Modulating DNA methylation in activated CD8⁺ T cells inhibits Treg cell-induced binding of FoxP3 to the CD8⁺ T cell IL2 promoter

Abstract

We have previously demonstrated that CD4⁺CD25⁺ Treg cells activated during the course of FIV infection suppress CD8⁺ CTL function in a TGFβ-dependent fashion, inhibiting IFNγ and IL2 production, and inducing G1 cell cycle arrest. Here, we describe the molecular events occurring at the IL2 promoter leading to suppression of IL2 production. These experiments demonstrate that FoxP3 induced by lentivirus-activated Treg cells in the CD8⁺ target cells binds to the IL2 promoter, actively repressing IL2 transcription. We further demonstrate that the chronic activation of CD8⁺ T cells during FIV infection results in chromatin remodeling at the IL2 promoter, specifically, demethylation of CpG residues. These DNA modifications occur during active transcription and translation of IL2; however, these changes render the IL2 promoter permissive to FoxP3-induced transcriptional repression. These data help explain, in part, the seemingly paradoxical observations that CD8⁺ T cells displaying an activation phenotype exhibit altered antiviral function. Further, we demonstrate that blocking demethylation of CpG residues at the IL2 promoter inhibits FoxP3 binding, suggesting a potential mechanism for rescue and / or reactivation of CD8⁺ T cells. Using the FIV model for lentiviral persistence, these studies provide a framework for understanding how immune activation combined with Treg cell-mediated suppression may affect CD8⁺ T cell IL2 transcription, maturation, and anti-viral function.

Introduction

Lentiviruses such as Human Immunodeficiency Virus (HIV) and Feline Immunodeficiency Virus (FIV) are able to evade an early, vigorous immune response and establish a persistent infection. Despite an initial, robust expansion in HIV-specific CD8⁺ T cells, virus is only partially cleared and CD8⁺ cells display signs of dysfunction including a lack of inflammatory cytokine production in response to activation by specific ligand(s) or in response to mitogenic stimulation (1-3). A specific group of HIV infected individuals referred to as elite controllers (EC) are able to control virus in the absence of therapeutic treatment and researchers have demonstrated that these individuals maintain a highly active population of HIV-specific CD8⁺ T cells into the chronic infection stage (4, 5). By comparison, HIV-infected individuals who do not effectively control virus harbor virus-specific CD8⁺ T cells with altered functionality leading to disruptions in overall immune homeostasis (1, 4). During chronic HIV/FIV, the virus replicates at low levels contributing to a state of chronic immune activation followed by immune exhaustion (6-9). These findings illustrate the need for a more detailed understanding of CD8⁺ T cell-mediated response to HIV/FIV infection and to define the direct cause for CD8⁺ dysfunction.

Using the FIV model for HIV/AIDS, our group and others have demonstrated the progressive activation of regulatory CD4⁺CD25⁺ regulatory T cells (Treg cells) during the course of infection, consistent with reports of activated regulatory cells being isolated from HIV patients (10-16). Several groups have reported that depletion of Treg cells during HIV infection results in boosted antiviral responses and CD8⁺ T cell activity. (15, 17). Similar to our findings using the FIV model, Kinter et al. (18) reported that CD4⁺CD25⁺ T cells in HIV⁺ patients significantly suppressed cellular proliferation and cytokine production by CD4⁺ and CD8⁺ T cells stimulated with HIV peptides in vitro. Although it is evident that Treg cells are able to suppress CD4⁺ and CD8⁺ effector T cells during the course of lentiviral infections, it is not clear if suppression is always harmful. Several investigations have indicated that CD4⁺CD25⁺ activation may play a protective role during the course of lentiviral infections and it has been reported that there is a significant expansion of CD4⁺CD25⁺ T cells in the blood of HIV⁺ patients on anti-retroviral therapy (19). Taken together, this evidence suggests that timing may be a critical factor, with Treg activation being detrimental during acute infection by inhibiting early T cell responses and thus aiding in the establishment of persistent infection but performing a beneficial role during chronic infection by dampening immune activation and associated pathologic inflammation during the course of chronic infection. These observations underscore the need to further understand the molecular mechanisms occurring in activated CD8⁺ T cells following interaction with lentivirus-activated Treg cells.

The intranuclear transcription factor FoxP3 serves as a “master molecule” for Treg cell function. FoxP3 alters gene expression profiles by binding to specific promoters, including the IL2 promoter, to regulate transcription through control of histone modifications and blocking the assembly of transcriptional machinery (20, 21). For example, FoxP3 and the linker histone H1.5 cooperatively bind the IL2 promoter and repress IL2 expression (22). Although FoxP3 has been broadly considered a regulatory cell specific marker, we and others have demonstrated increased FoxP3 expression in activated CD8⁺ lymphocytes following interaction with lentivirus-activated Treg cells (23, 24). Although some investigations have demonstrated that CD8⁺FoxP3⁺ T cells are suppressor cells, we and others were unable to document that CD8⁺FoxP3⁺ T cells exhibit suppressor function (23, 25). As part of the same series of experiments, we were able to demonstrate that Treg cells inhibited IL2 mRNA expression and induced G1 cell cycle arrest and anergy in CD8⁺ lymphocyte targets during both acute and chronic FIV (23, 26, 27). Findings from murine studies have offered clues as to what may be occurring to these cells during the course of lentiviral infection. OVA and LCMV studies have demonstrated that the acquisition of CD8⁺ effector function and differentiation into mature, virus-specific CTLs are clearly linked to specific epigenetic modifications at the IL2 promoter (28, 29). These studies have also shown that disruption of differentiation leads to the induction of CD8⁺ T cell dysfunction and eventual immune exhaustion, which is consistent with what occurs in lentivirus-induced CD8⁺ T cell immune dysfunction (30).

