Genes for biosynthesis of butenolide-like signalling molecules in Streptomyces ghanaensis, their role in moenomycin production

Abstract

Moenomycins (Mm) – phosphoglycolipid compounds produced by Streptomyces ghanaensis ATCC14672 – are considered a promising model for development of novel class of antibiotics. In this regard it is important to generate Mm overproducing strains which would be a basis for economically justified production of this antibiotic. In this work a set of genes for synthesis and reception of low-molecular weight signaling molecules (LSM) in ATCC14672 were described and their significance for Mm production was studied. The ATCC14672 genome carries structural and regulatory genes for production of LSMs of avenolide and γ-butyrolactone families. Additional copies of LSM biosynthetic genes ssfg_07848 and ssfg_07725 did not alter the Mm production level. ATCC14672 LSMs are not capable of restoring the sporulation of butyrolactone-nonproducing mutant of S. griseus. Likewise, while the heterologous host S. lividans 1326 produced Mm, its mutant M707 (deficient in the butyrolactone synthase gene scbA) did not. Thus, while the natural level of LSMs production by ATCC14672 does not limit Mm synthesis, the former is essential for the synthesis of moenomycins.

Introduction

Prokaryotes are engaged in extensive intercellular interactions mediated by the synthesis, secretion and reception of low molecular weight signaling metabolites (molecules; LSMs) [1]. “Chemical communication” is known for a long time in bacteria, and it underlies the quorum sensing, a special kind of regulation of gene expression in bacteria that depends on population density and concentrations of the LSMs [1, 2]. These communication systems are present among streptomycetes – members of the class Actinobacteria, main industrial producers of antibacterial compounds, and they are based on butenolide scaffold [3–6]. In these bacteria, LSMs are involved in pleiotropic regulation of morphogenesis and secondary metabolism [7–10]. At the moment 14 LSMs of γ-butyrolactone type have been identified, and they are produced by seven streptomycete species. General mechanism of action of these LSMs is based on binding of repressor protein; as a result, the latter releases promoter region and thus activates gene transcription [8, 9]. A-factor (2-(6′-methylheptanoyl)-3R-hydroxymethyl-4-butanolide) is the best studied member of γ-butyrolactone family. A-factor – positive regulator of streptomycin synthesis and morphogenesis in Streptomyces griseus [10].

Recently second group of butenolide-like LSMs has been found in streptomycetes, that structurally are furan derivatives. Methylenomycin furans of S. coelicolor and avenolides of S. avermitilis fall into this group; they are involved in regulation of production of antibiotics methylenomycin and avermectin, respectively [11, 12]. According to bioinformatics data [11], some of the genes for biosynthesis of avenolide-like LSMs are located in the genomes of several other streptomycetes, particularly in Streptomyces ghanaensis ATCC14672. This strain is interesting because of its ability to produce phosphoglycolipid antibiotics moenomycins (Mm), in particular moenomycin A (MmA, fig. 1), which is major component of Mm mixture accumulated by ATCC14672. MmA directly inhibits peptidoglycan glycosyltrasferases, vital enzymes involved in bacterial cell wall formation [13]. No other classes of antibiotics are described so far that would exhibit the same or similar mode of action. Initial level of Mm production by ATCC14672 is minute. This prompts to investigate the mechanisms of regulation of Mm biosynthesis. In this regard, the transcriptional and translational regulatory mechanisms are studied relatively well [13, 14]. Yet, the role of LSMs in Mm biosynthesis remained unstudied. We note that heterologous expression of Mm biosynthetic genes (moe) in S. coelicolor, S. lividans and S. albus has been employed previously to study the genetics of regulation [13, 14]. This is explained by the difficulties of making gene knockouts in ATCC14672, and relatively high productivity of heterologous hosts, as well as by the fact that the genomes of the latter carry genes homologous to pleiotropic regulators of secondary metabolism of S. ghanaensis. Therefore, in this work we pursued following aims: to annotate all structural and regulatory genes involved in formation of communicative systems of Streptomyces ghanaensis; to study the role of LSMs in Mm production via overexpression of certain LSM-related genes; to reveal the influence of deletion of γ-butyrolactone synthase gene scbA of S. lividans M707 on heterologous production of Mm by this strain.

Fig. 1.

