Skip to main content
NCBI home page
American Journal of Neurodegenerative Disease logoLink to American Journal of Neurodegenerative Disease
. 2014 Dec 5;3(3):134–142.

Age-induced reduction of autophagy-related gene expression is associated with onset of Alzheimer’s disease

Yasuhiro Omata 1, Young-Mi Lim 2, Yukihiro Akao 3, Leo Tsuda 2
PMCID: PMC4299720  PMID: 25628964

Abstract

Aging is a major risk factor for Alzheimer’s disease (AD). Aggregation of amyloid beta (Aβ) in cerebral cortex and hippocampus is a hallmark of AD. Many factors have been identified as causative elements for onset and progression of AD; for instance, tau seems to mediate the neuronal toxicity of Aβ, and downregulation of macroautophagy (autophagy) is thought to be a causative element of AD pathology. Expression of autophagy-related genes is reduced with age, which leads to increases in oxidative stress and aberrant protein accumulation. In this study, we found that expression of the autophagy-related genes atg1, atg8a, and atg18 in Drosophila melanogaster was regulated with aging as well as their own activities. In addition, the level of atg18 was maintained by dfoxo (foxo) and dsir2 (sir2) activities in concert with aging. These results indicate that some autophagy-related gene expression is regulated by foxo/sir2-mediated aging processes. We further found that reduced autophagy activity correlated with late-onset neuronal dysfunction caused by neuronal induction of Aβ. These data support the idea that age-related dysfunction of autophagy is a causative element in onset and progression of AD.

Keywords: Aging, macroautophagy, Alzheimer’s disease (AD), amyloid beta (Aβ), neurodegeneration, Drosophila melanogaster

Introduction

Macroautophagy (autophagy) is the system for degradation and recycling of cellular waste in eukaryotic cells, and it is involved in cellular responses to stress including starvation, infection, and pathological accumulation of protein [1-4]. During autophagy, double-membrane vesicles called autophagosomes are formed to fuse with lysosomes, allowing the lysozymes to degrade their contents [5-7]. When autophagy is induced by starvation, newly synthesized amino acids and free fatty acids are provided that can be used for cellular energy [1,8]. Autophagy also controls the quality of essential cellular components by eliminating damaged organelles and protein aggregates [1,8].

In yeast, many autophagy-related genes have been identified. Most are essential for autophagosome formation [9]. Autophagosome formation occurs in the endoplasmic reticulum (ER) and involves a series of steps, including initiation, nucleation and expansion [7]. In mammals, yeast ATG1 homologues of unc-51-like kinase (ULK1/2), ATG13, ATG101 and focal adhesion kinase family interacting protein of 200 kDa (FIP200) form a complex with mTORC1 in nutrient status. ATG101 and FIP200 have been found only in mammals. In response to starvation, initiation step starts to dephosphorylate ULK1/2 rapidly. ULK1/2 is auto-phosphorylated and then phosphorylates ATG13 and FIP200. Alternatively, ULK1/2 is phosphorylated and activated by AMPK [10]. Nucleation involves formation of the isolation membrane (IM) from the source. Mammalian have four ATG18 homologues, WD-repeat protein interacting with phosphoinositides (WIPIs). In this process, WIPI2 (ATG18) and double-FYVE-containing protein (DFCP1) found only in mammals, which are autophagy-specific effectors for phosphatidy-linositol 3-kinase (PI3K), are recruited to the IM [11]. Finally, ATG16L complex induces microtubule associated protein light chain 3 (LC3) lipidation. IM having distinct localization of ATG protein expands within the omegasome and close to form autophagosome [12].

A growing number of studies have shown that expression levels of autophagy-related genes are tightly regulated by many types of transcription factors under different signaling pathways, including the insulin/growth factor pathway and nutrient-sensing signaling through the mTOR- and Akt-dependent pathways [13,20,39]. A previous study revealed that atg1 expression is upregulated by dfoxo (the Drosophila homolog of foxo, which encodes forkhead box transcription factor class O), and that insulin signaling inhibits expression of autophagy-related genes by inactivating foxo in hepatic cells [14]. dfoxo is also necessary and sufficient to induce autophagy in the Drosophila larval fat body [15]. Moreover, sirt1 is a sensor of CR to induce autophagy through deacetylation of foxo and also regulate the induction of autophagy through the inhibition of insulin signaling, which result in TOR inhibition [20]. The control of mRNA translation is a function of insulin/TOR pathway. 4E-BP is involved in cap-dependent mRNA translation. 4E–BP mutation is hypersensitive to starvation suggesting a coordination of translation and autophagy in response to insulin/TOR signaling [39].

