Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Feb 12.
Published in final edited form as: Neuroscience. 2014 Nov 18;0:79–86. doi: 10.1016/j.neuroscience.2014.11.005

Prenatal Protein Malnutrition Decreases KCNJ3 and 2DG Activity in Rat Prefrontal Cortex

AC Amaral a,*, M Jakovcevski b, JA McGaughy c, SK Calderwood d, DJ Mokler e, RJ Rushmore a, JR Galler f, SA Akbarian g, DL Rosene a
PMCID: PMC4298467  NIHMSID: NIHMS643115  PMID: 25446346

Abstract

Prenatal protein malnutrition (PPM) in rats causes enduring changes in brain and behavior including increased cognitive rigidity and decreased inhibitory control. A preliminary gene microarray screen of PPM rat prefrontal cortex (PFC) identified alterations in KCNJ3 (GIRK1/Kir3.1), a gene important for regulating neuronal excitability. Follow-up with polymerase chain reaction and Western blot showed decreased KCNJ3 expression in PFC, but not hippocampus or brainstem. To verify localization of the effect to the PFC, baseline regional brain activity was assessed with 14C-2-deoxyglucose. Results showed decreased activation in PFC but not hippocampus. Together these findings point to the unique vulnerability of the PFC to the nutritional insult during early brain development, with enduring effects in adulthood on KCNJ3 expression and baseline metabolic activity.

Keywords: Prenatal Protein Malnutrition, Prefrontal Cortex, KCNJ3, GIRK1, Brain Activity, 2-deoxyglucose

There is strong evidence that exposure to perinatal malnutrition in humans is linked to cognitive impairment and to behavioral and neuropsychiatric disorders later in life, including an increased prevalence of attention deficits, antisocial personality disorders, and schizophrenia (Susser et al.,1996; St Clair et al., 2005; Galler et al., 2012; Galler et al., 2013; Susser and St Clair, 2013). Studies in a rat model of prenatal protein malnutrition (PPM) have shown behavioral, anatomical, morphological and neurophysiological deficits in the adult rat, even after postnatal nutritional rehabilitation (Tonkiss and Galler, 1990; Galler et al., 1996; Morgane et al., 2003). In the hippocampus, PPM leads to neurophysiological and neuroanatomical changes that increase neuronal inhibition (Chang et al., 2003; Lister et al., 2011). In the prefrontal cortex (PFC), PPM leads to alterations in neurotransmitter release (Mokler et al., 2007) and in immediate early gene activation in response to stress (Rosene et al., 2004). Behaviorally, PPM rats have decreased inhibitory control and are more cognitively rigid, two behavioral domains that critically depend on PFC circuitry (McGaughy et al., 2014).

While these long lasting behavioral and neurological deficits have been well documented, little is known about how molecular mechanisms are affected by PPM. To screen for genes that might be altered by PPM, we used a high-density microchip microarray (Galler et al., unpublished results) to compare gene expression in adult rats that had undergone PPM and were challenged with restraint stress to well-nourished controls. This screen identified numerous genes that were up- or down-regulated in the PFC following PPM. (See Table 1 for the genes with highest change). Of these, based on its robust level of change and potential functional importance for inhibitory processes, the gene KCNJ3 was selected for follow-up investigation. KCNJ3 is an inwardly-rectifying potassium channel, subfamily J, member 3, also known as GIRK1 and Kir3.1. It belongs to a G protein-gated inwardly rectifying potassium (GIRK) channel family that plays an important role in controlling neuronal excitability by hyperpolarizing the membrane and generating slow post synaptic inhibitory potentials (Hibino et al., 2010). GIRK channels are formed by differential multimerization among the four subunits expressed in mammals (GIRK1–GIRK4), of which only the first three are commonly expressed in the brain (Lusher and Slesinger, 2010). GIRK loss-of-function can lead to excessive neuronal excitation, such as in epilepsy (D’Adamo et al., 2013), whereas gain-of-function can substantially reduce neuronal activity, such as when GIRK2 is triplicated in a mouse model of Down syndrome (Best et al., 2007). In humans, alterations in expression levels in KCNJ3 gene have been linked to schizophrenia (Yamada et al., 2011, 2012), epilepsy (Chioza et al., 2002; Lucarini et al., 2007), developmental delays and language impairment (Newbury et al., 2009), and mental retardation in children (Poot et al., 2010).

Table 1. mRNA species significantly downregulated (left) or upregulated (right) by behavioral stress in the PFC of rats: influence of PPM.

Genes were selected on the significant alteration after stress. Statistically significant changes were assessed by ANOVA analysis and examination of false discovery rate.
Gene Fold change (down) Gene Fold change (up)
KCNJ3 −5.8 Plagl1 1.9
Snap91 −1.7 Mta1 1.5
RTIAw2 −1.7 Homer1 1.4
Rnpt4 −1.5 Par3 1.3
Pap3 −1.5 Rasd1 1.3
Vti −1.4 Scg2 1.3
Opr1 −1.4 Unc13h3 1.3
Birc4 −1.4
Ptpze −1.4
Open in a new tab

Results obtained from a high-density microchip array (Genome 230A, Affymetrix, Inc., Santa Clara, CA). Subjects in this study were Sprague Dawley male rats age P350 (n=16, n=8 25/25, n=8 6/25) bred and nourished according to the same PPM model described here (Tonkiss and Galler, 1990). Behavioral challenge was conducted as described in Rosene et al. (2004).