Structural formulae of moenomycins mentioned in the text. Moenomycin A – main product in the moenomycin biosynthetic pathway of S. ghanaensis ATCC14672. Nosokomycin B₂ is accumulated by S. lividans 1326 upon introduction of cosmid moeno38-5

Materials and methods

Draft genome sequence of S. ghanaensis ATCC14672 and BLASTP program, both accessible via NCBI (www.ncbi.nlm.nih.gov), were used to search genes involved in biosynthesis and reception of LSMsa and to perform pairwise alignments.

In this work we used strain S. coelicolor M145 (producer of actinorhodin; a derivative of wild type A3(2) strain lacking plasmids SCP1 and SCP2), wild type MmA producer S. ghanaensis ATCC14672 as well as its mutants: ΔadpA_gh, impaired in aerial mycelium formation [14]; ΔmoeO5 impaired in the first step of MmA biosynthesis [14]; Δssfg_05654 that has lost the ability to produce aerial mycelium on solid medium TSA [21]. We also use wild type S. lividans 1326 and its mutant M707 carrying the deletion of scbA (provided by Prof. E. Takano, Manchester university, UK). Mutant of S. griseus IFO13350 with impaired biosynthesis of A-factor was provided by Prof. B. Matseliukh (D.K. Zabolotnyy Institute of Microbiology and Virology of NASU). Strains Escherichia coli DH5α Ta ET12567 (pUZ8002), which were used for generation and transfer of recombinant plasmids, are described in [15]. S. ghanaensis ATCC14672, S. lividans 1326, M707 and their derivatives were grown on solid oatmeal and TSB media [13, 15], and in liquid TSB (tryptone – 17 g, glucose – 2.5 g, NaCl – 5g, K₂HPO₄ – 2.5, soy hydrolyzate – 10, H₂O) – to 1L). Strains of E. coli were grown according to standard protocols [15]. The media for growth of recombinant actinomycete and E. coli strains were amended with apramycin (Am) and kanamycin (Km) at concentration of 50 μg/ml. Structural and regulatory genes for biosynthesis of LSMs of S. ghanaensis were cloned into vector pKC1139, which is based on temperature-sensitive pSG5 replicon [15]. Recombinant plasmids and cosmid moeno38-5 controlling nosokomycin B₂ synthesis (see fig. 1) were transferred into actinomycete strains via intergeneric conjugation from E. coli ET12567 (pUZ8002).

Total and plasmid DNA isolation, restriction endonuclease digestion, DNA ligation, DNA electrophoresis and E. coli transformation were carried out according to standard methods [15]. PCR was carried out as in [14] using PTC100 MiniCycler (“MJ Research”, USA). Intergeneric conjugation E. coli – S. ghanaensis was carried as in [13]. DNA sequencing was performed by Sanger method at the Biopolymers facility of Harvard Medical School (Boston, USA)

Mm purification from the biomass and its quantitative analysis via disc diffusion assay and liquid chromatography coupled to mass spectrometry was carried out according to [13].

Results and discussion

Bioinformatic analysis of the genes encoding LSM systems in S. ghanaensis

An in silico analysis showed the presence in S. ghanaensis the of the genes, encoding putative structural, regulatory and receptor proteins involved in metabolism of LSMs of butenolide types (γ-butyrolactones and avenolides). The identified genes of S. ghanaensis have homologues in the genomes of strains S. coelicolor, S. griseus and S. avermitilis (Table 1).

Table 1.

Genetic components of LSM systems of S. ghanaensis and their homologues in S. coelicolor, S. griseus and S. avermitilis

Streptomyces ghanaensis ATCC14672			Homologues
No	Protein	Function	Gene	Protein	Strains	Similarity %
1	Ssfg_07724	Butyrolactone receptor	scbR	A-factor receptor	S. coelicolor	46
2	Ssfg_07725 (AfsAgh)	Regulator/Necessary for LSM synthesis	afsA	A-factor sythesis	S. griseus	44
3	Ssfg_07843	TetR-like regulator	scbR	TetR-like A-factor receptor	S. coelicolor	45
4	Ssfg_07848 (AvaRgh)	Autoregulatory receptor protein	avaR	Avenolide receptor	S. avermitilis MA-4680	75
5	Ssfg_07849	Acyl-CoA oxidase	aco	Acyl-CoA oxidase	S. avermitilis MA-4680	48
6	Ssfg_01628	TetR-like A-factor receptor	cprA	ArpA-like receptor	S. coelicolor	76