Based upon our previous findings that Treg cells induce anergy and suppression of IL2 production in CD8⁺ T cells following co-culture, we hypothesized that FoxP3 expressed in CD8⁺ target cells functions in a similar manner as FoxP3 in other T cell subsets, occupying the IL2 promoter and directly inhibiting gene expression. Further, we propose a mechanism by which early CD8⁺ T cell epigenetic changes (DNA demethylation), while essential to antiviral function, render activated CD8⁺ T cells highly permissive to Treg induced FoxP3 binding at the IL2 promoter. This mechanism of suppression thus leads to a loss of IL2 and effector cell function in the CD8⁺ target cells and helps to reconcile the seemingly paradoxical observations that activated CD8⁺ T cells exhibit characteristics associated with both chronic activation and altered immunologic function. These results define a key element involved in subverting the early CD8⁺ T cell response and identify potential avenues for rescuing and augmenting T cell function.

Materials and Methods

Cats and FIV infection

Specific pathogen-free cats were obtained from Liberty Labs (Liberty Corners, NJ) or Cedar River Laboratory (Mason City, IA) and housed at the Laboratory Animal Resource Facility at the College of Veterinary Medicine, North Carolina State University. Cats were inoculated with the NCSU₁ isolate of FIV, a pathogenic clade A virus, as described by Bucci et al (31). FIV infection was confirmed by ELISA (SNAP® FIV/FeLV, Idexx Laboratories) and provirus detected by PCR using primers specific for the FIV-p24 GAG sequence. At the time samples were taken, cats had been infected with FIV for at least 5 years and were clinically asymptomatic. Non-infected control cats ranged in age from 3 to 6 years and were housed separately from FIV-infected cats. Protocols were approved by the North Carolina State University Institutional Animal Care and Use Committee.

Sample Collection and Preparation

Whole blood (28 ml/cat) was collected by jugular venipuncture into EDTA Vacutainer tubes (Becton-Dickinson, Franklin Lakes, NJ). PBMC were isolated by Percoll density gradient centrifugation (Sigma-Aldrich, St. Louis, MO) as previously described (32) or by Ficoll-Histopaque-1077 density gradient centrifugation (Sigma-Aldrich, St-Louis, MO) following the manufacturer’s guidelines. Single-cell suspensions were prepared from popliteal or submandibular peripheral lymph nodes (PLN) obtained through surgical biopsies by gently and repeatedly injecting sterile PBS into the tissue using an 18G needle until the cells were released from the tissue. Cell counts and viability were determined by trypan blue dye exclusion and viability was always >90%.

Reagents and Antibodies

Recombinant human IL2 was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH from Dr. Maurice Gately, Hoffmann - La Roche Inc. Concanavalin A (ConA) was purchased from Sigma-Aldrich (St. Louis, MO). Streptavidin-PerCP was purchased from BD Biosciences PharMingen (San Diego, CA). Mouse anti-feline CD25 (mAb 9F23) was kindly provided by K. Ohno (University of Tokyo, Tokyo, Japan). Mouse anti-feline CD4 (mAb 30A) and CD8+ (mAb 3.357) were developed in our laboratory (33). PE conjugated rat anti-mouse FoxP3 (FJK-16s) used for flow cytometry analysis was purchased from eBioscience (San Diego, CA). ChIP grade anti-FoxP3 antibody (ab2481) used for ChIP immunoprecipitation was purchased from Abcam (Cambridge, MA). Curcumin (Product #C27727) and gemcitabine (Product #G6423) were purchased from Sigma-Aldrich.

CD8⁺ Co-culture Assays

Whole blood from FIV-infected or FIV-negative control cats was isolated as described and purified by Ficoll density gradient. PBMCs were then labeled with specific antibody and purified into CD4⁺CD25⁺ and CD8⁺ groups using a high-speed, high-purity fluorescence activated cell sorter (MoFlo, DakoCytomation). 1×10⁶ CD8⁺ cells were left untreated or stimulated with ConA (5ug/mL) and IL2 (100U/mL) for 1 hour, washed, and then cultured with or without CD4⁺CD25⁺ Treg cells at a 1:1 ratio. After 24 hours, cells were washed and then used directly for flow cytometry or resorted into pure CD8⁺ populations for analysis by PCR. The purity of FACS sorted cell populations was always > 95%.

Flow Cytometric Analysis

For comparison of intracellular staining of cultured PBMCs, at least 5×10⁵ cells were stained for surface expression of CD8, CD4 and CD25 using specific antibodies. For intracellular staining of FoxP3, cells were then washed in PBS, incubated with 4% PFA for 10 minutes, incubated in 0.1% Triton x-100 for 30 minutes, washed with PBS + 4% FBS, resuspended in 100 uL of PBS and incubated with FoxP3-specific antibody at room temperature for 20 minutes. Cells were washed in PBS + 4% FBS and analyzed on the FACSCalibur flow cytometer (BD Biosciences, Mountain View, CA). Lymphocytes were gated on forward vs. side scatter and 20,000 gated events were acquired and stored list-mode fashion for analysis using CellQuest software. Gating was determined using unstained and isotype controls.