This study investigated the effect of PPM on KCNJ3 using quantitative polymerase reaction to quantify the gene expression change and Western blot analysis to verify effects on protein levels. To localize the effect of prenatal malnutrition on brain function, 2-deoxyglucose (2DG) was used as a measure of resting state neuronal activity.

EXPERIMENTAL PROCEDURES

Subjects and Nutritional Treatment

Subjects were male Long-Evan rats derived from two breedings (designated A and B). Adult male and females rats were obtained from Charles River, Wilmington, MA. Nutritional manipulation followed previously published methods (Tonkiss and Galler, 1990). In brief, and as summarized in Figure 1, five weeks prior to mating, nulliparous females were randomized into two groups and placed on one of two isocaloric diets: an adequate protein diet (25% casein) or a low protein diet (6% casein) supplemented by l-methionine (Teklad Laboratories, Madison, WI). Females were mated with males that had been acclimated to these respective diets for one week prior to mating. Dams were maintained on the respective diets throughout pregnancy. Following parturition, litters from both nutritional groups were culled to eight pups (2 females and 6 males) and fostered within 24 hrs of birth as whole litters to dams that had received the 25% casein diet and had given birth within the same 24 hr period. This effectively institutes nutritional rehabilitation for the pups from mothers on the 6% casein diet. For all experiments we used only one pup from each litter to avoid litter effects. Thus, the “n” in each experiment represents both the number of subjects and litters.

Figure 1. Experimental timeline of rat model of prenatal protein malnutrition.

Figure 1

Open in a new tab

This model was designed to assure that the malnutrition insult was restricted to the prenatal period. All pups were cross-fostered to lactating dams given the 25% protein diet prior to mating and throughout pregnancy. Pups born to dams provided the 6% protein diet and fostered to dams given the 25% protein diet were designated “6/25” (prenatally malnourished) rats. And pups born from and fostered to dams given the 25% protein diet were designated “25/25” (well-nourished) controls.

Pups born to mothers on the 6% casein diet and fostered to mothers on 25% casein are designated the 6/25 group, while pups born to mothers on a 25% casein diet are designated as the 25/25 group. At day 21, all rats were weaned and placed on a standard laboratory chow diet (Purina Mills Inc., Richmond, IN; Formula 5001). The animal quarters were maintained at a temperature of 23°C (± 2°) and at 35–65% humidity on a reverse 12h day/night (8:00–20:00 dark) cycle with red fluorescent lighting during the dark portion providing dim illumination. All procedures were approved by the University of New England Institutional Animal Care and Use Committee (20101005MOK) in accordance with guidelines outlined in the NIH Guide for the Care and Use of Laboratory Animals and the Society for Neuroscience Policies on the Use of Animals and Humans in Neuroscience Research.

Euthanasia and Sample Preparation - Fresh Tissue

For tissue harvest of fresh brain samples, animals were deeply anesthetized with CO2 followed by decapitation. The brains were rapidly removed from the skull and placed on a chilled glass plate. The olfactory bulbs were removed and the hemispheres separated along the median longitudinal fissure and divided into four pieces each: PFC, hippocampus, brain stem/basal ganglia and remaining cortex. The PFC block was dissected coronally just anterior to the corpus callosum and included anterior cingulate, medial and orbital prefrontal cortex and the frontal pole cortex along with some of the head of the caudate. The hippocampus was dissected by cutting the fornix rostrally at the septum and then “unrolling” and separating it as a single piece from the adjacent corpus callosum (dorsal hippocampus) and entorhinal cortices (ventral hippocampus). The basal ganglia and brainstem were then separated from the remaining cortex as one piece. Dissected pieces were immediately frozen on dry-ice and stored at −80°C until processed.

Quantitative real-time polymerase chain reaction (q-PCR)

To test the effect of nutrition on KCNJ3 expression, RNA from the PFC of 25/25 and 6/25 rats (left hemisphere) was isolated with the RNeasy Lipid Tissue Kit (Qiagen, Valencia, CA, USA) following manufacturer’s instructions. On column digestion was performed to remove traces of contaminating genomic DNA. cDNA was generated using Superscript II Reverse Transcriptase Kit (Qiagen, Valencia, CA, USA) and random hexamer primers. For KCNJ3 q-PCR, cDNA was amplified in a total reaction volume of 20 µl using a SYBR green master mix with 1 µl of forward and 1 µl of reverse primers and 1 µl of the cDNA sample (dilution 1:10). The following specific primers for KCNJ3 were used: forward (5'-3'): CGAGACCCTCATGTTTAGCGA; reverse (5'-3'): ATTTGAGCAGCTTGCAGCG. Triplicates of each sample were measured and analyzed on an ABI 7500 sequencer (Applied Biosystems, Foster City, CA, USA) using standard amplification conditions set by the manufacturer. Data from q-PCR was analyzed using the comparative 2−ΔΔC(T) method (Livak and Smitten, 2001). Hprt and 18s were used as normalization controls. The following primers were used: Hprt: forward (5'-3'): GTTCTTTGCTGACCTGCTGGA; reverse (5'-3'): TCCCCCGTTGACTGATCATT and 18s: forward (5'-3'): CATGGCCGTTCTTAGTTGGT; reverse (5'-3'): GAACGCCACTTGTCCCTCTA. The mRNA levels of the 6/25 rats were expressed as percentage of the mean value of the 25/25 control group. Q-PCR products were controlled by SYBR-Green-based melting curve analysis followed by gel electrophoresis and Sanger sequencing to verify specificity of amplification.

