narrower AP half-width (P = 0.009), and higher AP frequency (P = 0.039) at 160 pA than VIP interneurons (n =  8) (unpaired t tests, Table 2). All PV interneurons with muscarinic responses had fast-spiking characteristics with little hyperpolarizing sag. Morphological reconstruction of each PV interneuron confirmed that the PV interneurons from which we recorded innervated the perisomatic region of CA1 pyramidal neurons (Fig. 2A–C). Therefore, PV interneurons with similar morphological and electrophysiological properties can have differing responses to the activation of muscarinic receptors by ACh release.

Release of ACh results in disynaptic inhibition of CA1 pyramidal neurons through muscarinic receptor-mediated excitation of perisomatic VIP and PV interneurons

It has been previously shown that ACh release in hippocampal CA1 results in muscarinic-mediated disynaptic inhibition of CA1 pyramidal neurons (Nagode et al. 2011). Because this disynaptic inhibition was sensitive to endocannabinoids, these findings have been proposed to result, in part, from the activation of CCK-expressing basket cells (CCK BCs). However, the effect of ACh release on other subtypes of interneurons that innervate pyramidal neurons has not been thoroughly investigated.

ACh released by long bursts of repetitive blue flashes (120 × 20 Hz) elicited a barrage of sIPSCs in CA1 pyramidal neurons of both Chat-Cre;PV-Cre;Arch-GFP (Fig. 3Aa) and Chat-Cre;VIP-Cre;ROSA26-Arch-GFP (Fig. 3Ba) animals. This could be measured as a decrease in interevent intervals (IEIs) (Fig. 3C, t test, P = 0.0002, n = 32) and an increase in the amplitude of the sIPSCs (Fig. 3D, t test, P = 0.0004, n = 32) and persisted in the presence of glutamate antagonists APV and DQNX, which was included in all experiments that measured sIPSCs. We found that the time to onset and duration of the barrages following the first blue light flash varied considerably across all cells (time to onset: 4.67 ± 2.51 s and duration: 18.02 ± 5.11 s). When comparing barrages in Chat-Cre;PV-Cre;ROSA26-Arch-GFP, Chat-Cre;ROSA26-Arch-GFP, and Chat-Cre;VIP-Cre;ROSA26-Arch-GFP animals, there was not a significant difference in the time to onset or duration of the barrages. However, within a single experiment a robust barrage of sIPSCs could be consistently generated when light pulses were delivered once every 2 min for up to 25 min. The barrage of sIPSCs was inhibited by atropine indicating that they were mediated by muscarinic receptors (Fig. 3C and D, t test, n.s. (P = 0.78), n = 10; Fig. 3Ac and d, and Bc and d, K-S test, P = 0.002).

Figure 3. ACh release increases sIPSC frequency and amplitudes in CA1 pyramidal neurons via a muscarinic-dependent mechanism.

Figure 3

Open in a new tab

A and B, left, schematic diagrams illustrating the experimental design for Aa–d and Ba–d. Aa and Ba, voltage clamp recordings from pyramidal neurons in a Chat-Cre;PV-Cre;ROSA26-Arch-GFP (A, CPA) and Chat-Cre;VIP-Cre;ROSA26-Arch-GFP (B, CVA) animal demonstrating that ACh release (blue bars, 1 ms flashes, 120 × 20 Hz) resulted in an increase in sIPSCs (black trace). A raster plot (bottom) indicates the timing of individual sIPSCs. Ab and Bb, the increase sIPSC frequency by ACh release was blocked by 10 μm atropine (green trace, raster plot below). Ac and Bc, a cumulative probability plot of interevent interval for control (black) and atropine (green) conditions. Ad and Bd, the average interevent interval decreases in response to ACh release from MS/DBB terminals. C and D, histograms demonstrating that ACh release significantly decreased the sIPSC interevent interval (C, black bar) and increased the sIPSC amplitude (D, black bar). The effect of ACh release on sIPSC interevent interval and amplitudes was blocked by 10 μm atropine (C and D, green bars).

To identify interneurons that contribute to muscarinic receptor-mediated sIPSC barrages in CA1 pyramidal neurons, VIP-Cre or PV-Cre mice were crossed to Arch-GFP mice to optogenetically suppress their activity with yellow light. Interneurons that expressed Arch responded to fast repetitive blue light flashes (120 × 20 Hz) with very small hyperpolarizations (average amplitude −1.2 ± 0.2 mV, n = 5) (Fig. 4D, inset). In contrast, a 4 s yellow light pulse caused a large hyperpolarization (average amplitude −21.2 ± 3.2 mV, n = 5) (Fig. 4D) that was capable of suppressing interneuron activity (Fig. 4E) that could be observed by a decrease in sIPSC frequency in CA1 pyramidal neurons (Fig. 4G). A potential problem with the experimental design arose from the possible co-expression of oChIEF and Arch in ACh terminals. However, the potential presence of Arch in cholinergic terminals appeared to have no effect on ACh released by blue light flashes (Fig. 4Ga). Furthermore, the presence of Arch in MS/DBB neurons transfected with oChIEF-tdTomato did not prevent the reliable optogenetic activation of action potentials (n = 4) (Fig. 4B). Another potential problem occurred in experiments involving the Chat-Cre;PV-Cre;ROSA26-Arch-GFP mouse line crosses. Injection of AAV into the MS/DBB resulted in the expression of oChIEF-tdTomato in cholinergic terminals and a subset of GABAergic projections to hippocampal CA1. However, because MS/DBB GABAergic projections are mediated solely by GABAA receptors (Toth et al. 1997), possible GABA release from MS/DBB terminals will only influence interneuron activity during the blue light flashes. Thus, measurements of muscarinic receptor-mediated sIPSC barrages made after the last blue light flash will be unaffected by MS/DBB GABAergic inputs (Fig. 4G). In a Chat-Cre;PV-Cre;ROSA26-YFP hippocampal slice, a train of blue light flashes released ACh and resulted in an increase in sIPSC frequency that persisted for seconds following termination of the light pulses. This permitted the measurement of sIPSC frequency 2 s after the last blue light flash (Fig. 4G, pink vertical bar). Furthermore, yellow light suppression of Arch-expressing PV interneurons could be measured even later during the sIPSC barrage, which resulted in a reduction in sIPSC frequency (Fig. 4G, orange vertical bar). Therefore, using combined optogenetic stimulation and inhibition, we investigated the interneuron subtypes that were excited by muscarinic receptor activation resulting in disynaptic inhibition of CA1 pyramidal neurons.