Although the precise molecular mechanisms remain to be clarified, aging is an important regulator of autophagy function. In Drosophila melanogaster, expression of autophagy-related genes is reduced with aging [16-18]. Mutant atg8 flies have a reduced lifespan and are sensitive to oxidative stress [16]. Conversely, increased expression of autophagy-related genes delays aging and extends lifespan [19,20]. These results suggest that the activity of autophagy is closely associated with aging.

The suppression of neural autophagy leads to aberrant protein aggregation and neural degeneration. The expression level of WIPI4, a human homolog of atg18, is correlated with static encephalopathy of childhood with neurodegeneration in adulthood (SENDA), a subtype of neurodegenerative disease with iron accumulation in the brain [21]. Furthermore, many studies suggest a strong correlation between autophagy activity and Alzheimer’s disease (AD), a highly epidemic cause of neuronal dysfunction in old age [22]. Defects in the lysosomal proteolysis machinery were detected in AD patients with a presenilin mutation [23]. In an APP-overexpressing mouse model, downregulation of Beclin-1, an essential regulator of autophagy initiation, caused accumulation of both intraneuronal and extracellular Aβ deposits followed by marked neurodegeneration [24].

In this report, we have revealed that the expression of autophagy-related genes is tightly regulated by many factors, including aging, sirtuin signaling, TOR signaling and autophagy activity itself. We further found that these regulatory systems may contribute to late-onset neuronal dysfunction in a Drosophila AD model induced by amyloid beta (Aβ) overexpression.

Materials and methods

Fly stocks

Flies were maintained in vials with SY medium at 25°C on a 12 h:12 h light/dark cycle. dfoxo, dsir2 and d4E-BPnull lines were kindly provided by Drs. Hafen, Helfand and Lasko, respectively. The deficiencies E44 and ZP1 were obtained from the Bloomington Stock Center (Indiana University).

Human Aβ42 is a peptide cleaved from APP, a transmembrane protein, by β- and γ-secretase [25]. Although components required for γ-secretase activity are well conserved [26], β-secretase is absent or has quite low in Drosophila [27]. To generate transgenic lines as a AD model, rat pre-proenkephalin signal peptide was connected to Aβ42 by PCR using APP cDNA. Aβ42 E22G (arctic) and Aβ42 L17P constructs with a signal peptide were cloned into the pUAST vector [28]. Each amino acid substitution was generated by PCR starting with Aβ42 wild template individually. After embryonic injection of these vectors, transgenic flies were established using standard methods. UAS-Tg lines were crossed with gmr-gal4 lines or elav-gal4 lines. Several lines with high expression were used for experiments.

Histology

Plastic embedding and sectioning of eyes were carried out as described [29]. Images were captured by microscopy (Nikon).

Climbing assay

Twenty flies that had eclosed on the day of the assay were placed in empty plastic vials divided into bottom, middle and top areas. Vials were tapped on a table to make the flies drop to the bottom, and then placed on the table to allow the flies to climb up. The number of flies in each area was counted after 1 min. The assay was repeated every 5 days for 50 days. Males and females were tested separately. Each assay was repeated three times and average numbers were calculated. Averaged data of them was shown since there was no significant difference between males and females.

Quantitative PCR (qPCR)

Total RNA was extracted from 30 fly heads using ISOGEN (Nippon Gene). cDNA was synthesized using the Prime-Script RT reagent kit (Takara). SYBR Premix Ex-Taq II (Takara) was used for amplification. PCR amplification and data analysis was performed on a Thermal Cycler Dice (Takara) under previously described conditions [30]. RP49 was used for a control of mRNA level.

Oligonucleotides for real-time PCR analysis were follows:

atg1: Sense; 5’- CATTCGTTGGTGCAAAAGTG -3’, Antisense; 5’- CATGCTGCTGCAATATGCTC -3’; atg8a: Sense; 5’- CATTCCACCAACATCGGCTA -3’, Antisense; 5’- GCCGTAAACATTCTCATCGG -3’; atg18: Sense; 5’- AACCAGAACATAACTTCCC-TGGC -3’, Antisense; 5’- TCGTGTGGTAGATCTTGTCCAG -3’; QC: Sense; 5’- AGGTCCATTTCAACCGCAC -3’, Antisense; 5’- TTCAGCGATTGGACCAGGTA -3’. The sequence data for rp49 was as described previously [30].