Quantitative Western Blot

Protein lysates were obtained by tissue homogenization in RIPA buffer of the PFC from the right hemisphere of the same animals used in the q-PCR study. Protein concentration was determined according to manufacturer’s instructions using the BCA Protein Assay Reagent Kit (Pierce, Rockford, IL, USA). Equal amounts of protein (100 µg) were denatured in Laemmli buffer at 100°C for 10 min and separated by electrophoresis on 4–15% gradient gel followed by transfer to a PVDF membrane (Immobilon-P, Millipore, Billerica, MA, USA). The membranes were blocked with 5% blotting-grade blocker (Bio-Rad, Hercules, CA, USA) in Tris buffered saline containing 0.1% Tween-20 (T-S-T) at 4°C overnight and incubated for 1 hour at room temperature with the following antibodies: rabbit anti-KCNJ3 (1:1000, Novus Biologicals, Littleton, CO, USA Cat# NBP1-19393) and mouse anti-β-tubulin III (1:2500, Covance, Princeton, NJ, USA Cat# MMS-435P) as a loading control. After washing in T-S-T, membranes were incubated for 1 hour with HRP-conjugated secondary antibodies (1:20000 goat anti-rabbit for KCNJ3 or 1:5000 goat anti-mouse for β-tubulin III). Blots were developed by chemiluminescence using Super Signal West Dura Chemiluminescent Substrate (Thermo Scientific, Rockford, IL, USA). Imaging and quantification were done by band densitometry using Versa Doc Imaging System in conjunction with the Quantity One software (Bio-Rad). Optical densities for KCNJ3 proteins were normalized by the optical densities for the loading control β-tubulin III.

Euthanasia and Sample Preparation - Metabolic Mapping with 14C-2-deoxyglucose (2DG)

To evaluate baseline brain activity, littermates of rats included in the molecular experiments (Breeding A) were injected with the metabolic activity marker 2DG (100µCi/Kg i.p.; specific activity=390mCi/mmol; VWR/GE Healthsource, Radnor, PA). After 45 minutes in their home cage, animals were deeply anesthetized (pentobarbital; 65 mg/kg) and perfused through the heart with 250 ml of fixative (2% paraformaldehyde and 15% sucrose in 0.1M phosphate buffer, pH 7.4) for 5 minutes. The brains were removed, coated with albumin, frozen at −30°C in 2-methylbutane and stored at −80°C. Brains were later cut into 20µm thick coronal sections and one out of every five sections was mounted on subbed cover slips and rapidly dried. Sections were batch-processed by affixing them to Bristol board, and apposing them to high-resolution X-ray film (Structurix, Agfa, Belgium) with 14C microscales (Amersham, Piscataway, NJ). Sections were exposed at −80°C for 10 days. Films were then developed, fixed, and digitized as previously described (Rushmore et al., 2006). Uptake of 2DG was assessed densitometrically in the PFC and hippocampus, and values were normalized to white matter (Sharp et al., 1983). The sampling regions were chosen to correspond to the PFC and hippocampal samples used in the molecular studies.

Data Analysis

All comparisons were done using standard parametric statistical methods with the significance set at p ≤ 0.05. Subjects used in each experiment were unrelated as one rat per litter was randomly selected for each procedure as described above.

RESULTS

Body weight

The use of this model has consistently shown deficits in body weight at birth in the 6/25 group compared to controls. By weaning the weight deficit has declined but remains significant but, by the time the rats reach adulthood (>P90), the 6/25 rats catch up with the 25/25 and their weights are similar. (Galler and Tonkiss, 1998; Fischer et al., 2014). A student’s t-test comparing the body weight of all subjects in breeding B (n=8 25/25, n=8 6/25) at the time of tissue harvest shows that there is no difference between the two nutritional groups (t(14)=0.216, p=0.832). The average weight on PND230 for 6/25 subjects was 536.7 ± 10.11 g (mean ± SEM) while 25/25 subjects weighed an average of 540.0 ± 11.6 g.

Q-PCR for KCNJ3 Gene Expression

In a cohort of 8 adult males (n=5 25/25, n=3 6/25; Breeding A), results revealed a significant down-regulation of KCNJ3 in the 6/25 rats relative to 25/25 controls (two-tailed t-test t (6)=2.69, p=0.03; Fig. 2A). A second cohort of 16 subjects (n=8 25/25, n=8 6/25; Breeding B) was used to replicate mRNA levels of KCNJ3. As observed in Breeding A, KCNJ3 mRNA in the PFC was significantly down-regulated in the 6/25 rats compared to 25/25, confirming the effect of PPM on this gene (two-tailed t-test t (13)=2.58, p=0.02; Fig. 2B).

Figure 2. PPM causes down-regulation of KCNJ3 in the PFC.

Figure 2

Open in a new tab

(A&B): KCNJ3 is significantly down-regulated in the PFC of 6/25 subjects (white bars) from two breedings as compared to 25/25 subjects (black bars). In contrast KCNJ3 expression was unchanged in the (C) hippocampus (p=0.30) and (D) brain stem/basal ganglia (p=0.82) of the same breeding. (E) KCNJ3 protein levels were significantly lower in 6/25 rat PFC compared to controls, consistent with mRNA levels in the same region. (F) Optical density (OD) for the loading control β-tubullin III was equal in the two nutritional groups. (G) Representative Western blots standardized against Beta-tubulin III as loading control. The first three lanes in the blots are representative of 6/25 animals (M1–M3) and the following five lanes of control animals (C1–C5). Cts and ODs are shown as percentage of 25/25 group. *p values shown by each graph when significant (two-tailed t-test). Data presented as Mean +/− SEM.