Figure 4. Suppression of sIPSC frequency and amplitudes in CA1 pyramidal neurons by optogenetically silencing specific CA1 interneuron subtypes.

Figure 4

Open in a new tab

A, schematic diagram of experimental design used in Aa. Aa, in a Chat-Cre;PV-Cre;ROSA26-YFP animal (CPY), 120 blue pulses at 20 Hz reliably evoked action potentials in medial septal neurons expressing oChIEF-tdTomato with each flash of light. B, schematic diagram of experimental design used in Ba. Ba, in a Chat-Cre;PV-Cre;Arch-GFP animal (CPA), 120 blue pulses at 20 Hz reliably produced action potentials in medial septal cells expressing oChIEF-tdTomato. C, schematic diagram of experimental design used in D. D, current clamp recording from a CA1 PV interneuron expressing Arch-GFP (PV-Arch) that responded to blue light flashes (blue bars, 120 × 20 Hz) with small hyperpolarizations (average amplitude −1.2 ± 0.2 mV, n = 5). A yellow light pulse (yellow bar, duration: 4 s) produced a large hyperpolarization (average amplitude −21.2 ± 3.2 mV, n = 5). E, current clamp recording from a CA1 PV-Arch interneuron demonstrating that APs elicited by a depolarizing current step can be abolished through activation of Arch-GFP. F, schematic diagram illustrating the experimental design for G. G, ACh release (blue bar, 120 × 20 Hz) increased the amplitude and decreased the interevent interval of sIPSCs in a voltage clamped CA1 pyramidal neuron 2 s after the last blue light flash (pink bar, Ga, average amplitude 38.82 pA, IEI 41.67 ms). The ACh release-induced changes in sIPSC amplitudes and interevent intervals were suppressed by Arch activation in PV interneurons (yellow horizontal bar, orange vertical bar, Gb, average amplitude 7.31 pA, IEI 151.03 ms). Suppression of sIPSC frequency by Arch activation is illustrated by the raster plot of sIPSC occurrence (bottom).

To determine which subsets of interneurons contribute to the barrage of sIPSCs in CA1 pyramidal neurons, we compared the number, frequency and amplitudes of sIPSCs that occurred during 4 s time periods under three different experimental conditions (Fig. 5A–C): baseline (grey), ACh release (blue), and Arch suppression (orange). The number of sIPSC events increased following ACh release for all three animals (Fig. 5D, blue bars, one-way ANOVA, P = 0.0043, Bonferroni post hoc, P = 0.0041 for Chat-Cre;VIP-Cre;ROSA26-Arch-GFP, Chat-Cre;PV-Cre;ROSA26-Arch-GFP, and Chat-Cre;ROSA26-Arch-GFP, n = 13, 16 and 11, respectively). This increase in sIPSC number was significantly reduced when VIP (one-way ANOVA, P = 0.003, Bonferroni post hoc, P = 0.008, n = 13) and PV (Fig. 5D, orange bars, one-way ANOVA, P = 0.004, Bonferroni post hoc, P = 0.007, n = 16), but not Chat (one-way ANOVA, P = 0.003, Bonferroni post hoc, n.s., n = 11) interneurons were suppressed with yellow light. Additionally, we found that following ACh release, the IEI of sIPSCs was significantly increased by suppressing the activity of VIP ((1.8 ± 0.25)-fold, t test, P = 0.005, n = 13) and PV interneurons ((1.96 ± 0.26)-fold, t test, P = 0.002, n = 16). Furthermore, the average amplitude of sIPSCs was decreased by suppressing VIP (0.81 ± 0.09 of control amplitude, t test, P = 0.041) and PV (0.84 ± 0.06 of control amplitude, t test, P = 0.036) interneurons. In contrast, yellow light applied in Chat-Cre;ROSA26-Arch-GFP slices produced no effect on the average interevent interval ((0.96 ± 0.12)-fold change, t test, n.s. (P = 0.51), n = 11) or amplitude ((0.97 ± 0.08)-fold change, t test, n.s. (P = 0.45), n = 11) of sIPSCs following ACh release.

Figure 5. PV and VIP but not Chat interneurons contribute to muscarinic-dependent increases in sIPSC frequency and amplitudes in CA1 pyramidal neurons.

Figure 5

Open in a new tab

A–C, peristimulus time histograms (PSTH) of sIPSCs measured in pyramidal neurons of slices that expressed Arch-GFP in VIP (A), PV (B) and Chat (C) interneurons. Cells responded with an increase in sIPSCs following ACh release (horizontal blue bars, 120 × 20 Hz, top black trace). Peristimulus time histograms (middle) and raster plots bottom demonstrate an increase in time-dependent sIPSC frequency following ACh release. Activation of Arch by a yellow light pulse (horizontal yellow bar, 4 s) suppressed sIPSC frequency when Arch was expressed in VIP (A) and PV interneurons (B) but not Chat interneurons (C). D, the number of sIPSCs that occurred during a 4 s bin following ACh release (blue bars) was significantly larger than the number of sIPSCs that occurred during a 4 s bin before ACh was released (grey bars). Yellow light activation of Arch (orange bars) following ACh release suppressed the number of pyramidal neuron sIPSCs in slices taken from Chat-Cre;VIP-Cre;ROSA26-Arch-GFP (CVA) and Chat-Cre;PV-Cre;ROSA26-Arch-GFP (CPA) animals but not Chat-Cre;ROSA26-Arch-GFP (CA) animals. E, pyramidal neuron sIPSCs measured in slices taken from Chat-Cre;VIP-Cre;ROSA26-Arch-GFP (CVA), Chat-Cre;PV-Cre;ROSA26-Arch-GFP (CPA) and Chat-Cre;ROSA26-Arch-GFP (CA) animals illustrate the effect of yellow light on baseline activity. F, the proportion of sIPSCs inhibited by yellow light during baseline measurements (yellow bars) was significantly smaller than the proportion of sIPSCs inhibited by yellow light following ACh release (orange bars) when Arch was expressed in VIP and PV interneurons but not Chat interneurons. Estimation of the proportion of sIPSCs unaffected by ACh release but suppressed by yellow light following ACh release (red bars) was significantly smaller than the total number of sIPSCs suppressed by yellow light following ACh release (orange bars) in slices expressing Arch in VIP (CVA) and PV (CPA) but not Chat (CA) interneurons.