Western blotting

Twenty fly heads were homogenized in RIPA lysis buffer containing proteinase inhibitors; RIPA lysis buffer is described in [31]. Homogenate was sonicated on a Bioruptor (CosmoBio), then ultracentrifuged at 189,000 x g, 4°C, for 30 min. This first supernatant was collected as the SDS-soluble fraction. The pellet was dissolved in 70% formic acid, and then centrifuged at 13,000 rpm, 4°C, for 20 min. This second supernatant was dried for 1 h at room temperature by speed vacuum, resuspended with 1 M Tris-HCl (pH 6.8), and kept as the SDS-insoluble fraction. Each fraction was separated on 15-20% Tris-tricine gel (Wako) at room temperature, and then transferred to a 0.22-μm nitrocellulose membrane (Whatman) for 1 h at 4°C. The membrane was blocked with 5% skim milk (Difco). Antibodies against Aβ (6E10 from Covance; 82E1 from IBL) and α-tubulin (Sigma) were used for detection. Goat α-mouse HRP (Santa Cruz Biotechnology) was used as secondary antibody. Signals were visualized using Immunostar LD (Wako) to be exposed to Bio Max MR film (Sigma). The films were developed using CEPROS SV (Fujifilm, Japan).

Results

Expression of autophagy-related genes is reduced with aging

It has previously been implicated that aging affects expression of autophagy-related genes in D. melanogaster [16-18]. To confirm this, qPCR was performed to compare expression of atg1, atg8a and atg18 in fly heads at 4 and 30 days after eclosion. Expression of all three genes was reduced with aging processes (Figure 1A). In contrast, expression of glutaminyl cyclase (QC), an enzyme responsible for converting the N terminus of glutamine or glutamate into pyroglutamate [38], did not change with age (Figure 1B), indicating that the effect of aging on atg gene expression was specific. To refine this temporal change, we compared expression of atg18 at 0, 2, 7 and 14 days after eclosion. Expression of atg18 decreased to ~70% by 7 days after eclosion, and appeared to reach a plateau at 14 days (Figure 1C). These results suggest that expression of autophagy-related genes may be regulated by early aging processes.

Figure 1.

Figure 1

Open in a new tab

Downregulation of atg1, atg8a and atg18 mRNA in heads of aged D. melanogaster. A. atg1, atg8a and atg18 mRNA expression in wild-type (WT) flies at 4 and 30 days (means±SD, n=4); B. Glutaminyl cyclase (QC) mRNA expression in wild-type flies at 4 and 30 days (means±SD, n=4). C. atg18 mRNA expression in wild-type flies at 0 to 14 days (means±SD, n=4). D. atg1 and atg18 expression in foxo, sir2 and 4E-BP mutants at 4 and 14 days (means±SD, n=4). Statistical significance of each expression levels in older flies against younger flies was analyzed by student t-test (**P < 0.01).

Expression of atg18 is reduced in dfoxo and dsir2 mutants

To further assess the relationship between aging and expression of autophagy-related genes, we examined expression levels of atg1 and atg18 in dfoxo and dsir2 mutants. Expression of atg18 at day 4 was reduced in dfoxo mutants compared to wild type (WT, Figure 1D), possibly due to a positive effect of dfoxo on autophagy-related gene expression, as reported in fat body [15]. Expression of atg18 at day 14 was reduced in dfoxo and dsir2 compared to WT (Figure 1D). Although dsir2 showed almost the same expression of atg1 and atg18 as WT at day 4, expression of atg18 was significantly reduced at day 14 compared to WT (Figure 1D). These results suggest that dfoxo and dsir2 activity may be required to maintain atg18 expression during aging.

Initiation factor 4E-binding protein (4E-BP) negatively regulates autophagy-related gene expression

Many studies suggest that 4E-BP acts downstream foxo in the regulation of aging [39]. Therefore, we examined the effect of 4E-BP on expression of atg1 and atg18. Surprisingly, expression of both genes was higher in 4E-BP mutants than in WT at days 4 and 14, but was also reduced with age (Figure 1D). These results suggest that 4E-BP negatively regulates autophagy-related gene expression.

Development of a transgenic fly model for AD

Because our data indicate that expression of autophagy-related genes is tightly regulated during aging, and it has previously been shown that autophagy is involved in development of age-related neuronal disorders such as AD, we developed a fly model of AD to further test this relationship. We cloned human Aβ42 and generated mutant forms of S8D, L17P, E22G and 3Q42 using a rat pre-proenkephalin signal peptide sequence, as reported [31]. Substitution mutations such as S8D and E22G or N-terminal truncated Aβ 3Q42 have been identified from patients and those mutations in Aβ42 facilitate aggregation in fly and mouse [32-36]. L17P mutation inhibits Aβ aggregation in PC12 cells [37]. We established transgenic flies using each of these constructs, and confirmed their biochemical properties by western blotting of protein extracts from heads of 30 days flies. Expression of Aβ was detected in SDS-soluble fractions (Figure 2A). Aggregation of Aβ was confirmed in SDS-insoluble formic acid fractions in transgenic flies (Figure 2B).

Figure 2.

Figure 2

Open in a new tab

Aβ transgenic flies produce Aβ42 and exhibit reduced locomotor activity. (A, B) Western blots of soluble (A) and insoluble fractions (B) in 30 days WT and transgenic flies. Epitope of 6E10 is 3-8 of Aβ42 and 82E1 is 1-5 of Aβ42. (C-G) Climbing assay. Twenty flies were placed in an empty vial marked to define three equal areas (C). Climbing ability was reported as percentage of flies climbing to each area (black=bottom, gray=middle, white=top) in 1 min. The assay was performed using WT (D) and transgenic Aβ42 (E), Aβ42 L17P (F) and Aβ42 E22G (G) flies. Each experiment was performed three times and average results are shown. Aβ42=elav > Aβ42, Aβ42 L17P=elav > Aβ42 L17P, Aβ42 E22G=elav > Aβ42 E22G.

To test the transgenic flies for Aβ-dependent neuronal toxicity, we overexpressed Aβ and its two mutants using a pan-neuronal dependent Gal4 line, elav-Gal4. We used a climbing assay to monitor the locomotor activity of newly eclosed flies every 5 days for 50 days (Figure 2C). Aβ42, Aβ42 E22G, and Aβ42 L17P flies demonstrated 70-100% climbing disability by 40 days, whereas WT flies showed only 40% disability at 40 days (Figure 2D-G). These data support previous reports that Aβ accelerates age-induced locomotor dysfunction.

Expression of autophagy-related genes affects development of AD

It has been thought that the neuronal toxicity of AD is mediated by regulation of autophagy-related gene expression by Aβ [41]. To confirm this possibility, we analyzed the expression of autophagy-related genes atg1, atg8a and atg18 in Aβ42 transgenic flies at days 4 and 30. We found that expression of all three genes in Aβ42 transgenic flies was reduced with age, similar to the reduced expression in WT flies (Figure 3). These results indicate that Aβ42 did not affect the level of autophagy-related gene expression. Aβ42 mutations such as L17P and Aβ42 E22G also did not affect the expression, although they showed climbing disability.

Figure 3.

Figure 3

Open in a new tab

Overexpression of Aβ42 does not affect expression of autophagy-related genes. Relative expression of atg1, atg8a and atg18 in transgenic flies with pan-neuronal expression of Aβ42, Aβ42 L17P and Aβ42 E22G (means±SD, n=4). Statistical significance of old flies against young flies was analyzed by student t-test (**P < 0.01). Aβ42=elav > Aβ42, Aβ42 L17P=elav > Aβ42 L17P, Aβ42 E22G=elav > Aβ42 E22G.

Next, we analyzed the relationship between expression of autophagy-related genes and the toxic effect of Aβ42 on locomotor activity. To reduce the expression level of autophagy-related genes, we used two lines, E44 and ZP1, which carry the deficiencies Df(atg1) and Df(atg18), respectively. We found that Df(atg1)/+ heterozygotes demonstrated strongly enhanced neuronal toxicity caused by Aβ42 (Figure 4A). Df(atg18)/+ heterozygotes also demonstrated an enhanced phenotype, although it was less severe than in Df(atg1)/+ flies. These results suggest that expression of atg1 has an important role in the neuronal toxicity of Aβ42 during aging.

Figure 4.

Figure 4

Open in a new tab

Expression of autophagy-related genes correlates with neuronal toxicity caused by Aβ42. A. Locomotor activity of Aβ42, Aβ42; Df(atg18)/+ and Aβ42; Df(atg1)/+ flies. Aβ42=elav > Aβ42; B. Expression of atg1, atg8a and atg18 in Df(atg1)/+ and Df(atg18)/+ flies was quantified by qPCR (means±SD, n=4). Statistical significance of Df atg18/+ or Df atg1/+ against WT was analyzed by student t-test (**P < 0.01). Df(atg1)=E44, Df(atg18)=ZP1.