To investigate whether the down-regulation of KCNJ3 secondary to PPM was generalized in the brain or specific to the PFC, q-PCR was performed in tissue samples of hippocampus and of brain stem/basal ganglia in the same Breeding A subjects as the PFC. As shown in Figure 2C&D, KCNJ3 mRNA levels were not markedly altered in these regions (two-tailed t-test t(6)=1.13; p=0.30 in the hippocampus and t(6)=0.23; p=0.82 in the brain stem/basal ganglia).

Western Blot for Protein Levels

To determine if the changes in gene expression resulted in altered protein levels of KCNJ3, we used the PFC samples (right hemispheres) of the same animals used for q-PCR (Breeding A) for Western blot analysis. As shown in Figure 2E&G, consistent with the q-PCR results, Western blot confirmed that protein levels of KCNJ3 were significantly decreased in 6/25 rats (two-tailed t-test t(6)=3.08; p=0.02). This confirmed that KCNJ3 gene expression leads to similar changes in protein.

Assessment of Metabolic Activity with 2DG

Ten naive adult rats (n=5 25/25, n=5 6/25; Breeding A) were injected with 2DG. Of the 10 subjects, 2 rats in the 25/25 group did not exhibit a radioactive brain signal and were excluded from the analysis, leaving 3 subjects in this group. A two-way ANOVA (Hemisphere [2 levels] X Region [2 levels]) revealed no inter-hemispheric difference (F(1,24)=7.32e-005; p=0.993), no significant interaction between hemisphere and region (F(3,24)=0.017; p=0.996), but a significant overall effect of region (F(3,24)=17.29; p<0.0001). Hence, data were collapsed across hemispheres for each region for a two-way ANOVA (Nutrition [2 levels] × Region [2 levels]). Results showed no overall effect of nutrition (F(1,12)=1.524; p=0.240), but there was a significant interaction between nutrition and region (F(1,12)=10.02; p=0.008) as well as an overall effect of region (F(1,12)=20.47; p=0.0007) and. We then ran post-hoc comparisons to determine which region differed between the two nutrition groups. Results revealed a significant decrease in 2DG uptake in the PFC in the 6/25 group (two-tailed t-test t(6)=2.687; p=0.036) (Figure 3B&C), but no change in the hippocampus (two-tailed t-test: t(6)=1.681; p=0.143) (Figure 3F&G). Data graphed are the mean metabolic activity collapsed across hemisphere for each region (Figure 3D&H).

Figure 3. PPM decreases 2DG activity in the PFC but not in the hippocampus.

Figure 3

Open in a new tab

PFC (A) and hippocampus (E) were outlined according to Paxinos & Watson’s Atlas of the Rat Brain (2007). Illustrative examples of 2DG uptake in prefrontal (PFC) area and hippocampus (Hipp) of 25/25 rats (B&F, respectively) and of 6/25 rats (C&G). Bar graphs depict the mean (± SEM) 2DG uptake in the PFC (D) and in the hippocampus (H) of 25/25 (n=3, black bars) and 6/25, (n=5, white bars) rats. Each bar represents the regional 2DG uptake normalized to adjacent white matter. *p values shown by graph when significant (two-tailed t-test).

DISCUSSION

Summary of Results

In order to explore the molecular basis of observed alterations in a variety of inhibitory processes affected by PPM, changes in the KCNJ3 gene were investigated. Quantitative PCR confirmed that this gene was down regulated in the PFC but was unchanged in the hippocampus and brainstem. Western blot showed corresponding decreases in the protein levels of KCNJ3 only in the PFC. To determine if this affected brain function, metabolic activation patterns were explored using 2DG imaging and showed reduced metabolic activity in the PFC but not in the hippocampus, suggesting that the down regulation of KCNJ3 in the PFC may be associated with decreases in functional activity. The current study, however, does not show a causal relationship between the observed down regulation of KCNJ3 and lower metabolic activity in the PFC of PPM rats. Overall, these results provide further evidence that PPM leads to alterations in neuronal wiring that persists into adulthood and may be part of the neural substrates of altered processes in the PFC.

KCNJ3, Behavior and Disease

KCNJ3 regulates membrane excitability and plays a role in synaptic plasticity and behavior (Luscher and Slesinger, 2010). In humans, the gene has been linked to several neurological diseases defined by imbalance in excitatory and inhibitory signalling, including epilepsy, Down syndrome and schizophrenia. The direct impact of KCNJ3 on behavior has been evaluated by transgenic ablation of specific GIRK subunits in mice (Pravetoni and Wickman, 2008). KCNJ3 knockout (GIRK1−/−) mice showed several behavioral differences from the wild type (wt) mice, including elevated motor activity and delayed habituation in the open field test. Furthermore, GIRK1−/− mice showed reduced anxiety-related behavior in the elevated plus maze compared to the wt mice. In rats, KCNJ3 subunit knockdown (using antisense oligodeoxyribonucleotides injections) produced associative learning impairments (Kourrich et al., 2003). Interestingly, our previous studies using PPM rats, have reported lower anxiety and/ or higher impulsivity on the elevated plus maze as compared with well-nourished control rats (Almeida et al., 1996).