Because there was always a proportion of interneurons that were spontaneously active at rest, the sIPSCs measured following ACh release were composed of two types: those produced by interneurons that were excited by ACh and those produced by interneurons that were spontaneously active during that time period but not directly activated by ACh. Thus, the sIPSCs suppressed by yellow light following the release of ACh could be composed of the same two populations of presynaptic interneurons. Therefore, we further analysed the data to determine the proportion of interneurons suppressed by yellow light that were directly excited by ACh release. We counted the number of sIPSCs that occurred in 4 s periods during baseline, after ACh was released, and during yellow light pulses in both conditions. This allowed us to determine the proportion of sIPSCs suppressed by yellow light during baseline (Fig. 5E and F, yellow bars) and following ACh release (Fig. 5F, orange bars). To determine the maximum proportion of sIPSCs that were suppressed by yellow light following ACh release but unaffected by ACh, we normalized the number of sIPSCs suppressed by yellow light at baseline to the number of sIPSCs that occurred following ACh release (Fig. 5F, red bars). Using this analysis, we found that the proportion of sIPSCs suppressed following ACh release in VIP (Fig. 5F, left, t test, P = 0.003, n = 13) and PV (Fig. 5F, middle, t test, P = 0.002, n = 16) interneurons primarily arose from interneurons that were directly activated by ACh (Fig. 5F orange vs. red bars). In contrast, yellow light suppression of Chat-Cre;ROSA26-Arch-GFP slices did not have an effect on the number of sIPSCs at baseline or following the release of ACh (Fig. 5F, right, t test, n.s. (P = 0.81), n = 11). Therefore, VIP and PV perisomatically projecting interneurons were excited by the release of ACh onto muscarinic receptors resulting in inhibition of PC somata.

Muscarinic receptor-mediated excitation of VIP and PV BCs increased the proportion of sIPSCs occurring in the gamma frequency bandwidth

Previous studies have demonstrated that ACh release may activate muscarinic receptors on CCK BCs resulting in an increase in sIPSCs in hippocampal CA1 PCs (Nagode et al. 2011). The instantaneous frequency of these CCK BC-driven sIPSCs fell within the theta frequency bandwidth (4–10 Hz). Therefore, we examined the increased frequency of sIPSCs for underlying rhythmic components. Fourier analysis of the sIPSCs during a 4 s epoch following the release of ACh (Fig. 6A and B) produced multiple peaks primarily in the theta frequency bandwidth (Fig. 6B) with an average maximum peak at 8.9 Hz (8.9 ± 3.2 Hz, n = 32, Fig. 6Ba). However, Fourier analysis provides information regarding all components of the current waveform during sIPSC barrages and does not give information about the timing of individual sIPSCs. Therefore, we measured the interevent interval (IEI) of sIPSCs that occurred during the same 4 s epoch (Fig. 6C). We found that the IEI of sIPSCs following the release of ACh mostly occurred within the lower end of the gamma frequency bandwidth range with a smaller IEI population peak occurring within the theta bandwidth. Thus, populations of interneurons excited by muscarinic receptor activation produced sIPSCs with intervals preferentially occurring within the gamma frequency bandwidth.

Figure 6. Interevent intervals of ACh-driven sIPSCs in CA1 pyramidal neurons occur at gamma and theta rates.

Figure 6

Open in a new tab

Suppression of VIP and PV BCs reduced the proportion of sIPSCs occuring in the gamma but not theta band. A, 4 s voltage clamp recordings from baseline (grey) and following ACh release (black). B, Fourier analysis of the voltage clamp recording segments showed many peaks in the theta and gamma range. Ba, the distribution of maximum peaks of each power spectrum (average max. peak was at 8.9 ± 3.2 Hz, n = 32). C, a histogram distribution of interevent intervals (10 ms bins) exhibited a bimodal distribution with two peaks: a large gamma peak (orange) and a smaller theta peak (grey). D–F, ACh release produced sIPSC barrages (blue light, top) that were suppressed by Arch activation (yellow light traces, bottom) in Chat-Cre;VIP-Cre;ROSA26-Arch-GFP (CVA) (D), Chat-Cre;PV-Cre;ROSA26-Arch-GFP (CPA) (E), but not Chat-Cre;ROSA26-Arch-GFP (CA) (F). G–I, histograms of the proportion of sIPSCs occurring at different interevent intervals following the release of ACh: Chat-Cre;VIP-Cre;ROSA26-Arch-GFP (CVA) (G), Chat-Cre;PV-Cre;ROSA26-Arch-GFP (CPA) (H) and Chat-Cre;ROSA26-Arch-GFP (CA) (I). Notice two peaks occurring within the gamma (25–100 Hz) and theta frequency bands (4–10 Hz). J–L, histograms showing the relative distribution of interevent intervals across three conditions: baseline (grey), following the release of ACh (blue), and during the activation of Arch (orange). M and N, the fraction of events occurring at low gamma (25–50 Hz) and theta (4–10 Hz) range were normalized to the baseline level of activity. M, the sIPSC barrage caused a significant increase in the number of gamma rate events in all three conditions (blue bars). Subsequent activation of Arch (orange bars) suppressed the fraction of sIPSC events in the gamma band of Chat-Cre;VIP-Cre;ROSA26-Arch-GFP (CVA) and Chat-Cre;PV-Cre;ROSA26-Arch-GFP (CPA) slices but not Chat-Cre;ROSA26-Arch-GFP (CA) in CA1 pyramidal cells. N, in contrast, the fraction of theta range events was not significantly altered by either ACh release or activation of Arch-GFP in Chat-Cre;VIP-Cre;ROSA26-Arch-GFP (CVA), Chat-Cre;PV-Cre;ROSA26-Arch-GFP (CPA) or Chat-Cre;ROSA26-Arch-GFP (CA) CA1 pyramidal cells.