Autophagy-related genes have a positive auto-feedback effect

To confirm the expression levels of autophagy-related genes in these deficiency backgrounds, we performed qPCR analysis on mRNA from heterozygote fly heads. We found that Df(atg1)/+ decreased the expression not only of atg8a and atg18, but of atg1 itself as well (Figure 4B). Df(atg18)/+ showed a similar tendency, although the effect was less strong (Figure 4B). These results suggest that there may be auto-feedback machinery that controls autophagy-related genes, and that atg1 may play a central role in maintaining expression of autophagy-related genes.

Discussion

In this report, we have shown that expression of autophagy-related genes was regulated by age-related signaling. dsir2 (a Drosophila SIRT1 homolog) and dfoxo were required to maintain atg18 expression during aging (Figure 1), suggesting that, among autophagy-related genes, this gene specifically is regulated by foxo/sir2 activity. Interestingly, aging seemed to affect expression of all autophagy-related genes tested, suggesting that aging and foxo/sir2 may act at different levels to regulate autophagy-related gene expression.

Previous studies have shown that sir2, foxo and 4E-BP are involved in regulating the Drosophila lifespan [40]. Our data, however, indicate that 4E-BP antagonized expression of autophagy-related genes (Figure 1D). 4E-BP is believed to be controlled by TOR signaling [39,42]. Therefore, the negative effect of 4E-BP on autophagy-related gene expression may be mediated through the effect of TOR signaling pathway, which also seems to antagonize autophagy-related gene expression.

Autophagy is highly correlated with lysosomal activity, and the autophagy-lysosome pathway is thought to be involved in many cellular processes [5,43]. Recent studies indicate that lysosomal activity affects expression of autophagy-related genes. The lysosome nutrient sensing (LYNUS) machinery is responsible for sensing whether there are sufficient nutrients [44]. Under a sufficient nutrient status, the mammalian target of rapamycin complex 1 (mTORC1, a member of the LYNUS machinery) phosphorylates transcription factor EB (TFEB) on the lysosomal surface and inhibits its nuclear localization [45]. In this way, TFEB is unable to induce expression of lysosomal and autophagy-related genes under nutrient sufficient conditions. These results suggest that the level of autophagy-related genes might be regulated by the state of lysosome formation and autophagy itself. Here, expression of autophagy-related genes was affected by the activity of other autophagy-related genes as well as their own activity, suggesting that auto-feedback regulation is part of the mechanism used to maintain expression of autophagy-related genes in Drosophila.

In this study, we observed that reducing the expression of autophagy-related genes strongly enhanced the neuronal toxicity caused by Aβ expression. Furthermore, reducing atg1 expression using the Df(atg1)/+ heterozygote showed a more severe enhancement of Aβ-dependent neuronal toxicity than reducing atg18 expression using the Df(atg18)/+ heterozygote (Figure 4). Interestingly, atg1 also demonstrated strong auto-feedback regulation, as reducing expression of atg1 resulted in further defects in expression of atg genes. Therefore, it is possible that a drastic reduction in expression of many atg genes may contribute to the neuronal toxicity of Aβ42, and that aging and autophagy may be determinants of AD onset.

Acknowledgements

We gratefully thank Drs. E. Hafen, S.L. Helfand, and P.F. Lasko for gifts of Drosophila strains. We also thank the Bloomington Stock Center (Indiana University) for fly stocks. We acknowledge Dr. W. Maruyama (National Center for Geriatrics and Gerontology) for supportive contributions to these experiments.

Disclosure of conflict of interest

The authors declare that there is no conflict of interests regarding the publication of this paper.

References

  • 1.Lum JJ, DeBerardinis RJ, Thompson CB. Autophagy in metazoans: cell survival in the land of plenty. Nat Rev Mol Cell Biol. 2005;6:439–448. doi: 10.1038/nrm1660. [DOI] [PubMed] [Google Scholar]
  • 2.Ravikumar B, Sarkar S, Davies JE, Futter M, Garcia-Arencibia M, Green-Thompson ZW, Jimenez-Sanchez M, Korolchuk VI, Lichtenberg M, Luo S, Massey DC, Menzies FM, Moreau K, Narayanan U, Renna M, Siddiqi FH, Underwood BR, Winslow AR, Rubinsztein DC. Regulation of mammalian autophagy in physiology and pathophysiology. Physiol Rev. 2010;90:1383–1435. doi: 10.1152/physrev.00030.2009. [DOI] [PubMed] [Google Scholar]
  • 3.Levine B, Mizushima N, Virgin HW. Autophagy in immunity and inflammation. Nature. 2011;469:323–335. doi: 10.1038/nature09782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nedelsky NB, Todd PK, Taylor JP. Autophagy and the ubiquitin-proteasome system: collaborators in neuroprotection. Biochim Biophys Acta. 2008;1782:691–699. doi: 10.1016/j.bbadis.2008.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shen HM, Mizushima N. At the end of the autophagic road: an emerging understanding of lysosomal functions in autophagy. Trends Biochem Sci. 2014;39:61–71. doi: 10.1016/j.tibs.2013.12.001. [DOI] [PubMed] [Google Scholar]
  • 6.Boya P, Reggiori F, Codogno P. Emerging regulation and functions of autophagy. Nat Cell Biol. 2013;15:713–720. doi: 10.1038/ncb2788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lamb CA, Yoshimori T, Tooze SA. The autophagosome: origins unknown, biogenesis complex. Nat Rev Mol Cell Biol. 2013;14:759–774. doi: 10.1038/nrm3696. [DOI] [PubMed] [Google Scholar]
  • 8.Cuervo AM. Autophagy and aging: keeping that old broom working. Trends Genet. 2008;24:604–612. doi: 10.1016/j.tig.2008.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mizushima N, Yoshimori T, Ohsumi Y. The role of Atg proteins in autophagosome formation. Annu Rev Cell Dev Biol. 2011;27:107–132. doi: 10.1146/annurev-cellbio-092910-154005. [DOI] [PubMed] [Google Scholar]
  • 10.Alers S, Löffler AS, Wesselborg S, Stork B. Role of AMPK-mTOR-Ulk1/2 in the regulation of autophagy: cross talk, shortcuts, and feedbacks. Mol Cell Biol. 2012;32:2–11. doi: 10.1128/MCB.06159-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Polson HE, de Lartigue J, Rigden DJ, Reedijk M, Urbé S, Clague MJ, Tooze SA. Mammalian Atg18 (WIPI2) localizes to omegasome-anchored phagophores and positively regulates LC3 lipidation. Autophagy. 2010;6:506–522. doi: 10.4161/auto.6.4.11863. [DOI] [PubMed] [Google Scholar]
  • 12.Suzuki K, Akioka M, Kondo-Kakuta C, Yamamoto H, Ohsumi Y. Fine mapping of autophagy-related proteins during autophagosome formation in Saccharomyces cerevisiae. J Cell Sci. 2013;126:2534–2544. doi: 10.1242/jcs.122960. [DOI] [PubMed] [Google Scholar]
  • 13.Salih DA, Brunet A. FoxO transcription factors in the maintenance of cellular homeostasis during aging. Curr Opin Cell Biol. 2008;20:126–136. doi: 10.1016/j.ceb.2008.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Liu HY, Han J, Cao SY, Hong T, Zhuo D, Shi J, Liu Z, Cao W. Hepatic autophagy is suppressed in the presence of insulin resistance and hyperinsulinemia: inhibition of FoxO1-dependent expression of key autophagy genes by insulin. J Biol Chem. 2009;284:31484–31492. doi: 10.1074/jbc.M109.033936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Juhász G, Puskás LG, Komonyi O, Erdi B, Maróy P, Neufeld TP, Sass M. Gene expression profiling identifies FKBP39 as an inhibitor of autophagy in larval Drosophila fat body. Cell Death Differ. 2007;14:1181–1190. doi: 10.1038/sj.cdd.4402123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Simonsen A, Cumming RC, Brech A, Isakson P, Schubert DR, Finley KD. Promoting basal levels of autophagy in the nervous system enhances longevity and oxidant resistance in adult Drosophila. Autophagy. 2008;4:176–184. doi: 10.4161/auto.5269. [DOI] [PubMed] [Google Scholar]
  • 17.McPhee CK, Baehrecke EH. Autophagy in Drosophila melanogaster. Biochim Biophys Acta. 2009;1793:1452–1460. doi: 10.1016/j.bbamcr.2009.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ling D, Salvaterra PM. A central role for autophagy in Alzheimer-type neurodegeneration. Autophagy. 2009;5:738–740. doi: 10.4161/auto.5.5.8626. [DOI] [PubMed] [Google Scholar]
  • 19.Meléndez A, Tallóczy Z, Seaman M, Eskelinen EL, Hall DH, Levine B. Autophagy genes are essential for dauer development and life-span extension in C. elegans. Science. 2003;301:1387–1391. doi: 10.1126/science.1087782. [DOI] [PubMed] [Google Scholar]
  • 20.Rubinsztein DC, Mariño G, Kroemer G. Autophagy and aging. Cell. 2011;146:682–695. doi: 10.1016/j.cell.2011.07.030. [DOI] [PubMed] [Google Scholar]
  • 21.Saitsu H, Nishimura T, Muramatsu K, Kodera H, Kumada S, Sugai K, Kasai-Yoshida E, Sawaura N, Nishida H, Hoshino A, Ryujin F, Yoshioka S, Nishiyama K, Kondo Y, Tsurusaki Y, Nakashima M, Miyake N, Arakawa H, Kato M, Mizushima N, Matsumoto N. De novo mutations in the autophagy gene WDR45 cause static encephalopathy of childhood with neurodegeneration in adulthood. Nat Genet. 2013;45:445–449. 449e441. doi: 10.1038/ng.2562. [DOI] [PubMed] [Google Scholar]
  • 22.Barnett A, Brewer GJ. Autophagy in aging and Alzheimer’s disease: pathologic or protective? J Alzheimers Dis. 2011;25:385–394. doi: 10.3233/JAD-2011-101989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lee JH, Yu WH, Kumar A, Lee S, Mohan PS, Peterhoff CM, Wolfe DM, Martinez-Vicente M, Massey AC, Sovak G, Uchiyama Y, Westaway D, Cuervo AM, Nixon RA. Lysosomal proteolysis and autophagy require presenilin 1 and are disrupted by Alzheimer-related PS1 mutations. Cell. 2010;141:1146–1158. doi: 10.1016/j.cell.2010.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Pickford F, Masliah E, Britschgi M, Lucin K, Narasimhan R, Jaeger PA, Small S, Spencer B, Rockenstein E, Levine B, Wyss-Coray T. The autophagy-related protein beclin 1 shows reduced expression in early Alzheimer disease and regulates amyloid beta accumulation in mice. J Clin Invest. 2008;118:2190–2199. doi: 10.1172/JCI33585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Nunan J, Small DH. Regulation of APP cleavage by alpha-, beta- and gamma-secretases. FEBS Lett. 2000;483:6–10. doi: 10.1016/s0014-5793(00)02076-7. [DOI] [PubMed] [Google Scholar]
  • 26.Takasugi N, Tomita T, Hayashi I, Tsuruoka M, Niimura M, Takahashi Y, Thinakaran G, Iwatsubo T. The role of presenilin cofactors in the gamma-secretase complex. Nature. 2003;422:438–441. doi: 10.1038/nature01506. [DOI] [PubMed] [Google Scholar]
  • 27.Fossgreen A, Brückner B, Czech C, Masters CL, Beyreuther K, Paro R. Transgenic Drosophila expressing human amyloid precursor protein show gamma-secretase activity and a blistered-wing phenotype. Proc Natl Acad Sci U S A. 1998;95:13703–13708. doi: 10.1073/pnas.95.23.13703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Iijima K, Liu HP, Chiang AS, Hearn SA, Konsolaki M, Zhong Y. Dissecting the pathological effects of human Abeta40 and Abeta42 in Drosophila: a potential model for Alzheimer’s disease. Proc Natl Acad Sci U S A. 2004;101:6623–6628. doi: 10.1073/pnas.0400895101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dong X, Tsuda L, Zavitz KH, Lin M, Li S, Carthew RW, Zipursky SL. ebi regulates epidermal growth factor receptor signaling pathways in Drosophila. Genes Dev. 1999;13:954–965. doi: 10.1101/gad.13.8.954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lim YM, Hayashi S, Tsuda L. Ebi/AP-1 suppresses pro-apoptotic genes expression and permits long-term survival of Drosophila sensory neurons. PLoS One. 2012;7:e37028. doi: 10.1371/journal.pone.0037028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Iijima K, Chiang HC, Hearn SA, Hakker I, Gatt A, Shenton C, Granger L, Leung A, Iijima-Ando K, Zhong Y. Abeta42 mutants with different aggregation profiles induce distinct pathologies in Drosophila. PLoS One. 2008;3:e1703. doi: 10.1371/journal.pone.0001703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kumar S, Rezaei-Ghaleh N, Terwel D, Thal DR, Richard M, Hoch M, Mc Donald JM, Wüllner U, Glebov K, Heneka MT, Walsh DM, Zweckstetter M, Walter J. Extracellular phosphorylation of the amyloid β-peptide promotes formation of toxic aggregates during the pathogenesis of Alzheimer’s disease. EMBO J. 2011;30:2255–2265. doi: 10.1038/emboj.2011.138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Nilsberth C, Westlind-Danielsson A, Eckman CB, Condron MM, Axelman K, Forsell C, Stenh C, Luthman J, Teplow DB, Younkin SG, Näslund J, Lannfelt L. The ‘Arctic’ APP mutation (E6- 93G) causes Alzheimer’s disease by enhanced Abeta protofibril formation. Nat Neurosci. 2001;4:887–893. doi: 10.1038/nn0901-887. [DOI] [PubMed] [Google Scholar]
  • 34.Cheng IH, Palop JJ, Esposito LA, Bien-Ly N, Yan F, Mucke L. Aggressive amyloidosis in mice expressing human amyloid peptides with the Arctic mutation. Nat Med. 2004;10:1190–1192. doi: 10.1038/nm1123. [DOI] [PubMed] [Google Scholar]
  • 35.Lord A, Kalimo H, Eckman C, Zhang XQ, Lannfelt L, Nilsson LN. The Arctic Alzheimer mutation facilitates early intraneuronal Abeta aggregation and senile plaque formation in transgenic mice. Neurobiol Aging. 2006;27:67–77. doi: 10.1016/j.neurobiolaging.2004.12.007. [DOI] [PubMed] [Google Scholar]
  • 36.Schilling S, Zeitschel U, Hoffmann T, Heiser U, Francke M, Kehlen A, Holzer M, Hutter-Paier B, Prokesch M, Windisch M, Jagla W, Schlenzig D, Lindner C, Rudolph T, Reuter G, Cynis H, Montag D, Demuth HU, Rossner S. Glutaminyl cyclase inhibition attenuates pyroglutamate Abeta and Alzheimer’s disease-like pathology. Nat Med. 2008;14:1106–1111. doi: 10.1038/nm.1872. [DOI] [PubMed] [Google Scholar]
  • 37.Morimoto A, Irie K, Murakami K, Masuda Y, Ohigashi H, Nagao M, Fukuda H, Shimizu T, Shirasawa T. Analysis of the secondary structure of beta-amyloid (Abeta42) fibrils by systematic proline replacement. J Biol Chem. 2004;279:52781–52788. doi: 10.1074/jbc.M406262200. [DOI] [PubMed] [Google Scholar]
  • 38.Jawhar S, Wirths O, Bayer TA. Pyroglutamate amyloid-β (Aβ): a hatchet man in Alzheimer disease. J Biol Chem. 2011;286:38825–38832. doi: 10.1074/jbc.R111.288308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Grewal SS. Insulin/TOR signaling in growth and homeostasis: a view from the fly world. Int J Biochem Cell Biol. 2009;41:1006–1010. doi: 10.1016/j.biocel.2008.10.010. [DOI] [PubMed] [Google Scholar]
  • 40.Xiang L, Nakamura Y, Lim YM, Yamasaki Y, Kurokawa-Nose Y, Maruyama W, Osawa T, Matsuura A, Motoyama N, Tsuda L. Tetrahydro-curcumin extends life span and inhibits the oxidative stress response by regulating the FOXO forkhead transcription factor. Aging (Albany NY) 2011;3:1098–1109. doi: 10.18632/aging.100396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ling D, Song HJ, Garza D, Neufeld TP, Salvaterra PM. Abeta42-induced neurodegeneration via an age-dependent autophagic-lysosomal injury in Drosophila. PLoS One. 2009;4:e4201. doi: 10.1371/journal.pone.0004201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Partridge L, Alic N, Bjedov I, Piper MD. Ageing in Drosophila: the role of the insulin/Igf and TOR signalling network. Exp Gerontol. 2011;46:376–381. doi: 10.1016/j.exger.2010.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Settembre C, Fraldi A, Medina DL, Ballabio A. Signals from the lysosome: a control centre for cellular clearance and energy metabolism. Nat Rev Mol Cell Biol. 2013;14:283–296. doi: 10.1038/nrm3565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Zoncu R, Bar-Peled L, Efeyan A, Wang S, Sancak Y, Sabatini DM. mTORC1 senses lysosomal amino acids through an inside-out mechanism that requires the vacuolar H(+)-ATPase. Science. 2011;334:678–683. doi: 10.1126/science.1207056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Settembre C, Zoncu R, Medina DL, Vetrini F, Erdin S, Huynh T, Ferron M, Karsenty G, Vellard MC, Facchinetti V, Sabatini DM, Ballabio A. A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. EMBO J. 2012;31:1095–1108. doi: 10.1038/emboj.2012.32. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from American Journal of Neurodegenerative Disease are provided here courtesy of e-Century Publishing Corporation

RESOURCES