Reverse Transcription and Real-time PCR

FoxP3 mRNA was detected by RT-PCR using feline specific primers for FoxP3 or IL2 as described previously (34). GAPDH mRNA expression was used as a normalizing control. Briefly, total RNA was isolated from 1×10⁶ CD8⁺ T cells using RNeasy Protect Mini Kit (Qiagen, Valencia, CA). Reverse transcription was carried out using a reverse transcription system kit from Promega as per the manufacturer’s protocol followed by real-time PCR using Quantitect SYBR green PCR kit (Qiagen, Valencia, CA). Reactions were run in triplicate in 96-well plates and all reactions were carried out using identical cycling conditions as follows: denatured at 95°C for 20s, annealed at 58°C for 20s, and elongated at 72°C for 30s with 40 cycles.

DNA methylation analysis and cloning

As the feline IL2 promoter has not been previously characterized, we first identified the feline IL2 gene using the NCBI data base for the felis catus whole genome. We then designed primers to amplify the region up to 1kb upstream of the transcriptional start site by first amplifying and sequencing smaller, overlapping regions and then piecing together a robust promoter map using sequences of genomic DNA isolated from two FIV negative and two FIV positive cat CD8⁺ samples (not shown). The resultant sequence was then analyzed for CpG residues and used to design qRT-PCR primers for later ChIP analyses (see Table I for primers). Three CpG residues were identified in this IL2 promoter region. For analysis of promoter methylation, DNA was isolated from at least 5×10⁵ lymphocytes using the QIAamp DNA Mini kit (Qiagen, Valencia CA) and then subjected to bisulfite modification using an EZ DNA Methylation-Gold kit (Zymo Research, Irvine CA). Reduced DNA was used as a template for IL2 promoter amplification using the primer set listed in Table I and the following cycling conditions: denatured at 95°C for 30s, annealed at 53°C for 30s, and elongated at 72°C for 30s with 40 cycles. Product was gel purified using the QIAquick gel extraction kit (Qiagen, Valencia CA) and then used as template for TA cloning. Briefly, product was ligated into the pGEM T Easy Vector System (Promega, Madison WI) according to manufacturer’s protocol and vectors were used to transform JM109 High Efficiency Competent Cells (Promega, Madison WI). Colonies were selected based on Blue/White screening and processed using the ZR Plasmid Miniprep kit (Zymo Research, Irvine CA). Individual clones were sent for sequencing to Eurofins MWG Operon (Huntsville, AL). Sequence data was analyzed using the Geneious analysis software program (35).

Table I.

Real-time qPCR primers and primers for PCR product cloning.

Primer target	Forward (5′- 3′)	Reverse (5′- 3′)
FoxP3 (mRNA)	atttcatgcaccagctctcaacgg	accatcttcctggatgagaagggca
IL2 (mRNA)	acagtgcacctgcttcaagctct	cctggagagtttggggttctcagg
GapDH (mRNA and ChIP)	ccttcattgacctcaactacat	ccgaagtggtcatggatgacc
IL2 (bisulfite trt promoter)	gggtagttagtgtattatattgagg	ccttaaatttatacttattatattttcacc
IL2 (ChIP promoter)	tggaggagtcaccagcaatg	tccactacagcatctagggc

Global DNA methylation

For global methylation analysis, DNA was isolated from 1e6 FACS-purified lymphocytes and analyzed using the Methylamp Global DNA Methylation kit (Epigentek, Farmingdale NY) following manufacturer’s instructions.

Chromatin Immunoprecipitation (ChIP) Assay

After culture, cells were re-sorted (97-99% purity) and cross-linked with 1% formaldehyde for use in ChIP experiments. Anti-Foxp3 (Abcam, ab2481) ChIPs was performed with an A/G agarose ChIP kit (Thermo Scientific), following the manufacturers protocol. After enzymatic digestion, 10% of the chromatin was saved as input controls. The remaining chromatin was immunoprecipitated with 1 μg of antibody during an overnight incubation at 4°C. After IP elution, cross-linking was performed on the purified product and DNA fragments collected for use in real-time qPCR following the described cycling conditions and with primers listed in Table I. The relative enrichment was calculated using input controls and a delta-delta Ct equation as follows: (2^-(Ct_{IL2, IP} – Ct_{Gapdh, IP}))/(2^-(Ct_{IL2, input}-Ct_{Gapdh, input}))

Statistical Analysis

The Mann-Whitney U test (t test for nonparametric data) was used for pair-wise comparison of parameters. Differences were considered to be significant at p < 0.05.