It is important to consider that KCNJ3 subunits alone do not form functional homomeric GIRK channels but need to dimerize with other subunits, usually KCNJ6 (GIRK2), to form functional channels (reviewed in Wickman et al., 2002). Moreover, even when KCNJ3 is completely ablated, KCNJ6 can still form homomer GIRK channels (Lujan et al, 2014). Thus, even though PPM rats show some behavioral deficits similar to KCNJ3 knockout rats, namely lower anxiety and higher impulsivity, PPM rats only present a decrease in KCNJ3 mRNA and protein. However, we do not exclude the possibility that this reduction is part of a network of alterations produced by PPM and hence other changes might contribute to the behavioral deficits. Future studies are needed to determine how the behavioral phenotype in PPM is specifically related to the down-regulation of KCNJ3. Such studies would also need to examine the constellation of genes that showed highest changes in the microarray study such as Snap91, Plagl1 and Homer1 (Table 1) which are pertinent to synaptic activity.

Published studies of the effects of prenatal malnutrition have identified other genes of interest. Among them, Reelin is reduced in the brains of adult rats whose mothers had diets deficient in methyl donors during pregnancy (Konycheva et al, 2011). In humans, IGF2 is hypomethylated in adult offspring of mothers that were pregnant during the Dutch Hunger Winter of 1944–1945 (Heijmans et al, 2008). The exact mechanisms by which malnutrition affects the offspring are still not understood, but there is strong evidence that maternal nutrition can have long-lasting effect on gene expression, phenotype, and neurological diseases via epigenetic changes that alter chromatin structure and gene expression, such as histone modifications and DNA methylation (Kirkbride et al, 2012). DNA methylation, in particular, because of its direct link to metabolism, will be of particular interest for future studies in our PPM model.

Decreased metabolic activity in the PFC

Metabolic labelling with 2DG is a sensitive index of neural activity and has been previously used to show alterations in PFC activity in a rat model of attention deficit hyperactivity disorder (ADHD; Barbelivien et al., 2001). In our group, we have recently reported that PPM rats display cognitive rigidity in tests of attentional set shifting and reversal learning. Same-sex littermates had decreased 2DG uptake in PFC regions critical to these forms of cognitive control (McGaughy et al., 2014). These data support the hypothesis that PPM may selectively diminish activity in the PFC, which then leads to impairments in executive function. The neuroanatomical basis of this hypofunction in the PFC is unclear. It is generally accepted that the 2DG signal predominantly reflects synaptic activity at the axonal terminals of neuronal pathways (Kadekaro et al., 1985). As a result, the decrease in activity in PPM rats could be due to a widespread alteration in PFC connectivity and function, or it could be a result of changes in specific inputs to or within the PFC. Since 2DG labelling makes no distinction between excitatory or inhibitory synapses, the observed decrease in activity could also reflect a population-specific dysfunction in cellular activation in the PFC, with either excitatory or inhibitory populations being more vulnerable to PPM.

However, in previous studies in this model, we observed alterations in a variety of inhibitory processes due to PPM, leading us to hypothesize that the inhibitory cells are functionally more affected by the malnutrition insult. It remains to be seen whether the down-regulation of KCNJ3 is linked to the dampening of metabolic activity in the PFC of PPM rats but, if the observed decrease in KCNJ3 occurred mainly on GABAergic interneurons, it would increase their excitability and hence increase inhibitory tone in the PFC, perhaps leading to net lower baseline activity in PFC. Such a selective effect on inhibitory interneurons and processes is congruent with a number of observations in this model of PPM. For example, electrophysiological studies in the hippocampus showed evidence of enhanced inhibition in granule cells of the dentate gyrus (Bronzino et al.; 1991, 1997). In these studies the authors reported a hyperactivation of GABAergic inhibitory interneurons in the dentate gyrus leading to a greater potentiation of inhibition in PPM rats. Future studies using cFos as a marker for activation and double labelling with cell type specific markers could test this hypothesis.

Decreased frontal lobe activation is also observed in human studies in children and adults with ADHD (Rubia et al., 1999; Cubillo et al., 2010) and in patients with schizophrenia (Mueser and McGurk, 2004). The mechanism of these decreases is not well understood, but they have been posited to have early life onset, possibly during the prenatal period (ADHD: Ottoboni and Ottoboni, 2003; Schizophrenia: Räikkönen, 2012). Regardless of mechanism, these observations suggest a unique vulnerability of the PFC to prenatal insults such as malnutrition.

The questions of when these changes occur and whether there are sex differences are also open. In a developmental study, Fernandez-Alacid et al (2011) reported that GIRK subunits, including KCNJ3, are already highly expressed in the rat brain at birth (P0), and progressively increase postnatally, suggesting that the gene dysregulation found here was likely established in the prenatal period and continued into adulthood. In this model of PPM, however, it is not known if the deficits observed here are already present at birth (P0) or if they develop postnatally. Also, while our current study only included male subjects, sex differences in behavior have previously been reported in this model (Almeida et al, 1996; Tonkiss et al, 1998). Thus, investigating these effects in females will be important in future studies.