We next examined the contributions of VIP and PV BC activity to the temporal properties of CA1 PC sIPSCs following the release of ACh. To do this, we measured the impact of Arch-mediated suppression of VIP or PV neurons on the IEI of sIPSCs (Fig. 6D–F). The majority of sIPSC IEIs in CA1 PCs occurred within the gamma frequency bandwidth but another smaller population of sIPSC IEIs peaked within the theta bandwidth (Fig. 6G–I). Individual CA1 PC recordings from each mouse cross (Chat-Cre;VIP-Cre;ROSA26-Arch-GFP, Chat-Cre;PV-Cre;ROSA26-Arch-GFP, Chat-Cre;ROSA26-Arch-GFP) demonstrated that the release of ACh increased the relative proportion of sIPSCs that had IEIs within the gamma bandwidth but not the theta bandwidth (Fig. 6J and K, grey vs. blue bars). This increase within the gamma bandwidth was statistically significant across all populations of PC neurons (Fig. 6M, blue bars, one-way ANOVA, P = 0.0031, Bonferroni post hoc, Chat-Cre;VIP-Cre;ROSA26-Arch-GFP, Chat-Cre;PV-Cre;ROSA26-Arch-GFP, and Chat-cre;ROSA26-Arch-GFP: P = 0.0045, n = 13, 16 and 11, respectively). Furthermore, individual recordings demonstrated that inhibition of VIP (Fig. 6D, J and M blue vs. orange bars: one-way ANOVA, P = 0.005, Bonferroni post hoc, P = 0.006, n = 13) or PV BCs (Fig. 6E, K and M blue vs. orange bars: one-way ANOVA, P = 0.002, Bonferroni post hoc, P = 0.002, n = 16) by Arch activation suppressed the ACh-driven increase of sIPSCs in the gamma bandwidth but had no effect on IEIs within the theta bandwidth (Fig. 6J, K and N blue vs orange bars, Chat-Cre;VIP-Cre;ROSA26-Arch-GFP and Chat-Cre;PV-Cre;ROSA26-Arch-GFP: one-way ANOVA, n.s. (P = 0.76 and 0.57), n = 13 and16, respectively). Although ACh release increased the sIPSC IEI in PCs recorded from all animals, yellow light pulses used to activate Arch had no impact on PC sIPSCs in slices taken from animals that expressed Arch in Chat neurons alone (Fig. 6F, L, M and N, blue vs. orange bars, one-way ANOVA, Bonferroni post hoc, n.s. (P = 0.48), n = 11). Therefore, our data suggest that activation of muscarinic receptors on VIP or PV BCs increases synaptic inhibition in PCs with instantaneous frequencies primarily occurring within the gamma frequency bandwidth.

Discussion

Our data suggest that physiological activation of muscarinic receptors has varying and sometimes opposing effects on the membrane potential of perisomatically projecting interneurons. Although the endogenous activation of muscarinic receptors consistently resulted in depolarization of VIP BCs, PV BCs could respond by depolarizing, hyperpolarizing or through biphasic responses. Despite the varying response types, muscarinic receptor activation following the release of ACh resulted in an increase in sIPSCs measured in CA1 PCs. Both VIP and PV interneurons could contribute to the ACh-mediated increase in sIPSCs. Furthermore, sIPSCs arising from the release of ACh had instantaneous frequencies that primarily fell within the lower end of the gamma frequency range. Both VIP and PV BCs could contribute to this selective increase in sIPSCs occurring within the gamma bandwidth. Therefore, muscarinic transmission onto perisomatic interneurons has complex effects and may contribute to the generation of gamma rhythms observed in CA1 PCs during specific brain states.

VIP basket cells, acetylcholine release and muscarinic receptors

We found that muscarinic transmission onto VIP BCs produced depolarizations that could often generate action potentials. This is consistent with previous studies showing that optogenetically released ACh resulted in an increase in sIPSCs in PCs that may in part be due to a muscarinic receptor excitation of CCK BCs (of which VIP BCs make a subset) (Somogyi et al. 2004; Nagode et al. 2011). In contrast, studies utilizing electrical stimulation to evoke muscarinic responses in CA1 interneurons found that perisomatic interneurons could respond with hyperpolarizing and biphasic responses in addition to depolarizations (Widmer et al. 2006). The specific subset of perisomatic interneurons that produced each type of response was not determined. However, one biphasic responding interneuron of the Widmer study demonstrated morphology consistent with a CCK BC (Widmer et al. 2006). In this report, we never observed a biphasic responding VIP BC suggesting that other non-VIP-expressing subsets of CCK BCs may have different types of responses following the release of ACh.

The primary role of VIP BCs is to inhibit the perisomatic region of PCs. Indeed, this report demonstrates that optogenetically released ACh resulted in increased amplitudes and frequency of sIPSCs in CA1 PCs. Most of the increase in sIPSCs occurred within the gamma frequency range. The selective optogenetic silencing of VIP interneurons could reverse this increase in sIPSCs suggesting that VIP BCs contributed to the increase in sIPSCs observed in the gamma frequency range. Previous studies have shown that ACh release may activate muscarinic receptors on CCK BCs resulting in an increase in large amplitude sIPSCs in PCs that occurred within the theta bandwidth (Nagode et al. 2011). These studies selectively measured large amplitude IPSCs that were inhibited by endocannaboids suggesting that a subpopulation of CCK interneurons may be activated at lower frequencies than those that we measured. However, when measured as a broad population, ACh release onto VIP BCs can cause an increase in sIPSCs that mostly occurs within the gamma bandwidth.

The number of VIP BCs contributing to the increase in sIPSC frequency and amplitude cannot be deduced from our results. However, it has been estimated that approximately 10 CCK BCs innervate one PC (Takács et al. 2014). Furthermore, VIP BCs only make up 10% of the CCK BC population (Somogyi et al. 2004). Therefore, it can be estimated that one VIP BC innervates an individual PC. Moreover, because optogenetic suppression of VIP neurons can reverse the increase in sIPSCs following ACh release, it is likely that the activation of an individual VIP BC can alone produce sIPSC barrages in the gamma range.