Results

Lentivirus-activated Treg cells induce FoxP3 expression in CD8⁺ cells during co-culture

Our lab and others have previously documented a population of CD8⁺FoxP3⁺ cells exhibiting altered function, including decreased IL2 production, that are not suppressor cells. Chronic FIV infection is associated with progressive Treg cell activation; therefore, we asked whether Treg cells from FIV⁺ cats induce FoxP3 expression in autologous, ConA-activated CD8⁺ targets. Because FoxP3 is a transcriptional regulator and is known to modulate IL2 expression, we hypothesized that activated Treg cells induce FoxP3 expression in CD8⁺ T cell targets, leading to IL2 suppression. To address this hypothesis, we first demonstrated FoxP3 induction in CD8⁺ target cells. Lymphocytes from 8 FIV-infected or 4 control cats were isolated from peripheral blood and sorted into CD4⁺CD25⁺ or CD8⁺ populations. CD8⁺ T cells were left untreated or activated by ConA (5ug/mL, 1 hour) stimulation, and then cultured for 24 hours with or without CD4⁺CD25⁺ Treg suppressor cells. After co-culture, cells were analyzed by flow cytometry for intracellular FoxP3 expression. As shown in Fig. 1A-B, ConA stimulation alone induced FoxP3 expression in treated CD8⁺ cells, consistent with reports of transient FoxP3 expression in activated lymphocytes (36). 1 hour stimulation with ConA (5ug/mL) followed by 24 hour co-culture with FIV-activated Treg cells led to significantly increased FoxP3 protein expression in CD8⁺ target cells when compared to controls. By comparison, lymphocytes from FIV⁻ cats exhibited a relatively small increase in FoxP3 following stimulation and Treg cell co-culture, consistent with a lack of in vivo activation of Treg cells from FIV⁻ cats (Fig. 1A). Representative flow cytometry dot plots demonstrate an increase in both the percentage of positive cells and FoxP3 fluorescence following autologous Treg co-culture in FIV⁺ cats, when compared to FIV⁻ control cats (Fig. 1B). FoxP3 mRNA expression was also analyzed by qRT-PCR in peripheral blood CD8⁺ T cells from FIV⁺ or control cats following the same stimulation and culture conditions. As with protein expression levels, FoxP3 transcription was upregulated following co-culture of activated CD8⁺ T cells with autologous, lentivirus-activated Treg cells (Fig. 1C). These results demonstrate that lentivirus-activated Treg cells are able to induce FoxP3 mRNA expression and protein production in activated CD8⁺ T cell targets.

FIGURE 1. FoxP3 protein and mRNA levels are increased in CD8⁺ lymphocytes following co-culture with lentivirus-activated Treg cells.

Intracellular expression of FoxP3 was measured by flow cytometry in untreated CD8⁺ T cells, CD8⁺ T cells stimulated with ConA (5 μg/mL, 1 hour), or in ConA-stimulated CD8⁺ T cells co-cultured with Treg cells for 24 hours (a.) The percentage of FoxP3 expression is increased approximately two-fold in stimulated CD8⁺ T cell targets following co-culture with Treg cells from FIV⁺ cats. Bars represent the mean + SEM for FIV⁻ or FIV⁺ cats (p <0.05, 4 and 8 independent experiments, respectively). (b.) Representative flow cytometry dot plots from FIV⁻ (upper row) and FIV⁺ cats (lower row) show the percentage of FoxP3⁺ positive cells (upper right corner) for untreated CD8⁺ T cells (left column, FIV⁻ 1%, FIV⁺ 4%), CD8⁺ T cells stimulated with ConA (middle column, FIV⁻ 6%, FIV⁺ 8%), or in ConA-stimulated CD8⁺ T cells co-cultured with Treg cells for 24 hours (right column, FIV⁻ 7%, FIV⁺ 19%). CD8⁺ T cells were gated and analyzed by forward scatter (FSC, x axis) vs. FoxP3 fluorescence (y axis). The dot plots demonstrate the change in both the percentage of positive cells and fluorescence intensity for FoxP3 (c.) FoxP3 mRNA induction (fold change) was higher in all treatment groups from FIV⁺ cats when compared to FIV⁻ cats and in ConA-stimulated CD8⁺ lymphocytes following Treg co-culture. Each bar represents the mean + SEM for 5 or 6 experiments (p<0.05, arrows).

Treg cell-induced FoxP3 binds to the IL2 promoter in activated CD8⁺ T cells

FoxP3 binds the IL2 promoter in other T cell subsets; therefore, we asked if FoxP3 binding might be responsible for IL2 inhibition in CD8⁺ T cells following co-culture with lentivirus-activated Treg cells. To our knowledge, no one has demonstrated FoxP3 binding to the IL2 promoter in activated CD8⁺ T cells following interaction with lentivirus-activated Treg cells. To answer this question, we performed ChIP on CD8⁺ T cells. As described in the methods, CD8⁺ lymphocytes isolated from FIV⁺ PLNs were stimulated for one hour with 5ug/mL ConA and then co-cultured with autologous Treg cells or left alone in culture for 24 hours. Cells were resorted into CD8⁺ or CD4⁺CD25⁺ fractions and ChIP was performed on the purified CD8⁺ T cells using a feline-specific anti-FoxP3 antibody, followed by PCR for the IL2 promoter. As shown in Fig. 2A, FoxP3 binds the IL2 promoter in the activated CD8⁺ cells following coculture with autologous CD4⁺CD25⁺ cells (Lanes 3,5,7; white arrows) but not when cultured alone (Lanes 2,4,6). To confirm that IL2 production in CD8⁺ lymphocytes from FIV⁺ cats is suppressed following co-culture conditions with CD4⁺CD25⁺ Treg cells, real-time RT-PCR for IL2 mRNA was performed on lymphocytes isolated from FIV⁺ or FIV⁻ PLNs as described. Fig. 2B demonstrates the expression of IL2 mRNA in untreated CD8⁺ cells, ConA (5ug/mL, 1 hour) stimulated CD8⁺ cells, or in ConA stimulated CD8⁺ cells following 24 hour Treg co-culture. CD8⁺ cells from FIV⁺ cats exhibited robust IL2 mRNA production following ConA stimulation which was abrogated by Treg cell co-culture, while FIV⁻ cats exhibit far less IL2 production in response to the same treatment conditions. Taken together, the results of Figs. 1-2 suggest that lentivirus-activated Treg cells induce FoxP3 expression and FoxP3 binding to the IL2 promoter, suppressing IL2 transcription in activated CD8⁺ T cell targets.

FIGURE 2. Treg-induced FoxP3 binds the IL2 promoter in activated CD8⁺ T cells, inhibiting IL2 transcription.

(a.) CD8⁺ and CD4⁺CD25⁺ Treg cells were purified from FIV⁺ PLNs and utilized for co-culture experiments. FoxP3 ChIP followed by PCR for the IL2 promoter resulted in IL2 promoter enrichment in ConA-stimulated (5ug/mL, 1 hour) CD8⁺ cells co-cultured with Treg cells (lanes 3, 5, 7, arrows), whereas there was little IL2 promoter enrichment in CD8⁺ cells stimulated with ConA alone (5ug/mL, 1 hour, lanes 2,4,6). (b.) CD8⁺ lymphocytes from FIV⁻ or FIV⁺ PLNs were either untreated, ConA stimulated (5ug/ml), or were ConA stimulated for two hours prior to autologous CD4⁺CD25⁺ Treg co-culture. After 24 hrs, RNA was isolated and RT-qPCR was performed on all sample groups. SPF control cats with little antigenic exposure exhibit only a modest response to mitogenic stimulation. IL2 was decreased by approximately four-fold in ConA stimulated CD8⁺ lymphocytes from FIV⁺ cats following CD4⁺CD25⁺ co-culture (p<0.05). For both (a.) and (b.), CD8⁺ lymphocytes and Treg cells from FIV⁺ cats were separated by cell sorting following co-culture (~99% purity).

CD8⁺ T cells from FIV⁺ cats exhibit epigenetic remodeling at the IL2 promoter

Activation of CD8⁺ CTLs during lentiviral infection has been extensively documented (2, 4, 37-39) but epigenetic changes induced by chronic infection at promoters for genes important for antiviral function remains largely uncharacterized. Specifically, alteration in methylation status at these regions can correlate with chromatin structure and impact accessibility of promoters for transcription factor binding. Therefore, we asked whether the chronic immune stimulation of during FIV infection led to epigenetic changes at the CD8⁺ T cell IL2 promoter; specifically, changes in IL2 promoter methylation. To address this question, we first analyzed the chromatin conformation of the IL2 promoter region in CD8⁺ T cells from FIV⁺ and FIV⁻ cats because increased DNA demethylation at the IL2 promoter is consistent with active transcription (40). CD8⁺ T cells were isolated from 4 FIV⁺ and 4 FIV⁻ control cats. DNA from each sample was subjected to bisulfite modification, amplified with feline IL2 promoter-specific primers (Table I), TA cloned and then sequenced. Demethylated cytosine residues were converted to uracil by bisulfite reduction which was detected as a thymine residue in the subsequent real-time PCR sequencing data. Three separate CpG residues were identified within the IL2 promoter (Fig. 3A, shaded regions). None of the FIV⁻ cats exhibited demethylation at CG1 (−1436) or CG3 (−1236) and modest demethylation at CG2 (−1333). The FIV⁺ cats also had no demethylation at CG1 (−1436). However, the FIV⁺ cats exhibited greater demethylation at both distal sites, CG2 (−1333) and CG3 (−1236), when compared to FIV⁻ cats. The percent demethylation of thirty CpG residues were calculated for each cat (10 unique clones × 3 sites). FIV⁺ cats displayed a significantly higher percentage of IL2 promoter demethylation when compared to FIV⁻ cats (Fig. 3C, p<0.05).

FIGURE 3. CD8⁺ T cells from FIV⁺ cats exhibit a high degree of IL2 promoter CpG de-methylation.

We have fully sequenced the feline IL2 promoter 1 kb upstream of the transcription start site (not shown). (a.) Within the upstream promoter region (−1469 to −1073) we have identified 3 CpG residues (shaded boxes) for methylation analysis. (b.) Following purification of CD8⁺ T cells from 4 FIV⁺ and 4 FIV⁻ PLNs by high speed cell sorting, DNA was isolated, bisulfite reduced and used for PCR amplification of the IL2 promoter. The product was cloned and the sequences analyzed. Demethylation of the CpG residues, shown in 3a above, were identified by replacement of the C with a T following bisulfite reduction (CG1 −1436, CG2 −1333, CG3 −1236). Each pie chart represents the percent demethylation (white) of CG1-CG3 for the cloned sequences from each cat. None of the FIV⁻ cats exhibited demethylation at CG1 or CG3 and modest demethylation at CG2. FIV⁺ cats also exhibited no demethylation at CG1; however, these cats exhibited greater demethylation at CG2 and CG3 when compared to FIV⁻ cats (c.) The percent demethylation for thirty CpG residues (CG1-3) from the IL2 promoter was analyzed for FIV⁻ (mean 5%, triangles, n=4) and FIV⁺ (mean 19%, circles, n=4) cats. CD8⁺ T cells from FIV⁺ cats exhibit an almost four-fold increase in demethylation at the IL2 promoter. (*p<0.05).

Modulating DNA methylation prevents FoxP3 from binding to the IL2 promoter in activated CD8⁺ T cells following Treg co-culture

Taken together, the results of Figs. 2-3 suggest that CD8⁺ T cell activation renders the IL2 promoter permissive to Treg-induced FoxP3 binding and suppression of IL2 transcription. Therefore, we asked if modulating DNA demethylation in activated CD8⁺ T cells might inhibit FoxP3 binding. Gene promoter regions can be activated by demethylation or silenced by hypermethylation and enzymes such as DNA methyltransferases (DNMTs) are integral to both these functions (41-44). Several compounds have been reported to modulate DNA methylation activity in vitro and for our purposes, we selected gemcitabine and curcumin which are reported to inhibit both DNA methylation and demethylation activity presumably through altering methyl group transfer and repair (41-44). Recent findings suggest that the combination of gemcitabine and curcumin provides maintenance of methylation status ex-vivo and prevents hypermethylation following mitogenic stimulation (45-47). We first performed a dose response curve to determine if treatment of purified CD8⁺ lymphocytes from an FIV negative cat with various concentrations of curcumin or gemcitabine would result in cell death as measured by FACS analysis of propidium iodide labeled cells (data not shown). After selecting the highest concentration for each compound which did not result in cell death (greater than controls) following a 12 hour incubation, we performed a second set of experiments to determine the combined effects of treating lymphocytes with these doses of compound over increasing lengths of time. As shown in Fig. 4A, curcumin (1mmol) plus gemcitabine (100 nmol) treatment did not cause significant cell death until after 12 hours of incubation time. We next determined whether 2 hours of treatment with each compound would be sufficient to modulate DNA methylation in mitogen-activated CD8⁺ T cells from FIV negative cats by performing global methylation analyses on sorted CD8⁺ cells. Curcumin has a high degree of yellow pigmentation which interfered with optical density measurement in the global methylation assay and we were unable assess global methylation with curcumin alone or with curcumin plus gemcitabine (not shown). As shown in Fig. 4B, gemcitabine (100 nmol) treatment for 2 hours prior to ConA stimulation was sufficient to prevent global demethylation and induced a small degree of hypermethylation when compared to untreated controls. CD8⁺ T cells were then treated with curcumin and gemcitabine prior to ConA activation and co-cultured with autologous CD4⁺CD25⁺ Treg cells for 24 hours to demonstrate that blocking DNA demethylation in activated CD8⁺ lymphocytes inhibits FoxP3 binding. As shown in Fig. 4C, CD8⁺ T cells treated with ConA alone displayed little FoxP3 enrichment at the IL2 promoter (gray bar). However, coculture with CD4⁺CD25⁺ Treg cells resulted in significant FoxP3 protein binding to the IL2 promoter in CD8⁺ cells (Fig. 4C, black bar), consistent with our previous findings from Fig 2A. Importantly, pretreatment of the CD8⁺ lymphocytes with curcumin and gemcitabine completely blocked the binding of FoxP3 protein to the IL2 promoter, suggesting that DNA demethylation of the IL2 promoter is required for the binding of this repressive transcription factor (Fig. 4C, hatched bar).

FIGURE 4. Blocking DNA demethylation prevents Treg-induced FoxP3 binding to the CD8⁺ IL2 promoter in mitogen activated cells.

(a.) To assess toxicity of combined treatment, PBMCs from an FIV⁻ cat were treated with curcumin (1mmol) and gemcitabine (100 nmol). After 1, 2, 4, 6, 12 or 24 hours of combined treatment, cells were labeled with propidium iodide and the percent cell death was calculated by comparing to untreated controls. At 12 and 24 hours, increased toxicity was noted. Data is representative of two separate experiments with samples run in triplicate. (b.) Percent global methylation was determined for untreated CD8⁺ cells, ConA (5ug/mL, 1hr) treated CD8⁺ cells, and gemcitabine (100 nmol, 2 hours) followed by ConA (5ug/mL, 1 hr) treated CD8⁺ cells. CD8⁺ T cells exhibited global demethylation following ConA stimulation (gray bar). Consistent with reports that gemcitabine inhibits DNA methyltransferase activity, feline CD8⁺ lymphocytes treated with gemcitabine exhibited lack of global DNA demethylation following ConA stimulation (black bar, p<0.05, n=5 cats). (c.) To demonstrate that inhibiting DNA demethylation blocks FoxP3 binding to the IL2 promoter, activated CD8⁺ T cells were co-cultured with autologous Treg cells (black bars) or were treated with gemcitabine (100 nmol) and curcumin (1 mmol) prior to co-culture (hatched bar). Controls included untreated (white bar) and ConA stimulated (gray bar) CD8⁺ T cells. Following CD8⁺ / Treg cell co-culture, FoxP3 binding to the IL2 promoter was enriched approximately 100 times that of untreated cells (black bar). FoxP3 binding to the IL2 promoter in mitogen-activated CD8⁺ T cells was completely blocked by pre-treatment of CD8⁺ T cells with curcumin and gemcitabine, clearly demonstrating that FoxP3 occupies demethylated IL2 promoter sequences (hatched bar, p=0.05, n=5).