Conclusions

This investigation reports on the down regulation of the expression of KCNJ3 mRNA and protein in the PFC of adult rats that were exposed to PPM and nutritionally rehabilitated from birth onwards. In parallel, we also report a decrease in baseline PFC activity in the adult littermates from the KCNJ3 study, though specific causality remains to be determined. Considering implications of our findings in PPM rats for humans, evidence shows that the offspring from the Dutch Hunger Winter and from the Chinese Famine have higher risk for schizophrenia in adulthood (Susser et al., 1996; St. Clair et al., 2005; Xu et al., 2009).There is also strong evidence linking schizophrenia to downregulation of KCNJ3 in the PFC (Yamada et al., 2011, 2012) and to reduced activation in the PFC (Mueser and McGurk, 2004). Observations reported here of reductions of both KCNJ3 levels and 2DG activity in the PFC support the hypothesis that the PFC is particularly vulnerable to this nutritional insult and might be linked to neuropsychiatric diseases observed in humans subjected to malnutrition in utero.

  • Maternal malnutrition can have long-term effects on brain function of offspring

  • Prenatal malnutrition reduces KCNJ3 mRNA and protein expression in the prefrontal cortex of rats

  • Prenatal malnutrition decreases metabolic activity in the prefrontal cortex of adult rats

  • The prefrontal cortex is particularly vulnerable to the prenatal malnutrition insult

Acknowledgements

This work was supported by NIH grants MH074811 and MH086509.

Abbreviations

PPM

prenatal protein malnutrition

KCNJ3

inward-rectifying potassium channel, subfamily J, member 3

PFC

prefrontal cortex

2DG

2-deoxyglucose

GIRK

G protein-gated inwardly rectifying potassium channel

6/25

prenatally malnourished

25/25

well-nourished controls

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  1. Almeida SS, Tonkiss J, Galler JR. Prenatal protein malnutrition affects exploratory behavior of female rats in the elevated plus-maze test. Physiol Behav. 1996;60(2):675–680. doi: 10.1016/s0031-9384(96)80047-3. [DOI] [PubMed] [Google Scholar]
  2. Barbelivien A, Ruotsalainen S, Sirviö J. Metabolic alterations in the prefrontal and cingulate cortices are related to behavioral deficits in a rodent model of attention-deficit hyperactivity disorder. Cereb Cortex. 2001;11:1056–1063. doi: 10.1093/cercor/11.11.1056. [DOI] [PubMed] [Google Scholar]
  3. Best TK, Siarey RJ, Galdzicki Z. Ts65Dn, a mouse model of Down syndrome, exhibits increased GABAB-induced potassium current. J Neurophysiol. 2007;97(1):892–900. doi: 10.1152/jn.00626.2006. [DOI] [PubMed] [Google Scholar]
  4. Bronzino JD, Austin-LaFrance RJ, Morgane PJ, Galler JR. Effects of prenatal protein malnutrition on kindling-induced alterations in dentate granule cell excitability. II. Paired-pulse measures. Exp Neurol. 1991;112:216–223. doi: 10.1016/0014-4886(91)90072-k. [DOI] [PubMed] [Google Scholar]
  5. Bronzino JD, Austin-LaFrance RJ, Mokler D, Morgane PJ. Effects of prenatal protein malnutrition on hippocampal long-term potentiation in freely moving rats. Exp Neurol. 1997;148:317–323. doi: 10.1006/exnr.1997.6653. [DOI] [PubMed] [Google Scholar]
  6. Chang Y, Galler JR, Luebke JI. Prenatal Protein Malnutrition Results in Increased Frequency of Miniature Inhibitory Postsynaptic Currents in Rat CA3 Interneurons. Nutr Neurosci. 2003;6(4):263–267. doi: 10.1080/1028415031000151549. [DOI] [PubMed] [Google Scholar]
  7. Chioza B, Osei-Lah A, Wilkie H, Nashef L, McCormick D, Asherson P, Makoff AJ. Suggestive evidence for association of two potassium channel genes with different idiopathic generalized epilepsy syndromes. Epilepsy Res. 2002;52(2):107–116. doi: 10.1016/s0920-1211(02)00195-x. [DOI] [PubMed] [Google Scholar]
  8. Cubillo A, Halari R, Ecker C, Giampietro V, Taylor E, Rubia K. Reduced activation and inter-regional functional connectivity of fronto-striatal networks in adults with childhood Attention-Deficit Hyperactivity Disorder (ADHD) and persisting symptoms during tasks of motor inhibition and cognitive switching. J Psychiatr Res. 2010;44:629–639. doi: 10.1016/j.jpsychires.2009.11.016. [DOI] [PubMed] [Google Scholar]
  9. D’Adamo MC, Catacuzzeno L, Di Giovanni G, Franciolini F, Pessia M. K(+) channelepsy: progress in the neurobiology of potassium channels and epilepsy. Front Cell Neurosci. 2013;7:1–21. doi: 10.3389/fncel.2013.00134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fernández-Alacid L, Watanabe M, Molnár E, Wickman K, Luján R. Developmental regulation of G protein-gated inwardly-rectifying K+ (GIRK/Kir3) channel subunits in the brain. Eur J Neurosci. 2011;34(11):1724–1736. doi: 10.1111/j.1460-9568.2011.07886.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fischer LK, Bradshaw SE, McGaughy J, Fitzmaurice G, Amaral AC, Rosene DL, Mokler DJ, Galler JR. Prenatal Protein Level Impacts Homing Behaviors in Long-Evans Rat Pups. Nutritional Neuroscience. 2014 doi: 10.1179/1476830515Y.0000000001. (In press). [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Galler JR, Shumsky JS, Morgane PJ. Malnutrition and brain development. In: Walker WA, Watkins JB JB, editors. Nutrition in Pediatrics: Basic Science and Clinical Application. 2nd ed. ch. 14. Neuilly-sur-Seine, France: J.B. Decker Europe, Inc.; 1996. pp. 196–212. [Google Scholar]
  13. Galler JR, Tonkiss J. The effects of prenatal protein malnutrition and cocaine on the development of the rat. Ann N Y Acad Sci. 1998;846:29–39. [PubMed] [Google Scholar]
  14. Galler JR, Bryce CP, Zichlin ML, Fitzmaurice G, Eaglesfield GD, Waber DP. Infant Malnutrition Is Associated with Persisting Attention Deficits in Middle Adulthood. J Nutr. 2012;142:788–794. doi: 10.3945/jn.111.145441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Galler JR, Bryce CP, Zichlin ML, Waber DP, Exner NM, Fitzmaurice GM, Costa PT. Malnutrition in the First Year of Life and Personality at Age 40. J Child Psychol Psychiatry. 2013;54(8):911–919. doi: 10.1111/jcpp.12066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Heijmans BT, Tobi EW, Stein AD, Putter H, Blauw GJ, Susser ES, Slagboom PE, Lumey LH. Persistent epigenetic differences associated with prenatal exposure to famine in humans. Proc Natl Acad Sci U S A. 2008;105:17046–17049. doi: 10.1073/pnas.0806560105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hibino H, Inanobe A, Furutani K, Murakami S, Findlay IAN. Inwardly Rectifying Potassium Channels : Their Structure, Function, and Physiological Roles. Physiol Rev. 2010;90:291–366. doi: 10.1152/physrev.00021.2009. [DOI] [PubMed] [Google Scholar]
  18. Kadekaro M, Crane aM, Sokoloff L. Differential effects of electrical stimulation of sciatic nerve on metabolic activity in spinal cord and dorsal root ganglion in the rat. Proc Natl Acad Sci USA. 1985;82:6010–6013. doi: 10.1073/pnas.82.17.6010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kirkbride JB, Susser E, Kundakovic M, Kresovich JK, Davey Smith G, Relton CL. Prenatal nutrition, epigenetics and schizophrenia risk: can we test causal effects? Epigenomics. 2012;4:303–315. doi: 10.2217/epi.12.20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Konycheva G, Dziadek MA, Ferguson LR, Krägeloh CU, Coolen MW, Davison M, Breier BH. Dietary methyl donor deficiency during pregnancy in rats shapes learning and anxiety in offspring. Nutr Res. 2011;31:790–804. doi: 10.1016/j.nutres.2011.09.015. [DOI] [PubMed] [Google Scholar]
  21. Kourrich S, Masmejean F, Martin-Eauclaire MF, Soumireu-Mourat B, Mourre C. Inwardly rectifying Kir3.1 subunit knockdown impairs learning and memory in an olfactory associative task in rat. Brain Res Mol Brain Res. 2003;113(1–2):97–106. doi: 10.1016/s0169-328x(03)00096-2. [DOI] [PubMed] [Google Scholar]
  22. Lister JP, Blatt GJ, Kemper TL, Tonkiss J, DeBassio WA, Galler JR, Rosene DL. Prenatal protein malnutrition alters the proportion but not numbers of parvalbumin-immunoreactive interneurons in the hippocampus of the adult Sprague-Dawley rat. Nutr Neurosci. 2011;14(4):165–178. doi: 10.1179/147683011X13009738172396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  24. Lucarini N, Verrotti A, Napolioni V, Bosco G, Curatolo P. Genetic polymorphisms and idiopathic generalized epilepsies. Pediatr Neurol. 2007;37(3):157–164. doi: 10.1016/j.pediatrneurol.2007.06.001. [DOI] [PubMed] [Google Scholar]
  25. Luján R, Marron Fernandez de Velasco E, Aguado C, Wickman K. New insights into the therapeutic potential of Girk channels. Trends Neurosci. 2014;37:20–29. doi: 10.1016/j.tins.2013.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lüscher C, Slesinger PA. Emerging roles for G protein-gated inwardly rectifying potassium (GIRK) channels in health and disease. Nat Rev Neurosci. 2010;11(5):301–315. doi: 10.1038/nrn2834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. McGaughy JA, Amaral AC, Rushmore RJ, Mokler DJ, Morgane PJ, Rosene DL, Galler JR. Prenatal Malnutrition Leads to Deficits in Attentional Set Shifting and Decreases Metabolic Activity in Prefrontal Subregions that Control Executive Function. Developmental Neuroscience. 2014 doi: 10.1159/000366057. In Press. [DOI] [PubMed] [Google Scholar]
  28. Mokler DJ, Torres OI, Galler JR, Morgane PJ. Stress-induced changes in extracellular dopamine and serotonin in the medial prefrontal cortex and dorsal hippocampus of prenatally malnourished rats. Brain Res. 2007;1148:226–233. doi: 10.1016/j.brainres.2007.02.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Morgane PJ, Mokler DJ, Galler JR. Malnutrition: central nervous system effects. In: Adelman G, Smith BH, editors. The Encyclopedia of Neuroscience. Third Edition. New York: Elsevier Science; 2003. CD-ROM. [Google Scholar]
  30. Mueser KT, McGurk SR. Schizophrenia. Lancet. 2004;363:2063–2072. doi: 10.1016/S0140-6736(04)16458-1. [DOI] [PubMed] [Google Scholar]
  31. Newbury DF, Warburton PC, Wilson N, Bacchelli E, Carone S, Lamb JA, et al. Mapping of partially overlapping de novo deletions across an autism susceptibility region (AUTS5) in two unrelated individuals affected by developmental delays with communication impairment. Am. J. Med Genet A. 2009;149A(4):588–597. doi: 10.1002/ajmg.a.32704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ottoboni F, Ottoboni A. Can Attention Deficit-Hyperactivity Disorder Result from Nutritional Deficiency. JP and S. 2003;8:5–7. [Google Scholar]
  33. Paxinos G, Watson C. The Rat Brain in Stereotaxic coordinates. 6th Edition. Boston: Elsevier; 2007. [Google Scholar]
  34. Poot M, Eleveld MJ, van ’t Slot R, Ploos van Amstel HK, Hochstenbach R. Recurrent copy number changes in mentally retarded children harbour genes involved in cellular localization and the glutamate receptor complex. Eur J Hum Genet. 2010;18(1):39–46. doi: 10.1038/ejhg.2009.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pravetoni M, Wickman K. Behavioral characterization of mice lacking GIRK/Kir3 channel subunits. Genes Brain Behav. 2008;7(5):523–531. doi: 10.1111/j.1601-183X.2008.00388.x. [DOI] [PubMed] [Google Scholar]
  36. Räikkönen K, Pesonen A-K, Roseboom TJ, Eriksson JG. Early determinants of mental health. Best Pract Res Clin Endocrinol Metab. 2012;26:599–611. doi: 10.1016/j.beem.2012.03.001. [DOI] [PubMed] [Google Scholar]
  37. Rosene DL, Lister JP, Schwagerl AL, Tonkiss J, McCormick CM, Galler JR. Prenatal protein malnutrition in rats alters the c-Fos response of neurons in the anterior cingulate and medial prefrontal region to behavioral stress. Nutr Neurosci. 2004;7(5–6):281–289. doi: 10.1080/10284150400015573. [DOI] [PubMed] [Google Scholar]
  38. Rubia K, Overmeyer S, Taylor E, Brammer M, Williams SC, Simmons A, Bullmore ET. Hypofrontality in attention deficit hyperactivity disorder during higher-order motor control: a study with functional MRI. Am J Psychiatry. 1999;156:891–896. doi: 10.1176/ajp.156.6.891. [DOI] [PubMed] [Google Scholar]
  39. Rushmore RJ, Valero-Cabre A, Lomber SG, Hilgetag CC, Payne BR. Functional circuitry underlying visual neglect. Brain. 2006;129:1803–1821. doi: 10.1093/brain/awl140. [DOI] [PubMed] [Google Scholar]
  40. Sharp FR, Kilduff TS, Bzorgchami S, Heller HC, Ryan AF. The relationship of local cerebral glucose utilization to optical density ratios. Brain Res. 1983;263:97–103. doi: 10.1016/0006-8993(83)91204-0. [DOI] [PubMed] [Google Scholar]
  41. St Clair D, Xu M, Wang P, Yu Y, Fang Y, Zhang F, et al. Rates of Adult Schizophrenia Following of 1959–1961. JAMA. 2005;294(5):557–562. doi: 10.1001/jama.294.5.557. [DOI] [PubMed] [Google Scholar]
  42. Susser E, Neugebauer R, Hoek HW, Brown AS, Lin S, Labovitz D, Gorman JM. Schizophrenia after prenatal famine. Further evidence. Arch Gen Psychiatry. 1996;53:25–31. doi: 10.1001/archpsyc.1996.01830010027005. [DOI] [PubMed] [Google Scholar]
  43. Susser E, St Clair D. Prenatal famine and adult mental illness: interpreting concordant and discordant results from the Dutch and Chinese Famines. Social science & medicine. 2013;97:325. doi: 10.1016/j.socscimed.2013.02.049. (1982) [DOI] [PubMed] [Google Scholar]
  44. Tonkiss J, Galler JR. Prenatal protein malnutrition and working memory performance in adult rats. Behav. Brain Res. 1990;40(2):95–107. doi: 10.1016/0166-4328(90)90002-v. [DOI] [PubMed] [Google Scholar]
  45. Tonkiss J, Almeida SS, Galler JR. Prenatally malnourished female but not male rats show increased sensitivity to MK-801 in a differential reinforcement of low rates task. Behav Pharmacol. 1998;9:49–60. [PubMed] [Google Scholar]
  46. Wickman K, Pu WT, Clapham DE. Structural characterization of the mouse Girk genes. Gene. 2002;284:241–250. doi: 10.1016/s0378-1119(01)00884-8. [DOI] [PubMed] [Google Scholar]
  47. Xu M-Q, Sun W-S, Liu B-X, Feng G-Y, Yu L, Yang L, He G, Sham P, Susser E, St Clair D, He L. Prenatal malnutrition and adult schizophrenia: further evidence from the 1959–1961 Chinese famine. Schizophr Bull. 2009;35:568–576. doi: 10.1093/schbul/sbn168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yamada K, Iwayama Y, Hattori E, Iwamoto K, Toyota T, Ohnishi T, et al. Genome-wide association study of schizophrenia in Japanese population. PLoS One. 2011;6(6):e20468. doi: 10.1371/journal.pone.0020468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yamada K, Iwayama Y, Toyota T, Ohnishi T, Ohba H, Maekawa M, et al. Association study of the KCNJ3 gene as a susceptibility candidate for schizophrenia in the Chinese population. Hum Genet. 2012;131(3):443–451. doi: 10.1007/s00439-011-1089-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES