Version Changes
Revised. Amendments from Version 1
We have added some important limitations into the new version, according to the three reviewers.
Abstract
The genetic background of ischemic vascular disease is actively being explored. Several studies have shown that inhibition of APOC3 significantly reduces plasma levels of apolipoprotein C3 and triglycerides. Recently, the TG and HDL Working Group and Jørgensen et al. reported that loss-of-function mutations in APOC3 are associated with decreased triglyceride levels and a reduced risk of ischemic vascular disease in European and African individuals. We performed a replication study in 4470 Chinese participants. The coding regions of APOC3 were amplified and re-sequenced. However, only synonymous and intronic variants with no functional consequences were identified. None of the loss-of-function mutations reported in European and African individuals were observed. Therefore, APOC3 may not be an ideal predictor for risk of ischemic vascular disease in the Chinese population.
Keywords: ischemic vascular disease, risk prediction, APOC3
Correspondence
The genetic basis of ischemic vascular disease such as coronary artery disease is actively being explored. Most studies have focused on susceptibility factors contributing to an increased risk 1, while only a few studies have identified protective variants conferring reduced risk 2. Recently, the TG and HDL Working Group and Jørgensen et al. reported that loss-of-function mutations in APOC3 are associated with decreased triglyceride levels and a reduced risk of ischemic vascular disease in individuals of European and African ancestry 3, 4. Approximately 1 in 150 individuals were heterozygous carriers of at least one of the four mutations: R19X, A43T, IVS2+1G→A, and IVS3+1G→T. Heterozygous carriers for these mutations had a significantly lower incidence of ischemic vascular disease as compared to non-carriers (hazard ratio = 0.59). Triglyceride and circulating APOC3 levels in the carriers were only 61% and 54% of those in non-carriers, respectively. These critical findings prompted us to undertake a replication study in China, where over one million people are affected by cardiovascular diseases each year ( http://www.nhfpc.gov.cn/).
A total of 4470 unrelated Chinese participants were enrolled, including 1488 healthy controls, 1050 patients with ischemic stroke, 628 patients with coronary artery disease, and 1304 patients with venous thrombosis, which could also be exacerbated by effects on the coagulation system resulting from elevated triglyceride levels. The 1488 healthy controls and 1050 patients with ischemic stroke were described in a previous study 5. Briefly, healthy individuals did not present any relevant medical history or family history of ischemic vascular disease. Ischemic stroke was confirmed by brain computed tomography (CT) and/or brain magnetic resonance imaging (MRI). The 1304 patients with venous thrombosis were described previously 6. Thrombosis was confirmed by objective investigations such as color Doppler ultrasonography and/or CT angiography. Patients with coronary artery disease were enrolled in our hospital from September 2013 to March 2014. Coronary artery disease was validated by angiographic evidence of at least one segment of a major coronary with over 50% organic stenosis. The characteristics of the 628 patients with coronary artery disease are summarized in Table 1. Written informed consent was obtained from all participants, and the study was approved by the Ethics Committee of Union Hospital affiliated with Huazhong University of Science and Technology (Approval number 2013-03-0052).
Table 1. Characteristics of the 628 patients with coronary artery disease.
| Characteristic | Number | Percentage |
|---|---|---|
| Onset age (yr, mean) | 61.6 ± 10.8 | |
| <40 | 11 | 1.7% |
| ≥40 and <60 | 256 | 40.8% |
| ≥60 | 361 | 57.5% |
| Sex | ||
| male | 408 | 65.0% |
| female | 220 | 35.0% |
| Coronary artery disease | ||
| angina pectoris | 422 | 67.2% |
| myocardial infarction | 206 | 32.8% |
| Family history | ||
| yes | 32 | 5.1% |
| no | 596 | 94.9% |
| Current smoker | ||
| yes | 157 | 25.0% |
| no | 471 | 75.0% |
| Drinking | ||
| yes | 79 | 12.6% |
| no | 549 | 87.4% |
| Hypertension | ||
| yes | 425 | 67.7% |
| no | 203 | 32.3% |
| Type 2 diabetes | ||
| yes | 175 | 27.9% |
| no | 453 | 72.1% |
| Fasting serum lipid levels | ||
| TC | 3.97 ± 0.99 mmol/L | |
| TG | 1.55 ± 1.05 mmol/L | |
| HDL-C | 1.19 ± 0.29 mmol/L | |
| LDL-C | 2.07 ± 0.76 mmol/L |
TC, total cholesterol; TG, triglycerides; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol.