Protein product of gene sfg_07725 – AfsA_gh - is the component of the first hormonal system. Like its homologues (Table 1), it contains FabZ domain that functions as thioesterdehydratase, and participates in fatty acid metabolism, whose intermediates are necessary for synthesis of A-factor [12, 16]. Gene ssfg_07725 is located on one terminus of linear S. ghanaensis chromosome near the divergently situated gene ssfg_07724. The protein product of the latter is possible A-factor receptor. Gene ssfg_01628 encodes TetR family protein homologous to ArpA-like receptor of S. coelicolor.

Gene ssfg_07848 for presumable avenolide receptor is located in one cluster with genes aco_gh and cyp encoding acyl-CoA oxidase and cytochrome hydroxylase, respectively. They are located the terminal region of S. ghanaensis chromosome (opposite of A-factor biosynthetic genes), and homologous to genes for biosynthesis of avenolide of S. avermitilis. Translation product of ssfg_07848 – a TetR-like protein, with characteristic secondary structure of DNA-binding helix-turn-helix domain. Analysis of available at the moment streptomycete genomes showed that S. ghanaensis, unlike the vast majority of the other members of Streptomyces, possesses genes for two communicative systems – that of γ-butyrolactone and avenolide types.

Introduction of additional copies of ssfg_07848 and sfg_07725 into S. ghanaensis ATCC14672 cells does not influence Mm production level

To introduce extra copies of ssfg_07848 and sfg_07725 into S. ghanaensis, several pKC1139-based plasmid have been generated. Fragments of S. ghanaensis chromosome containing ssfg_07848 and sfg_07725 (654 bp and 957 bp in size, respectively) were amplified with primers decorated at the ends with EcoRI and HindIII recognition sites. To amplify sfg_07725 we used primers: afsA-ghf (AAAGAATTCATAGCCTGCCCAGCCGGTTGG) and afsA-ghr (AAAAAGCTTTCAGATCCAGGCGGCATCCGC). To amplify ssfg_07848 we used primers avaR-ghf, avaRr-ghr (AAAGAATTCATCCAGATCAGAGGGCGCGC, AAAAAGCTTTCAGCTGCTCATCGGCTCCG, respectively). Amplified and gel-purified DNA fragments were digested with EcoRI and HindIII, and then purified and ligated to linearized vector pKC1139. E. coli DH5α was transformed with the ligation mixture and recombinant plasmid were selected on indicator plates containing chromogenic substrate X-Gal. The cloning of aforementioned genes into the vector was verified via mapping and sequencing. The generated plasmids were labeled as pKCafsA_gh and pKCavaR_gh. They were transferred conjugally into S. ghanaensis ATCC14672 from E. coli ET12567 (pUZ8002). Colonies of the transconjugants S. ghanaensis (pKCafsA_gh) and S. ghanaensis (pKCavaR_gh) did not differ from control strain (S. ghanaensis carrying empty vector pKC1139) in growth rate, sporulation and antibiotic resistance. The transconjugants had the same level of Mm production as compared to the control strain (fig. 2).

Fig. 2.

Level of Mm production by S. ghanaensis and S. lividans strains. 100 % production is the level of wild type (ATCC14672), approximately 1mg/L in TSB. For S. lividans strain 1326 the nosokomycin B₂ productivity was around 0.2 mg/L in TSB. The data are mean values of three independent experiments referred back to equal amounts of dry biomass.

LSMs produced by S. ghanaensis did not restore normal morphological development of S. griseus afsA mutant