PV basket cells, acetylcholine release and muscarinic receptors

We found that PV BCs could depolarize, hyperpolarize or produce biphasic responses following the release of ACh and activation of muscarinic receptors. These data are consistent with previous observations using electrical stimulation to produce muscarinic responses in CA1 interneurons (Widmer et al. 2006). Responses containing hyperpolarizing components were observed in nearly 81% of all PV BCs from which we recorded. In contrast, only 67% of PV BCs had a depolarizing component to their response. Furthermore, the muscarinic responses in PV BCs were smaller compared to VIP BCs and other interneuron subtypes (Bell et al. 2013). Although the depolarizations that we measured in PV BCs were relatively small, some of the increases in PC sIPSCs could be reversed by optogenetically suppressing PV interneurons. This contrasts with another report that has shown that PV interneurons do not contribute to muscarinic receptor-driven increases in sIPSCs in CA1 PCs when muscarinic receptors were activated by bath application of the cholinergic agonist carbachol (Nagode et al. 2014). These differences could be explained by differences in activation methods. Bath application of low concentrations of the agonist carbachol may not be sufficient to mimic the endogenous activation of muscarinic receptors on PV BCs. Nagode (2014) showed that, in the presence of high concentrations of carbachol and low concentrations of kainate, sIPSCs in CA1 PCs were increased, consistent with our results. Therefore, our data suggest that muscarinic receptor activation by ACh release depolarizes a subset of PV interneurons that can result in an increase in sIPSCs in PCs.

BCs make up 60–80% of all CA1 PV interneurons with the remaining being axo-axonic, bistratified or oriens-lacunosum-moleculare interneurons (Pawelzik et al. 2002; Baude et al. 2007; Klausberger & Somogyi, 2008). Therefore, it is possible that some of the PV interneurons contributing to the increase in PC sIPSCs were not BCs. However, the PV-Cre mouse line we used does not express high levels of Cre recombinase in all neurons that express PV (Madisen et al. 2010). Thus, neurons with low levels of PV (and presumably Cre) fail to express reporter proteins like Arch or YFP. Indeed, others have reported (Losonczy et al. 2010; Lovett-Barron et al. 2012) that crosses with the same line of PV-Cre mice (Hippenmeyer et al. 2005) result in reporter protein expression primarily in perisomatic interneurons. Moreover, in our recordings from Chat-Cre;PV-Cre;ROSA26-YFP neurons, all the cells had morphologies consistent with perisomatic interneurons. However, more recent studies have demonstrated that a significant number of hippocampal CA1 neurons in this PV-Cre line do express Cre recombinase in both bistratified and oriens-lacunosum-moleculare interneurons (Yi et al. 2014). Therefore, although we cannot discount a contribution of non-basket cell PV neurons in our observations, our data are most consistent with ACh acting on PV perisomatic neurons resulting in an increase in sIPSCs in CA1 PCs.

The increase in sIPSCs in PCs following the release of ACh primarily occurred with instantaneous frequencies in the gamma range. Optogenetic silencing of PV interneurons could reverse the increase in sIPSCs occurring within this gamma frequency bandwidth. The number of PV BCs contributing to this increase in sIPSCs could not be determined from our recordings. However, the number of PV BCs that innervate an individual PC has been estimated to be six (Takács et al. 2014). Considering that only 67% of PV BCs depolarize in response to ACh release, a maximum of four PV BCs could contribute to the increase in PC sIPSCs. Because these recordings were obtained from PCs located near the surface of the brain slices, the number of intact depolarizing PV BCs is probably less than four. Furthermore, not all PV BCs would be sufficiently depolarized to fire action potentials. Therefore, it is probable that individual PV BCs that depolarize in response to ACh release are capable of producing an increase in PC sIPSCs in the gamma frequency range.

Network implications

The release of ACh in the hippocampus has been correlated with attention, learning and memory. Furthermore, it has been proposed that the amount of ACh release is high during learning and low during memory retrieval (Hasselmo & Giocomo, 2006; Giocomo & Hasselmo, 2007; Hasselmo & Sarter, 2011). In hippocampal CA1, high ACh release during learning has been suggested to favour processing from entorhinal cortical input whereas low ACh favours the retrieval of memories and intrahippocampal processing from CA3. Our data suggest additional mechanisms that involve differential processing at PC somata during learning versus memory retrieval. Different postsynaptic muscarinic response types in hippocampal CA1 interneurons require different levels of activity in presynaptic cholinergic terminals (Bell et al. 2013). More specifically, depolarizing muscarinic responses require more stimuli (higher levels of ACh) relative to hyperpolarizing responses. Therefore, during low levels of activity, hyperpolarization of specific subsets of PV BCs may be favoured resulting in increased output from CA1 PCs and memory retrieval. In contrast, higher levels of ACh activity will recruit depolarizing PV BC and VIP BC responses resulting in increased sIPSCs at the gamma frequency. Notably, an increase in gamma frequency has been observed during learning (Colgin & Moser, 2010). Importantly, the increase in sIPSCs occurred in the absence of ionotropic glutamatergic synaptic transmission as all experiments were conducted in the presence of DNQX and APV to distinguish sIPSCs from sEPSCs. Furthermore, based on Fourier analysis, the increase in sIPSCs did not produce a clear synchronous oscillation in CA1 pyramidal neurons at gamma frequencies. Therefore, excitation of subsets of CA1 BC interneurons by muscarinic transmission is not sufficient to produce synchrony in populations of CA1 pyramidal neurons alone. Gamma frequency synchrony within hippocampal CA1 probably requires an intact functioning neural network both within CA1 and with connections to other brain regions that contribute to hippocampal oscillations such as the MS/DBB. Indeed, exogenous activation of muscarinic receptors in hippocampal slices results in network gamma oscillations in hippocampal CA3 and CA1 (Fisahn et al. 1998) that depend on excitatory glutamatergic synaptic transmission and the activation of perisomatic inhibitory interneurons (Fisahn et al. 1998; Hájos et al. 2004; Mann et al. 2005). Considering that gamma rhythms have been proposed to be involved in encoding activity in the hippocampus during learning (Colgin & Moser, 2010), higher levels of ACh may endow subsets of CA1 perisomatic interneurons to fire at gamma frequencies that are subsequently synchronized through network interactions. Therefore, depending on the behavioural situation, different levels of ACh release may influence perisomatic processing in hippocampal CA1 to favour learning or the retrieval of memories from hippocampal CA1.