The diagnosis of myocardial infarction was based on typical chest pain with a duration over 30 min, on electrocardiographic patterns, and on increased creatine kinase MB isoenzyme and troponin I levels. Hypertension is defined as systolic blood pressure ≥ 140 mmHg and/or diastolic blood pressure ≥ 90 mmHg. Type 2 diabetes were clarified using the 1999 WHO criteria, including fasting plasma glucose ≥ 7.0 mmol/L, 2-hour oral glucose tolerance test plasma glucose ≥ 11.1 mmol/L or ongoing therapy for diabetes.
Blood samples were collected into a vacutainer tube containing 0.105 mol/L trisodium citrate and were then centrifuged at 2000 g for 15 minutes. Genomic DNA was isolated using a salt precipitation method and was then used for sequencing. The four exons and the flanking intronic regions of APOC3 were amplified by PCR and then sequenced on an Applied Biosystems ABI 3730 Genetic Analyzer, as previously described 3. The oligonucleotide pairs and annealing temperatures employed in PCR and sequencing are shown in Table 2. In this study, we identified only synonymous and intronic variants, with no functional consequences, and similar genotype distributions across the groups ( Table 3). None of the loss-of-function mutations reported in European and African individuals were observed in the current cohort. Therefore, the genetic background of ischemic vascular disease is highly variable among different ethnic groups, and APOC3 may not be an ideal predictor of risk of ischemic vascular disease in the Chinese population.
Table 2. Primers and annealing temperatures for PCR and sequencing.
| Exon | Forward primer (5'-3') | Reverse primer (5'-3') | AT (ºC) | Product
size (bp) |
|---|---|---|---|---|
| 1 | GCCTTTACTCCAAACACCCC | AGTGCTTCTCCAGGCTTGCT | 58 | 602 |
| 2 and 3 | CCTTCTGAGAGCCCGTATTAGC | CCGCAGCAGCCTGACAAA | 58 | 646 |
| 4 | GGGGCATAAACATCTGAGGT | CTACCAGAAGGTGGATAGAGC | 58 | 693 |
AT, annealing temperature. The accession number of APOC3 reference sequence in GenBank is NG_008949.1.
Table 3. APOC3 variants identified in the 4470 Chinese participants.
| Variables | dbSNP ID | Control group
n = 1488 |
Ischemic stroke
n = 1050 |
Coronary heart disease
n = 628 |
Venous thrombosis
n = 1304 |
|---|---|---|---|---|---|
| Age (yr, mean) | 61.2 ± 12.8 | 62.2 ± 12.3 | 61.6 ± 10.8 | 51.7 ± 13.8 | |
| Male, n (%) | 978 (65.7%) | 691 (65.8%) | 408 (65.0%) | 638 (48.9%) | |
| Variants, n (%) b | |||||
| c.10C>A (p.Arg4=) | novel | ||||
| CC | 1485 (99.8%) | 1048 (99.8%) | 627 (99.8%) | 1301 (99.8%) | |
| CA | 3 (0.2%) | 2 (0.2%) | 1 (0.2%) | 3 (0.2%) | |
| P value | 0.95 | 0.84 | 0.87 | ||
| c.99G>A (p.Gln33=) | rs200557528 | ||||
| GG | 1481 (99.5%) | 1046 (99.6%) | 625 (99.5%) | 1296 (99.4%) | |
| GA | 7 (0.5%) | 4 (0.4%) | 3 (0.5%) | 8 (0.6%) | |
| P value | 0.73 | 0.98 | 0.61 | ||
| c.102T>C (p.Gly34=) | rs4520 | ||||
| TT | 655 (44.0%) | 456 (43.4%) | 278 (44.3%) | 582 (44.6%) | |
| TC | 641 (43.1%) | 449 (42.8%) | 272 (43.3%) | 566 (43.4%) | |
| CC | 192 (12.9%) | 145 (13.8%) | 78 (12.4%) | 156 (12.0%) | |
| P value | 0.80 | 0.95 | 0.75 | ||
| c.179+57G>A | rs2070667 | ||||
| GG | 1098 (73.8%) | 776 (73.9%) | 454 (72.3%) | 967 (74.2%) | |
| GA | 329 (22.1%) | 235 (22.4%) | 148 (23.6%) | 286 (21.9%) | |
| AA | 61 (4.1%) | 39 (3.7%) | 26 (4.1%) | 51 (3.9%) | |
| P value | 0.88 | 0.76 | 0.96 | ||
| c.240G>A (p.Lys80=) | novel | ||||
| GG | 1483 (99.7%) | 1047 (99.7%) | 626 (99.7%) | 1301 (99.8%) | |
| GA | 5 (0.3%) | 3 (0.3%) | 2 (0.3%) | 3 (0.2%) | |
| P value | 0.82 | 0.95 | 0.60 | ||
| c.*40G>C | rs5128 | ||||
| GG | 763 (51.3%) | 535 (51.0%) | 328 (52.2%) | 665 (51.0%) | |
| GC | 562 (37.8%) | 394 (37.5%) | 240 (38.2%) | 494 (37.9%) | |
| CC | 163 (10.9%) | 121 (11.5%) | 60 (9.6%) | 145 (11.1%) | |
| P value | 0.90 | 0.64 | 0.98 | ||
| c.*71G>T | rs4225 | ||||
| GG | 1006 (67.6%) | 703 (66.9%) | 416 (66.2%) | 880 (67.5%) | |
| GT | 414 (27.8%) | 304 (29.0%) | 180 (28.7%) | 368 (28.2%) | |
| TT | 68 (4.6%) | 43 (4.1%) | 32 (5.1%) | 56 (4.3%) | |
| P value | 0.73 | 0.79 | 0.92 |
dbSNP, single nucleotide polymorphism database of the National Center for Biotechnology Information ( http://www.ncbi.nlm.nih.gov/projects/SNP).