Structural and regulatory genes for γ-butyrolactone biosynthesis in S. ghanaensis are similar to afs genes of S. griseus, which points to the structural relatedness (probably, identity) of LSMs, whose production they control. To check this suggestion, we performed the test on restoration of sporulation of afsA mutant of S. griseus with the strains of S. ghanaensis. In this test S. ghanaensis strains are secretors of LSMs, which, in case of their functional similarity to A-factor of S. griseus, would restore the aerial mycelium formation and sporulation to S. griseus IFO13350 mutant. As secretors we used following strains: S. ghanaensis: ATCC14672, S. ghanaensis (pKCafsA_gh), S. ghanaensis ΔmoeO5 (deletion of key Mm biosynthesis gene, no Mm production), S. ghanaensis ΔadpA (knockout of the master regulatory gene for secondary metabolism and morphogenesis), and model actinomycete S. coelicolor M145. When growing in the vicinity of the afsA mutant, none of the investigated streptomycetes was able to restore normal colony development to the afsA mutant when growing in the vicinity of the latter (fig. 3A). γ-butyrolactones produced by different actinomycetes are structurally similar. Yet, only one case was describedwhen LSMs of one species restored the sporulation of another LSM-deficient species [4, 10]. In the same time, wild type S. ghanaensis strain partially restored the sporulation of S. ghanaensis Δssfg_05654 when growing on TSB agar (fig. 3B). This points to the ability of S. ghanaensis to produce and excrete LSMs. That is why our result, most probably, shows that LSMs produced by S. ghanaensis are quite different structurally from A-factor, and they cannot be recognized by the receptor proteins of S. griseus.

Fig. 3.

Results of tests on chemical complementation of impaired morphogenesis in streptomycetes. A. Complementation of afsA mutant of S. griseus by different strains. 1 – S. griseus ΔafsA, 2 - S. coelicolor M145, 3 – S. ghanaensis (pKCafsA_gh), 4 - S. ghanaensis ghanaensis ΔadpA, 5 - S. ghanaensis ΔmoeO5, 6 - ATCC14672. B. Complementation of impared morphogenesis of ssfg_05654 mutant S. ghanaensis (1) with wild type S. ghanaensis ATCC14672 (2).

Influence of deletion of scbA gene on moenomycin production by S. lividans

In both S. coelicolor and S. lividans genes scbA and scbR of encode γ-butyrolactone synthase and receptor protein with DNA-binding properties, respectively [17]. These genes play key role in LSM synthesis and regulatory pathways the LSMs are part of. Mutations in these genes have different effects on production of secondary metabolites. Particularly, scbA deletion caused early start of production of actinorhodin and undecylprodigiosin in S. coelicolor [2], while in S. griseus deletion of afsA, (scbA orthologue) led to complete cessation of streptomycin production [6]. Presumably, opposite effects of these mutations are caused by peculiarities of mechanisms of hormonal regulation in the aforementioned species. We showed previously that S. lividans, carrying cosmid moeno38-5 is able to produce nosokomycin B₂ (member of Mm family, see fig. 1) on a relatively high level [13]. Taking into account the difficulty of genetic manipulations of S. ghanaensis, absence of information on chemical structure of LSMs and their production level in native Mm producer, we decided to investigated the role of LSMs in Mm biosynthesis in heterologous S. lividans strains: 1326 (wild type) and M707 (deletion of scbA). The cosmid moeno38-5 was transferred into the both strains. Methanol extracts of the biomass of 1326 moeno38-5⁺ and M707 moeno38-5⁺ were analyzed with bioassays and high-performance liquid chromatography coupled to mass spectrometry. Extract of 1326 moeno38-5⁺ contained the nosokomycin B₂, while M707 moeno38-5⁺ extract showed neither activity in bioassays nor mass-peaks expected for nosokomycin B₂ (see fig. 2). Therefore, S. lividans 1326 scbA gene is a positive regulator of Mm biosynthesis.

In conclusion, we suggest that moenomycin biosynthesis, not regulated at the pathway-specific level [13, 18], is still a subject for global regulation from LSM-dependent pathways. S. ghanaensis genome analysis witnesses the presence of gene sets for synthesis and reception of two butenolide-like classes of LSMs, that of γ-butyrolactone and avenolide families. Experiments are being carried out in our laboratories to determine the fact of accumulation of avenolide-like compounds by S. ghanaensis cells and to reveal their role in Mm biosynthesis. In the same time, we already can state that LSMs of γ-butyrolactone family are necessary for Mm production. This statement is supported by inability of M707 moeno38-5⁺ strain to produce nosokomycin B₂. However, natural level of synthesis of LSMs in S. ghanaensis is likely to be high enough in order not to limit the Mm production. This is evident from the fact that overexpression of several LSM production-associated genes did not lead to increase in Mm titers. Our results set the groundwork for more detailed investigations of function and interaction of pathways to LSMs in S. ghanaensis.