Acknowledgments

The authors would like to thank Drs John Lin and Roger Tsien for donating oChIEF-tdTomato cDNA and Scott Sternson for rAAV-FLEX-rev-ChR2-tdTomato. We would also like to thank Dr John Dempster for the gift of his Strathclyde Electrophysiological Software.

Glossary

ACh

acetylcholine

Arch

archaerhodopsin

AP

action potential

APV

dl-2-amino-5-phosphonopentanoic acid

BC

basket cell

Chat-Cre;ROSA26-Arch-GFP

Chat-Cre × Arch-green fluorescent protein mouse cross

CCK

cholecystokinin

Chat

choline acetyltransferase

Chat-Cre;PV-Cre;ROSA26-Arch-GFP

Chat-Cre × parvalbumin-Cre × Arch-green fluorescent protein mouse cross

Chat-Cre;PV-Cre;ROSA26-YFP

Chat-Cre × parvalbumin-Cre × yellow fluorescent protein reporter mouse cross

Chat-Cre;VIP-Cre;ROSA26-Arch-GFP

Chat-Cre × VIP-Cre × Arch-green fluorescent protein mouse cross

Chat-Cre;VIP-Cre;ROSA26-YFP

Chat-Cre × VIP-Cre × yellow fluorescent protein mouse cross

DNQX

6,7-dinitroquinoxaline-2,3-dione

GABA

γ-aminobutyric acid

GFP

green fluorescent protein

IEI

interevent interval

MS/DBB

medial septum/diagonal band of Broca complex

PC

pyramidal cell

PV

parvalbumin

rAAV

recombinant adeno-associated virus

sIPSC

spontaneous inhibitory postsynaptic current

SLM

stratum lacunosum-moleculare

SO

stratum oriens

SP

stratum pyramidale

SR

stratum radiatum

VIP

vasoactive intestinal peptide

YFP

yellow fluorescent protein

Additional information

Competing interests

The authors declare no competing financial interests.

Author contributions

L.A.B. and A.R.M. conceived and designed the experiments; L.A.B., K.A.B. and A.R.M. collected, analysed and interpreted the data; L.A.B., K.A.B. and A.R.M. wrote and edited the manuscript.

Funding

These studies were supported by a grant from the National Institutes of Health (1R01MH094626-01 and 1R21MH103695-01 to A.R.M.).

References

  1. Alkondon M, Pereira EF. Albuquerque EX. -Bungarotoxin- and methyllycaconitine-sensitive nicotinic receptors mediate fast synaptic transmission in interneurons of rat hippocampal slices. Brain Res. 1998;810:257–263. doi: 10.1016/s0006-8993(98)00880-4. [DOI] [PubMed] [Google Scholar]
  2. Atri A, Sherman S, Norman KA, Kirchhoff BA, Nicolas MM, Greicius MD, Cramer SC, Breiter HC, Hasselmo ME. Stern CE. Blockade of central cholinergic receptors impairs new learning and increases proactive interference in a word paired-associate memory task. Behav Neurosci. 2004;118:223–236. doi: 10.1037/0735-7044.118.1.223. [DOI] [PubMed] [Google Scholar]
  3. Baude A, Bleasdale C, Dalezios Y, Somogyi P. Klausberger T. Immunoreactivity for the GABAA receptor α1 subunit, somatostatin and connexin36 distinguishes axoaxonic, basket, and bistratified interneurons of the rat hippocampus. Cereb Cortex. 2007;17:2094–2107. doi: 10.1093/cercor/bhl117. [DOI] [PubMed] [Google Scholar]
  4. Behrends JC. ten Bruggencate G. Cholinergic modulation of synaptic inhibition in the guinea pig hippocampus in vitro: excitation of GABAergic interneurons and inhibition of GABA-release. J Neurophysiol. 1993;69:626–629. doi: 10.1152/jn.1993.69.2.626. [DOI] [PubMed] [Google Scholar]
  5. Bell KA, Shim H, Chen CK. McQuiston AR. Nicotinic excitatory postsynaptic potentials in hippocampal CA1 interneurons are predominantly mediated by nicotinic receptors that contain α4 and β2 subunits. Neuropharmacology. 2011;61:1379–1388. doi: 10.1016/j.neuropharm.2011.08.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bell LA, Bell KA. McQuiston AR. Synaptic muscarinic response types in hippocampal CA1 interneurons depend on different levels of presynaptic activity and different muscarinic receptor subtypes. Neuropharmacology. 2013;73:160–173. doi: 10.1016/j.neuropharm.2013.05.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bierer LM, Haroutunian V, Gabriel S, Knott PJ, Carlin LS, Purohit DP, Perl DP, Schmeidler J, Kanof P. Davis KL. Neurochemical correlates of dementia severity in Alzheimer’s disease: relative importance of the cholinergic deficits. J Neurochem. 1995;64:749–760. doi: 10.1046/j.1471-4159.1995.64020749.x. [DOI] [PubMed] [Google Scholar]
  8. Blokland A, Honig W. Raaijmakers WG. Effects of intra-hippocampal scopolamine injections in a repeated spatial acquisition task in the rat. Psychopharmacology (Berl) 1992;109:373–376. doi: 10.1007/BF02245886. [DOI] [PubMed] [Google Scholar]
  9. Brazhnik ES. Fox SE. Action potentials and relations to the theta rhythm of medial septal neurons in vivo. Exp Brain Res. 1999;127:244–258. doi: 10.1007/s002210050794. [DOI] [PubMed] [Google Scholar]
  10. Cobb SR. Davies CH. Cholinergic modulation of hippocampal cells and circuits. J Physiol. 2005;562:81–88. doi: 10.1113/jphysiol.2004.076539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Colgin LL. Moser EI. Gamma oscillations in the hippocampus. Physiology (Bethesda) 2010;25:319–329. doi: 10.1152/physiol.00021.2010. [DOI] [PubMed] [Google Scholar]
  12. Fisahn A, Pike FG, Buhl EH. Paulsen O. Cholinergic induction of network oscillations at 40 Hz in the hippocampus in vitro. Nature. 1998;394:186–189. doi: 10.1038/28179. [DOI] [PubMed] [Google Scholar]
  13. Frazier CJ, Buhler AV, Weiner JL. Dunwiddie TV. Synaptic potentials mediated via α-bungarotoxin-sensitive nicotinic acetylcholine receptors in rat hippocampal interneurons. J Neurosci. 1998;18:8228–8235. doi: 10.1523/JNEUROSCI.18-20-08228.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Frotscher M, Vida I. Bender R. Evidence for the existence of non-GABAergic, cholinergic interneurons in the rodent hippocampus. Neuroscience. 2000;96:27–31. doi: 10.1016/s0306-4522(99)00525-4. [DOI] [PubMed] [Google Scholar]
  15. Giocomo LM. Hasselmo ME. Neuromodulation by glutamate and acetylcholine can change circuit dynamics by regulating the relative influence of afferent input and excitatory feedback. Mol Neurobiol. 2007;36:184–200. doi: 10.1007/s12035-007-0032-z. [DOI] [PubMed] [Google Scholar]
  16. Gonchar Y, Wang Q. Burkhalter A. Multiple distinct subtypes of GABAergic neurons in mouse visual cortex identified by triple immunostaining. Front Neuroanat. 2007;1:3. doi: 10.3389/neuro.05.003.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gu Z. Yakel JL. Timing-dependent septal cholinergic induction of dynamic hippocampal synaptic plasticity. Neuron. 2011;71:155–165. doi: 10.1016/j.neuron.2011.04.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hájos N, Pálhalmi J, Mann EO, Németh B, Paulsen O. Freund TF. Spike timing of distinct types of GABAergic interneuron during hippocampal gamma oscillations in vitro. J Neurosci. 2004;24:9127–9137. doi: 10.1523/JNEUROSCI.2113-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Harris JA, Hirokawa KE, Sorensen SA, Gu H, Mills M, Ng LL, Bohn P, Mortrud M, Ouellette B, Kidney J, Smith KA, Dang C, Sunkin S, Bernard A, Oh SW, Madisen L. Zeng H. Anatomical characterization of Cre driver mice for neural circuit mapping and manipulation. Front Neural Circuits. 2014;8:76. doi: 10.3389/fncir.2014.00076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hasselmo ME. Giocomo LM. Cholinergic modulation of cortical function. J Mol Neurosci. 2006;30:133–135. doi: 10.1385/JMN:30:1:133. [DOI] [PubMed] [Google Scholar]
  21. Hasselmo ME. Sarter M. Modes and models of forebrain cholinergic neuromodulation of cognition. Neuropsychopharmacology. 2011;36:52–73. doi: 10.1038/npp.2010.104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hippenmeyer S, Vrieseling E, Sigrist M, Portmann T, Laengle C, Ladle DR. Arber S. A developmental switch in the response of DRG neurons to ETS transcription factor signaling. PLoS Biol. 2005;3:e159. doi: 10.1371/journal.pbio.0030159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Huh CY, Goutagny R. Williams S. Glutamatergic neurons of the mouse medial septum and diagonal band of Broca synaptically drive hippocampal pyramidal cells: relevance for hippocampal theta rhythm. J Neurosci. 2010;30:15951–15961. doi: 10.1523/JNEUROSCI.3663-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Keita MS, Frankel-Kohn L, Bertrand N, Lecanu L. Monmaur P. Acetylcholine release in the hippocampus of the urethane anaesthetised rat positively correlates with both peak theta frequency and relative power in the theta band. Brain Res. 2000;887:323–334. doi: 10.1016/s0006-8993(00)03021-3. [DOI] [PubMed] [Google Scholar]
  25. Klausberger T. Somogyi P. Neuronal diversity and temporal dynamics: the unity of hippocampal circuit operations. Science. 2008;321:53–57. doi: 10.1126/science.1149381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lawrence JJ, Statland JM, Grinspan ZM. McBain CJ. Cell type-specific dependence of muscarinic signalling in mouse hippocampal stratum oriens interneurones. J Physiol. 2006;570:595–610. doi: 10.1113/jphysiol.2005.100875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee MG, Chrobak JJ, Sik A, Wiley RG. Buzsaki G. Hippocampal theta activity following selective lesion of the septal cholinergic system. Neuroscience. 1994;62:1033–1047. doi: 10.1016/0306-4522(94)90341-7. [DOI] [PubMed] [Google Scholar]