Comparisons between the controls and each case group were assessed with the use of the chi-square test. A two tailed P<0.05 was considered significant.
However, there are some limitations in this study. First, we only analyzed the coding sequence, as in the studies carried out in European and African individuals. Potential effects from large deletions and mutations in regulatory regions of the gene cannot be excluded. Previous studies have revealed two promoter polymorphisms (T-455C and C-482T) that affect the expression of APOC3. However, their relationship with coronary artery disease was not observed in a Han Chinese population 7. Second, the consequences of the synonymous mutations and the intronic mutations identified here were only predicted by an on-line bioinformatics tool ( http://www.fruitfly.org/seq_tools/splice.html). Third, the triglyceride levels were not available for the patients with venous thrombosis. Thus, the triglyceride levels according to the genotypes were not further analyzed. Nevertheless, considering the relatively large sample size, we suggest that functional variants in APOC3 could be very rare in China. Further studies are warranted to understand the genetic basis governing triglyceride levels and conferring protective effects on ischemic vascular disease in the Chinese population.
Consent
Written informed consent to publish these data has been obtained by each participant.
Funding Statement
This study was supported by grants from the National Natural Sciences Foundation of China (No. 81370622 and No. 81400099) and the Independent Innovation Foundation of Huazhong University of Science and Technology (No. 01-18-530045, 2013QN213).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
v2; ref status: indexed
References
- 1.Peden JF, Farrall M: Thirty-five common variants for coronary artery disease: the fruits of much collaborative labour. Hum Mol Genet. 2011;20(R2):R198–205. 10.1093/hmg/ddr384 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Golovkin AS, Ponasenko AV, Khutornaya MV, et al. : Association of TLR and TREM-1 gene polymorphisms with risk of coronary artery disease in a Russian population. Gene. 2014;550(1):101–9. 10.1016/j.gene.2014.08.022 [DOI] [PubMed] [Google Scholar]
- 3.Jørgensen AB, Frikke-Schmidt R, Nordestgaard BG, et al. : Loss-of-function mutations in APOC3 and risk of ischemic vascular disease. N Engl J Med. 2014;371(1):32–41. 10.1056/NEJMoa1308027 [DOI] [PubMed] [Google Scholar]
- 4.The TG and HDL Working Group of the Exome Sequencing Project, National Heart, Lung, and Blood Institute: Loss-of-function mutations in APOC3, triglycerides, and coronary disease. N Engl J Med. 2014;371(1):22–31. 10.1056/NEJMoa1307095 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Lu X, Tang L, Xu K, et al. : Novel association of a PROC variant with ischemic stroke in a Chinese Han population. Hum Genet. 2013;132(1):69–77. 10.1007/s00439-012-1225-8 [DOI] [PubMed] [Google Scholar]
- 6.Tang L, Wang HF, Lu X, et al. : Common genetic risk factors for venous thrombosis in the Chinese population. Am J Hum Genet. 2013;92(2):177–187. 10.1016/j.ajhg.2012.12.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Yu J, Huang J, Liang Y, et al. : Lack of association between apolipoprotein C3 gene polymorphisms and risk of coronary heart disease in a Han population in East China. Lipids Health Dis. 2011;10:200. 10.1186/1476-511X-10-200 [DOI] [PMC free article] [PubMed] [Google Scholar]