Discussion

The transcription factor FoxP3 is upregulated in CD8⁺ lymphocytes activated by mitogenic stimulation or antigenic stimulation, and following interaction with lentivirus-activated Treg cells (23, 24). Here, we have reported that the induction of FoxP3 in activated CD8⁺ T cells following co-culture with lentivirus-activated Treg cells is associated with decreased IL2 mRNA expression. Transient expression of FoxP3 in activated CD8⁺ lymphocytes is most likely a normal regulatory feedback mechanism (36). However, we hypothesized that aberrant FoxP3 expression following the interaction of activated CD8⁺ T cells with activated Treg cells leads to suppression of genes essential for CD8⁺ T cell antiviral function and maturation.

Previously, we have demonstrated that lentivirus-activated Treg cells induce stable FoxP3 expression and suppressor function in CD4⁺ T helper cells, following co-culture (48, 49). We and others have also demonstrated increased FoxP3 expression in activated CD8⁺ lymphocytes following mitogenic stimulation, antigenic stimulation, and upon interaction with lentivirus-activated Treg cells (23, 24). Although others have demonstrated that these CD8⁺FoxP3⁺ cells are indeed suppressor cells, our laboratory was unable to document that CD8⁺ lymphocytes exhibited suppressor function following Treg co-culture, despite the induction of CD8⁺ FoxP3 expression (23, 25). As part of the same series of experiments in our laboratory, we were able to demonstrate that Treg cells induce G₁ cell cycle arrest and anergy in CD8⁺ T cell targets during both acute and chronic FIV infection (23, 26, 50). Figs. 1-2 clearly demonstrate that FoxP3 is increased in CD8⁺ T cells following co-culture with lentivirus-activated Treg cells and, more importantly, that FoxP3 binds the IL2 promoter in CD8⁺ T cells inhibiting transcription of this essential cytokine. Our observations are consistent with those previously reported by Dieckman et al, who reported that Treg cells inhibited both CD4⁺ Th and CD8⁺ T cell function but induced suppressor function only in CD4⁺ T cells (51).

Activated T cells exhibit varying degrees of demethylation at the IL2 promoter. For example, Northrop et al reported CD8⁺ T cell IL2 promoter demethylation that followed a trend of progressive distal to proximal demethylation (52). They further demonstrated that IL2 promoter demethylation was augmented in antigen specific CD8⁺ T cells that had received CD4⁺ T cell help, as compared to CD8⁺ T cells from Th-deficient mice (52). Consistent with our findings here, Nakayama-Hosoya et al have demonstrated that both CD4⁺ T cells and CD8⁺ T cells exhibit a trend toward progressive distal to proximal IL2 promoter demethylation in HIV infected patients; while CD4⁺ demethylation was also dependent upon CD57 expression and maturation status (53). Based upon these findings, we asked if persistent activation of CD8⁺ T cells during chronic FIV infection leads to demethylation of the IL2 promoter, which is associated with actively transcribed euchromatin. To address this hypothesis, we first performed a full sequence analysis on the feline IL2 promoter. We identified three CpG residues within the 1kb region upstream of the IL2 gene and evaluated the methylation status of these cytosine residues in purified CD8⁺ T cells from FIV positive and FIV negative cats. Three separate CpG residues were identified within the IL2 promoter (Fig. 3A, shaded regions). None of the FIV⁻ cats exhibited demethylation at CG1 (−1436) or CG3 (−1236) and modest demethylation at CG2 (−1333). Like the FIV⁻ controls, the FIV⁺ cats also had no demethylation at CG1 (−1436). More importantly, the FIV⁺ cats exhibited greater demethylation at both distal sites, CG2 (−1333) and CG3 (−1236), when compared to FIV⁻ cats. Why CG1 exhibited no demethylation in either FIV⁻ or FIV⁺ cats is uncertain. However, our findings suggest a trend toward distal promoter demethylation in CD8⁺ T cells from FIV⁺ cats, consistent with the previous reports from Northrop et al and Nakayama-Hosoya et al mentioned above (52-53). When total IL2 promoter demethylation is examined, as shown in Fig. 3C, there was increased demethylation in the IL2 promoter in CD8⁺ T cells from FIV⁺ cats when compared to FIV⁻ cats. Collectively, these data support our hypothesis that the CD8⁺ T cell IL2 promoter is in an “open” conformation, poised for IL2 transcription.

We then asked if DNA demethylation resulted in increased susceptibility to FoxP3 suppression and if blocking demethylation might inhibit FoxP3 binding to the IL2 promoter. First, we demonstrated that we could inhibit DNA demethylation during CD8⁺ T cell activation by treatment with gemcitabine. We also treated cells with curcumin which is reported to prevent DNA hypermethylation and likely inhibits DNMT activity (44, 54). Although our target was inhibition of DNMT activity in activated CD8⁺ T cells, both curcumin and gemcitabine are reported to have other effects upon epigenetic conformation and cellular function. For example, curcumin can modulate histone deacetylase activity as well as histone acetyltransferase activity (55-57). One of the primary mechanisms of action for gemcitabine is incorporation into the growing DNA strand with chain termination through DNA polymerase inhibition (58). Therefore, it is possible that these compounds may have affected other cellular pathways in CD8⁺ target cells and is a limitation of the studies reported here. It is also likely that these compounds modulate Treg cell function. Therefore, to avoid this confounding factor, CD8⁺ T cells targets were treated prior to Treg cell coculture to assess the effects directly upon CD8⁺ T cells. Finally, of primary concern was cellular toxicity; therefore, toxicity and dose response curves were determined for each compound. As demonstrated in Fig. 4a-b, at these drug concentrations, DNA methylation was significantly reduced and no significant cell death was observed. We next demonstrated that FoxP3 directly binds the IL2 promoter region in activated CD8⁺ T cells following Treg co-culture by performing FoxP3 ChIP and identifying enrichment of the IL2 promoter by the FoxP3-bound chromatin (Figs. 2A, 4C). Finally, we treated CD8⁺ T cells with curcumin and gemcitabine to block DNMT activity, prior to activation and demonstrated that this prevented FoxP3 binding to the IL2 promoter. These findings are consistent with our hypothesis that DNA demethylation of the IL2 promoter in activated CD8⁺ T cells increases susceptibility to direct suppression of IL2 by FoxP3.

Studies using LCMV have offered some insight in what may be occurring at the IL2 promoter during the course of lentiviral infections. Northrop et al. (29, 52) have clearly demonstrated that the generation of phenotypically mature, fully functional CD8⁺ lymphocytes is dependent upon DNA demethylation at the IL2 promoter region. Conversely, dysfunctional CD8⁺ lymphocytes exhibited increased DNA methylation at the IL2 promoter and failure to undergo complete maturation. Studies of LCMV have also demonstrated that during protracted viral infection, CD8⁺ lymphocytes are persistently activated yet exhibit progressive loss of IL2 production (59). Collectively, these data suggest epigenetic patterns established early during the course of viral infection contribute to either a robust cellular immune response or to CD8⁺ T cell dysfunction, poor maturation, and progressive loss of CD8⁺ cytokine function.

Although not the focus of these investigations, lentiviruses may also directly influence DNA methylation profiles. For example, Abdel-Hameed, et al. recently reported that chronic HIV infection is associated with alterations in expression of methylation machinery including suppression of DNMT-1 activity, leading to increased FoxP3 promoter demethylation (60). However, others have demonstrated that HIV may enhance the activity of DNMTs, leading to hypermethylation and inactivation of genes important for anti-viral function, such as IFNγ (61). Collectively, these findings suggest it is possible that lentiviruses may directly influence methylation at the IL2 promoter region but how this may affect IL2 transcription is uncertain. Further, Figs. 2 and 4 clearly demonstrate that FoxP3 binds the IL2 promoter and this binding is associated with decreased IL2 mRNA.

We and others have previously established that CD8⁺ T cells exhibit an activated phenotype during the course of FIV infection (23, 62, 63). Therefore, the focus of this investigation was to demonstrate how Treg cells may utilize CD8⁺ T cell activation as a route for CD8⁺ T cell suppression. Using the FIV model for AIDS lentiviral infections, this study provides a key mechanistic insight into IL2 suppression in CD8⁺ lymphocytes. These studies clearly demonstrate that FoxP3 binds the IL2 promoter in mitogen-activated CD8⁺ T cells from FIV⁺ cats, following coculture with autologous Treg cells.

Further, we demonstrate that the CD8⁺ T cell IL2 promoter is demethylated in FIV⁺ cats when compared to FIV⁻ cats. One of the limitations of this study is the potential “off target” effects of gemcitabine and curcumin on CD8⁺ T cells. Despite this limitation, these findings support a novel mechanism of CD8⁺ T cell dysfunction during the course of lentivirus infection. These data also help to reconcile, at a molecular level, the seemingly paradoxical observation that phenotypically activated CD8⁺ T cells exhibit compromised effector function during the course of lentiviral infection. From this data we propose a mechanism by which Treg cells induce the expression of FoxP3 in activated CD8⁺ lymphocytes, which in turn suppresses IL2 production by binding at the demethylated IL2 promoter and interfering with transcription. Investigations are underway to identify these mechanisms in virus-specific CD8⁺ T cells during the acute stage of infection and follow them through the chronic stage of infection. A schematic representation of this “active suppression” model is shown in Fig. 5.

FIGURE 5. A model for lentivirus-activated Treg cell and FoxP3 exploitation of epigenetic rearrangements in activated CD8⁺ T cells.

The chromatin configuration within an inactive (left, heterochromatin) and activated T lymphocyte (center, euchromatin) are shown. In a quiescent T cell the DNA is tightly coiled around histone proteins and inactive promoter regions are highly methylated. Upon activation, the DNA relaxes into a euchromatin conformation and the cell is poised for transcription. Following DNA demethylation (Me, circles) at the IL2 promoter region, the promoter is actively transcribing IL2 and is thus open and accessible. Lentivirus-activated Treg cells are able to interact with the activated CD8⁺ T cell target, inducing the expression of the repressive transcription factor, FoxP3. In the activated CD8⁺ T cell, FoxP3 binds the IL2 promoter and inhibits transcription, inducing “active suppression.”