  28. Levin ED. Nicotinic receptor subtypes and cognitive function. J Neurobiol. 2002;53:633–640. doi: 10.1002/neu.10151. [DOI] [PubMed] [Google Scholar]
  29. Losonczy A, Zemelman BV, Vaziri A. Magee JC. Network mechanisms of theta related neuronal activity in hippocampal CA1 pyramidal neurons. Nat Neurosci. 2010;13:967–972. doi: 10.1038/nn.2597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lovett-Barron M, Turi GF, Kaifosh P, Lee PH, Bolze F, Sun XH, Nicoud JF, Zemelman BV, Sternson SM. Losonczy A. Regulation of neuronal input transformations by tunable dendritic inhibition. Nat Neurosci. 2012;15:423–430. doi: 10.1038/nn.3024. [DOI] [PubMed] [Google Scholar]
  31. McQuiston AR. Madison DV. Muscarinic receptor activity has multiple effects on the resting membrane potentials of CA1 hippocampal interneurons. J Neurosci. 1999a;19:5693–5702. doi: 10.1523/JNEUROSCI.19-14-05693.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. McQuiston AR. Madison DV. Muscarinic receptor activity induces an afterdepolarization in a subpopulation of hippocampal CA1 interneurons. J Neurosci. 1999b;19:5703–5710. doi: 10.1523/JNEUROSCI.19-14-05703.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Madisen L, Mao T, Koch H, Zhuo JM, Berenyi A, Fujisawa S, Hsu YW, Garcia AJ, III, Gu X, Zanella S, Kidney J, Gu H, Mao Y, Hooks BM, Boyden ES, Buzsaki G, Ramirez JM, Jones AR, Svoboda K, Han X, Turner EE. Zeng H. A toolbox of Cre-dependent optogenetic transgenic mice for light-induced activation and silencing. Nat Neurosci. 2012;15:793–802. doi: 10.1038/nn.3078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, Ng LL, Palmiter RD, Hawrylycz MJ, Jones AR, Lein ES. Zeng H. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci. 2010;13:133–140. doi: 10.1038/nn.2467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mann EO, Suckling JM, Hajos N, Greenfield SA. Paulsen O. Perisomatic feedback inhibition underlies cholinergically induced fast network oscillations in the rat hippocampus in vitro. Neuron. 2005;45:105–117. doi: 10.1016/j.neuron.2004.12.016. [DOI] [PubMed] [Google Scholar]
  36. Monmaur P, Collet A, Puma C, Frankel-Kohn L. Sharif A. Relations between acetylcholine release and electrophysiological characteristics of theta rhythm: a microdialysis study in the urethane-anesthetized rat hippocampus. Brain Res Bull. 1997;42:141–146. doi: 10.1016/s0361-9230(96)00200-6. [DOI] [PubMed] [Google Scholar]
  37. Nagode DA, Tang AH, Karson MA, Klugmann M. Alger BE. Optogenetic release of ACh induces rhythmic bursts of perisomatic IPSCs in hippocampus. PLoS One. 2011;6:e27691. doi: 10.1371/journal.pone.0027691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Nagode DA, Tang AH, Yang K. Alger BE. Optogenetic identification of an intrinsic cholinergically driven inhibitory oscillator sensitive to cannabinoids and opioids in hippocampal CA1. J Physiol. 2014;592:103–123. doi: 10.1113/jphysiol.2013.257428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Parra P, Gulyas AI. Miles R. How many subtypes of inhibitory cells in the hippocampus? Neuron. 1998;20:983–993. doi: 10.1016/s0896-6273(00)80479-1. [DOI] [PubMed] [Google Scholar]
  40. Pawelzik H, Hughes DI. Thomson AM. Physiological and morphological diversity of immunocytochemically defined parvalbumin- and cholecystokinin-positive interneurones in CA1 of the adult rat hippocampus. J Comp Neurol. 2002;443:346–367. doi: 10.1002/cne.10118. [DOI] [PubMed] [Google Scholar]
  41. Pitler TA. Alger BE. Cholinergic excitation of GABAergic interneurons in the rat hippocampal slice. J Physiol. 1992;450:127–142. doi: 10.1113/jphysiol.1992.sp019119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Porter JT, Cauli B, Staiger JF, Lambolez B, Rossier J. Audinat E. Properties of bipolar VIPergic interneurons and their excitation by pyramidal neurons in the rat neocortex. Eur J Neurosci. 1998;10:3617–3628. doi: 10.1046/j.1460-9568.1998.00367.x. [DOI] [PubMed] [Google Scholar]
  43. Rossi J, Balthasar N, Olson D, Scott M, Berglund E, Lee CE, Choi MJ, Lauzon D, Lowell BB. Elmquist JK. Melanocortin-4 receptors expressed by cholinergic neurons regulate energy balance and glucose homeostasis. Cell Metab. 2011;13:195–204. doi: 10.1016/j.cmet.2011.01.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Simon AP, Poindessous-Jazat F, Dutar P, Epelbaum J. Bassant MH. Firing properties of anatomically identified neurons in the medial septum of anesthetized and unanesthetized restrained rats. J Neurosci. 2006;26:9038–9046. doi: 10.1523/JNEUROSCI.1401-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Somogyi J, Baude A, Omori Y, Shimizu H, El MS, Fukaya M, Shigemoto R, Watanabe M. Somogyi P. GABAergic basket cells expressing cholecystokinin contain vesicular glutamate transporter type 3 (VGLUT3) in their synaptic terminals in hippocampus and isocortex of the rat. Eur J Neurosci. 2004;19:552–569. doi: 10.1111/j.0953-816x.2003.03091.x. [DOI] [PubMed] [Google Scholar]
  46. Sotty F, Danik M, Manseau F, Laplante F, Quirion R. Williams S. Distinct electrophysiological properties of glutamatergic, cholinergic and GABAergic rat septohippocampal neurons: novel implications for hippocampal rhythmicity. J Physiol. 2003;551:927–943. doi: 10.1113/jphysiol.2003.046847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Stone TW( Kynurenic acid blocks nicotinic synaptic transmission to hippocampal interneurons in young rats. Eur J Neurosci. 2007;25:2656–2665. doi: 10.1111/j.1460-9568.2007.05540.x. [DOI] [PubMed] [Google Scholar]
  48. Takács VT, Szőnyi A, Freund TF, Nyiri G. Gulyás AI. Quantitative ultrastructural analysis of basket and axo-axonic cell terminals in the mouse hippocampus. Brain Struct Funct. 2014 doi: 10.1007/s00429-013-0692-6. &(in press; DOI: 10.1007/s00429-013-0692-6) [DOI] [PubMed] [Google Scholar]
  49. Taniguchi H, He M, Wu P, Kim S, Paik R, Sugino K, Kvitsiani D, Fu Y, Lu J, Lin Y, Miyoshi G, Shima Y, Fishell G, Nelson SB. Huang ZJ. A resource of Cre driver lines for genetic targeting of GABAergic neurons in cerebral cortex. Neuron. 2011;71:995–1013. doi: 10.1016/j.neuron.2011.07.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Teles-Grilo Ruivo LM. Mellor JR. Cholinergic modulation of hippocampal network function. Front Synaptic Neurosci. 2013;5:2. doi: 10.3389/fnsyn.2013.00002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Toth K, Freund TF. Miles R. Disinhibition of rat hippocampal pyramidal cells by GABAergic afferents from the septum. J Physiol. 1997;500:463–474. doi: 10.1113/jphysiol.1997.sp022033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Widmer H, Ferrigan L, Davies CH. Cobb SR. Evoked slow muscarinic acetylcholinergic synaptic potentials in rat hippocampal interneurons. Hippocampus. 2006;16:617–628. doi: 10.1002/hipo.20191. [DOI] [PubMed] [Google Scholar]
  53. Yi F, Ball J, Stoll KE, Satpute VC, Mitchell SM, Pauli JL, Holloway BB, Johnston AD, Nathanson NM, Deisseroth K, Gerber DJ, Tonegawa S. Lawrence JJ. Direct excitation of parvalbumin-positive interneurons by M1 muscarinic acetylcholine receptors: roles in cellular excitability, inhibitory transmission and cognition. J Physiol. 2014;592:3463–3494. doi: 10.1113/jphysiol.2014.275453. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES